ID: 915488727

View in Genome Browser
Species Human (GRCh38)
Location 1:156239890-156239912
Sequence CTGGGGAACCAGCAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 1, 2: 9, 3: 50, 4: 559}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915488727_915488737 -4 Left 915488727 1:156239890-156239912 CCCCCCTCCTGCTGGTTCCCCAG 0: 1
1: 1
2: 9
3: 50
4: 559
Right 915488737 1:156239909-156239931 CCAGCCCTTTTCCCTGGCCCTGG 0: 1
1: 0
2: 4
3: 58
4: 544
915488727_915488740 1 Left 915488727 1:156239890-156239912 CCCCCCTCCTGCTGGTTCCCCAG 0: 1
1: 1
2: 9
3: 50
4: 559
Right 915488740 1:156239914-156239936 CCTTTTCCCTGGCCCTGGCTTGG 0: 1
1: 0
2: 2
3: 47
4: 443
915488727_915488733 -10 Left 915488727 1:156239890-156239912 CCCCCCTCCTGCTGGTTCCCCAG 0: 1
1: 1
2: 9
3: 50
4: 559
Right 915488733 1:156239903-156239925 GGTTCCCCAGCCCTTTTCCCTGG 0: 1
1: 0
2: 2
3: 41
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915488727 Original CRISPR CTGGGGAACCAGCAGGAGGG GGG (reversed) Intronic
900032172 1:380047-380069 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
900052722 1:608233-608255 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
900184164 1:1325169-1325191 CTGGGGGGCCAGCAGGAGACGGG - Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900598779 1:3494251-3494273 GTGGGGAGCCAGCAGCAGTGGGG - Intronic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901286835 1:8087107-8087129 ATGGGGAAAAGGCAGGAGGGAGG - Intergenic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902638018 1:17747761-17747783 CTGGGGACCCTTCAGGAGGCCGG + Intergenic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903323448 1:22556011-22556033 ATGGGGATCAGGCAGGAGGGGGG - Intergenic
903466698 1:23556961-23556983 CTGGGGAGCCACCAGGGGTGTGG + Intergenic
903479163 1:23640437-23640459 GTGAGGACCCAGCAAGAGGGTGG + Exonic
903650313 1:24917976-24917998 GGAGGGAACCAGCAGGAGTGTGG + Intronic
903800228 1:25961729-25961751 GTGGGGAACAAGCAGTAGAGTGG - Exonic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905173467 1:36122745-36122767 CTGGGGAACAAGGATGAAGGGGG - Intronic
905732921 1:40308412-40308434 CCCTGGCACCAGCAGGAGGGAGG + Intronic
905930174 1:41781322-41781344 GTGTGGAATGAGCAGGAGGGAGG - Intronic
907330340 1:53666783-53666805 CTGGGGAGCCAGCAGGGCAGGGG + Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
908462275 1:64357163-64357185 TTGGGGAAGCAGCAGCAGCGTGG - Intergenic
910077526 1:83298579-83298601 ATAGGGATCCATCAGGAGGGTGG + Intergenic
910220974 1:84889207-84889229 CTGGCAAGCCAGCTGGAGGGTGG - Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
912680273 1:111725008-111725030 GTGGGGGAGCTGCAGGAGGGAGG - Exonic
912713509 1:111966076-111966098 CTGGGGAGCCAGCAGCAGGGTGG - Intronic
913195040 1:116449234-116449256 CTGGGGTACCTGCAGGAAGTGGG - Intergenic
913481674 1:119294774-119294796 TTGGAGAACAGGCAGGAGGGTGG - Intergenic
914376590 1:147078278-147078300 CTGGGTAACCAGGAGCAGGCAGG - Intergenic
915299083 1:154941822-154941844 CTGGGGAGGCAGCAGGAGACGGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916080398 1:161228631-161228653 ATGGGGAATCAGCAGAATGGAGG - Intronic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917564373 1:176196927-176196949 GAGTGAAACCAGCAGGAGGGAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921178522 1:212613739-212613761 CTTGGGAACCAACTGCAGGGAGG + Intronic
921180153 1:212625677-212625699 CTGAGGAGCCAGCAACAGGGGGG + Exonic
921747181 1:218752151-218752173 CTTGGGAACAGGTAGGAGGGGGG + Intergenic
923267372 1:232327768-232327790 TTGGGGAACAATAAGGAGGGAGG - Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924129330 1:240889400-240889422 ATGGGACACCAGCAGCAGGGTGG + Intronic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
924886068 1:248218173-248218195 CTGGGGAAATAGCAACAGGGTGG + Intergenic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1062915819 10:1240659-1240681 ATGGGGAACCAGCACAGGGGAGG - Intronic
1063663106 10:8047210-8047232 CTGGGGAACCGGCAGGTAGGTGG + Intergenic
1063856016 10:10254943-10254965 CTGGGGACCCAGCTTTAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064349720 10:14565946-14565968 CTGTGGAACTCGCAGCAGGGCGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064366790 10:14715789-14715811 CTTGAGAACCACCAGGAGGTTGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065523409 10:26593949-26593971 CTCGGGAACCACCAGGAGCCAGG + Intergenic
1065529339 10:26653080-26653102 CTCGGGAACCACCAGGAGCCAGG + Intergenic
1065637035 10:27743664-27743686 CCGGGGAACCTGCAGGGGCGGGG - Intronic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1067058697 10:43066712-43066734 CTTGGGAACCATGAGCAGGGTGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067272650 10:44805426-44805448 CTGGGGATCCAGCAGGGGAAAGG + Intergenic
1067538506 10:47135035-47135057 ATGGGGAAGCAGCAGAAGTGGGG + Intergenic
1067696072 10:48536488-48536510 CTGAGTAACTAGCAGGTGGGGGG - Intronic
1067828689 10:49597624-49597646 CTGAGGACCCTGCAGGAGGATGG - Intergenic
1067941367 10:50659750-50659772 CAGGGGCACCAGCAGGCGCGAGG - Intergenic
1068767310 10:60778310-60778332 CTAGAGAAAAAGCAGGAGGGCGG - Intronic
1069582504 10:69575236-69575258 CTCAGGAACCAGCGAGAGGGGGG + Intergenic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1071530509 10:86387762-86387784 CTGGAGAAAAACCAGGAGGGTGG - Intergenic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072793808 10:98338844-98338866 CTGGGGGACAAGGAGAAGGGAGG - Intergenic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1074039293 10:109772241-109772263 CTGGGGAACCTCTAGTAGGGAGG - Intergenic
1074184019 10:111085854-111085876 TTGGGGAACAGGCTGGAGGGAGG + Intergenic
1074574061 10:114651877-114651899 CTGGGGACCCAGCATGCTGGAGG + Intronic
1075233924 10:120709602-120709624 CTGCGGGATCAGCTGGAGGGAGG + Intergenic
1075836154 10:125454535-125454557 CTCAGGAGCCAACAGGAGGGTGG - Intergenic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1076863038 10:133150988-133151010 CTGGGGAGGCCGCAGGATGGCGG - Intergenic
1077177485 11:1197330-1197352 CTGAGGACCCAGCAGGAGTAGGG - Intronic
1077191438 11:1257432-1257454 CTCGGGTACCAGCCCGAGGGAGG + Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077301609 11:1849826-1849848 CTGGGGGACCGGGAGGAAGGTGG + Intergenic
1077333771 11:1994502-1994524 CCAGGGGACCAGGAGGAGGGAGG - Intergenic
1078170388 11:8925004-8925026 TGAGGGAACCAGCAGGAGAGTGG + Intronic
1078869173 11:15327977-15327999 GTGGGGAATGAGCAGGAGTGGGG + Intergenic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1079292642 11:19202043-19202065 CTGGGGGAAGGGCAGGAGGGAGG + Intronic
1081162902 11:39772706-39772728 CTGAGAAACAAGCAGGAGTGGGG + Intergenic
1081662520 11:44896723-44896745 CTGGGGAACCCACAGTGGGGAGG - Intronic
1081664245 11:44907202-44907224 GTGGGTCACCAGCAGGTGGGTGG - Intronic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084199086 11:67543424-67543446 CTGGGGTACCAGCATGGGGAGGG + Intergenic
1084554105 11:69865554-69865576 CTGGGACACCAGCAGGGGAGGGG - Intergenic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085119404 11:73957555-73957577 CTGCGGCACCTGGAGGAGGGAGG - Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089576439 11:119447698-119447720 CTGAGGACCCAGCATGTGGGAGG - Intergenic
1089622430 11:119729426-119729448 CTGGGGAGCCGGCTGGAGCGCGG + Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1202816752 11_KI270721v1_random:49684-49706 CCAGGGGACCAGGAGGAGGGAGG - Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1092003794 12:5052040-5052062 CTGGGGATCCTGGAGGAGGCAGG + Intergenic
1092007447 12:5081254-5081276 CTGGTGACCCAGCAGGGCGGAGG + Intergenic
1092106706 12:5926472-5926494 CCAGGGAGCCAGCAGGAGAGAGG - Intronic
1092160225 12:6311754-6311776 CTTGGGAAAAAGCTGGAGGGAGG - Intronic
1092190055 12:6512639-6512661 CTGGGGAGCCACAAGCAGGGAGG + Intronic
1092196436 12:6552341-6552363 GTGGGGAGCCAGCAGGGTGGTGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1096529376 12:52233541-52233563 CTGGCGCACCCGCTGGAGGGAGG - Exonic
1096659862 12:53117680-53117702 CTGGGGAGGCAGTGGGAGGGTGG + Intronic
1096964121 12:55611495-55611517 ATGGGGAAGCAGCAGGGAGGGGG + Intergenic
1097180351 12:57168283-57168305 CTGGAGAACCTGCAGGGGGCTGG - Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100406449 12:94276463-94276485 AGGTGGAACCAGAAGGAGGGAGG + Intronic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1100815269 12:98380929-98380951 CTGGTGAACCAGCACCAGGCAGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1102122161 12:110450128-110450150 CTGGGGCCCGAGAAGGAGGGAGG - Intronic
1102239301 12:111314027-111314049 CCGGGGACCAGGCAGGAGGGAGG - Intronic
1102258903 12:111431328-111431350 CTAGGGAACCACCTGGAAGGGGG + Intronic
1102315462 12:111883956-111883978 CTAGGGATGCAACAGGAGGGAGG - Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102504498 12:113375028-113375050 CTGGGGGATGAGCAGGTGGGTGG + Intronic
1103181730 12:118918065-118918087 TTGGGGACCCAACAGAAGGGAGG + Intergenic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1104846615 12:131850289-131850311 CTGGGGGAGCAGCAGGGGCGAGG - Intronic
1104920641 12:132288794-132288816 CGTTGGAACCGGCAGGAGGGTGG + Intronic
1105005787 12:132719758-132719780 CTCGGGAAGCAGCGTGAGGGTGG + Intronic
1105543002 13:21330995-21331017 CTGGGGAACCAGCCTGAGACAGG - Intergenic
1106250292 13:27977546-27977568 CCGGGGAAGCCGCAGGAAGGAGG - Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106568812 13:30908563-30908585 CTCGGGAATCAGGAGGTGGGAGG + Intronic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1107869885 13:44736556-44736578 CTGGGGAGCCACAAGGAGAGGGG + Intergenic
1109470538 13:62799021-62799043 CTTGGGGACCAGGAGCAGGGAGG + Intergenic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1114556567 14:23565690-23565712 CTGGGGTACCACCTGGAGGGAGG + Exonic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115573168 14:34686236-34686258 GTGGAGAACAAGCAGGAGGTGGG + Intergenic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1120027460 14:79602513-79602535 CTGGGGTGCTATCAGGAGGGAGG - Intronic
1121431468 14:93891264-93891286 CTGGGGTACCAGGAGGAACGGGG - Intergenic
1121500629 14:94434083-94434105 CTCGGTAACCAGCAGGGGGCAGG + Intergenic
1122984486 14:105205912-105205934 TGGGGGCACCAGCAGGTGGGCGG - Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1124019331 15:25904908-25904930 CTGGGTACCCAGCATGAGTGGGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125522221 15:40354630-40354652 GCGGGGAAGCAGCAGGAGAGAGG - Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127653639 15:61034567-61034589 CTGGGGAACTGCCAGTAGGGAGG + Intronic
1127833548 15:62771770-62771792 CTGGGGGACCACCAGGCAGGAGG + Intronic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128160534 15:65420850-65420872 CTGGGGAAGACGCAGGAAGGAGG - Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128704151 15:69826308-69826330 CAAGGGAACCAGCAGGTGGTTGG - Intergenic
1128895118 15:71366036-71366058 CTGGGACACAAGTAGGAGGGAGG - Intronic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1129609764 15:77043880-77043902 GTGTGGAGGCAGCAGGAGGGAGG + Exonic
1129688523 15:77700080-77700102 CTGGGGAACCAGCAGAGGGGAGG + Intronic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132147694 15:99438187-99438209 CATGTGGACCAGCAGGAGGGCGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132478600 16:154440-154462 CTGGGGAACCTCCAGGACGGGGG - Exonic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133612730 16:7448674-7448696 CTGGGGAGCCACCAGGAGCCAGG - Intronic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1133997880 16:10761991-10762013 TTGGGGTGCCAGCTGGAGGGTGG - Intronic
1134021560 16:10924617-10924639 CTGGGGAATTAGCAGGCTGGGGG - Exonic
1134904912 16:17972040-17972062 GTGGGGCACCAAGAGGAGGGTGG - Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136656211 16:31710851-31710873 CTGGGGTCCCAGGAGGATGGTGG - Intergenic
1139463335 16:67140390-67140412 CTGCGGAACAAGCAAGAGTGGGG - Intronic
1139469249 16:67169652-67169674 CTGGACATCCAGCAGGAGTGGGG - Exonic
1141464964 16:84199268-84199290 CTGGGAAAACGGCAGGCGGGAGG + Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142981744 17:3676404-3676426 CTGGGGAACCGGGAGGACGGAGG + Intronic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143443773 17:6995705-6995727 CTGGGGAGCCAGGAGGAAGTAGG - Intronic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1144577025 17:16435792-16435814 CTGGGAAACCAGCAGGCTGTGGG - Intronic
1144780425 17:17805587-17805609 CTGGGGACCCACCAGGCAGGTGG - Intronic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145881849 17:28357782-28357804 CTGGGGAAGAAGCACAAGGGCGG + Exonic
1145978616 17:28998412-28998434 CTGGGGACCCAGGGGTAGGGAGG + Intronic
1146520282 17:33520883-33520905 CTGTGGAACCAGCAGGCTAGGGG + Intronic
1146583318 17:34059381-34059403 ACAGGGAACCATCAGGAGGGTGG + Intronic
1146967772 17:37047498-37047520 CTGGGGAACAGGGAGGAGAGGGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147161850 17:38573034-38573056 CTCGGGTTGCAGCAGGAGGGAGG + Intronic
1147361620 17:39934203-39934225 CTGGGGAACCAAGTGCAGGGAGG + Intergenic
1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG + Exonic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148761467 17:50004115-50004137 CTTGGGAATAAGCAGGAGGCAGG - Intergenic
1149258986 17:54858637-54858659 CTGGGGAACCAGCCTGAAGGTGG + Intergenic
1149502693 17:57166505-57166527 CTGGGGAAAGAGGAGGAGTGGGG + Intergenic
1149550487 17:57535743-57535765 TTGGGGATCCAGCCAGAGGGAGG + Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1152027348 17:77819713-77819735 CTTGGGAGGCAGCAGGCGGGCGG + Intergenic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152103389 17:78315591-78315613 CTGGGAAACCCTCAGGAGTGTGG + Intergenic
1152199701 17:78938191-78938213 CTTGGGAACCAGTAGCAAGGGGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152336753 17:79703189-79703211 CTGGGGTACGAGGAGGAGGTGGG - Intergenic
1152351425 17:79785871-79785893 CTGGGACACAGGCAGGAGGGAGG - Exonic
1152390877 17:80003011-80003033 CTGGGGATTCAGCAGGAGAGAGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153057987 18:966874-966896 TTGGGGTGGCAGCAGGAGGGAGG + Intergenic
1153707138 18:7757530-7757552 CTGGGCAGCCAGCAGCAGGTGGG + Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1155096542 18:22560926-22560948 CTGCGGTAACAGTAGGAGGGTGG + Intergenic
1157191463 18:45585740-45585762 CTGGGGTATCTGCAGTAGGGAGG - Intronic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157481894 18:48060489-48060511 GGAGGGAACCAGCAGGAGGCAGG - Intronic
1158505679 18:58044433-58044455 CTGCGGGACCAGCGGGCGGGCGG - Exonic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1160497475 18:79383792-79383814 CTGGGCAACCTGCAGTGGGGCGG - Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160913695 19:1487066-1487088 CTGGGAAACCAGGAGGGGCGGGG + Intronic
1161143493 19:2663348-2663370 CTGGGGAAGAAAGAGGAGGGGGG - Intronic
1161345933 19:3768729-3768751 CTTGGGGAACAACAGGAGGGTGG - Intergenic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161660704 19:5544189-5544211 CTGGCGGTTCAGCAGGAGGGAGG - Intergenic
1161854388 19:6754933-6754955 CTGGGGGCCCAGCAGGCAGGAGG + Exonic
1161993218 19:7697149-7697171 CTGGGGAACCACGAGGCTGGGGG - Intronic
1162146009 19:8612325-8612347 GTGGGGAGCAAACAGGAGGGTGG - Intergenic
1162788684 19:13051985-13052007 GTGGGTAATCGGCAGGAGGGAGG - Intronic
1162936044 19:13982074-13982096 CTCGGGAGACAGCAGGGGGGAGG + Intronic
1163393681 19:17046169-17046191 CTGGGACCCCAGCAGGTGGGGGG - Intergenic
1163659727 19:18569451-18569473 CTGGGGGCCCTGCTGGAGGGAGG + Intergenic
1163676132 19:18656177-18656199 GTGGGGGACCTGCAGGATGGGGG + Intronic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1166219433 19:41355057-41355079 GTGGGGAATCAGCAGGAGTCTGG - Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166841230 19:45698524-45698546 CTGTGGGAGCAGCAGGGGGGTGG - Intronic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167872482 19:52383651-52383673 GTGGGGAACCTGCAGGAGTCAGG - Intronic
1168292361 19:55362793-55362815 GTGGGGGACGATCAGGAGGGAGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168470846 19:56639368-56639390 CTGAGGAACCAACAGGGAGGTGG - Intergenic
925121500 2:1421990-1422012 CTGGGGCAAGGGCAGGAGGGAGG - Intronic
925169172 2:1740489-1740511 CTGGGGGGCCTGCAGGCGGGAGG + Intronic
925173675 2:1767694-1767716 CTGGGGGACCAGCACCTGGGAGG - Intergenic
925182625 2:1827000-1827022 CTGGGGCACCAGCAGGGGTGGGG - Intronic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927215464 2:20666074-20666096 CAGGGGAACGCGCAGGAGAGGGG - Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927937746 2:27085085-27085107 CTGGGGATCCAGCAGGGGAAGGG + Intronic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929511606 2:42569153-42569175 GTGGGGAAGAAGCAGGAGAGGGG - Intronic
929906411 2:46050076-46050098 CTGGGGACCAGGCAGCAGGGCGG - Intronic
929929256 2:46239477-46239499 CTGGGGCTTCAGGAGGAGGGAGG - Intergenic
931117140 2:59177162-59177184 ATGGGGAATCAGCAGGAAAGAGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932305348 2:70698044-70698066 CTGGGGAACCCACAGAGGGGAGG - Intronic
932743097 2:74307039-74307061 CTTGGGAAACAGCCTGAGGGAGG - Intronic
932770680 2:74499264-74499286 ACGGGGAACCAGGAGGAGAGAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934014478 2:87864461-87864483 CTGGGGGACCAGAAAGAGAGTGG - Intergenic
934854321 2:97719424-97719446 GTGGGGCTCAAGCAGGAGGGAGG + Intronic
934927425 2:98391344-98391366 CTGAGCAAGCAGCAGGTGGGCGG + Intronic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
936159402 2:110072214-110072236 CTGGGGAGCCCGCTGGAGGCGGG - Intergenic
936185259 2:110299118-110299140 CTGGGGAGCCCGCTGGAGGCGGG + Intergenic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
937273351 2:120669317-120669339 CTGGGGGAGAAGCAGGAGGCGGG + Intergenic
937285104 2:120745779-120745801 CAGGTGAACCAGCTGCAGGGTGG - Intronic
937291458 2:120784661-120784683 CTGGGGGGCGAGCAGGAGGCAGG - Intronic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937904308 2:127045447-127045469 CCGGGGAGCTGGCAGGAGGGCGG + Intergenic
937904528 2:127046391-127046413 CTGCGGATCCAGAGGGAGGGAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938246246 2:129780024-129780046 CTGGGGAGCCTGAATGAGGGTGG - Intergenic
938291017 2:130150578-130150600 CTGGGGCACAAGGAGGAGGGAGG - Intergenic
938381294 2:130837699-130837721 CAGGTGAGCCAGCGGGAGGGCGG + Intronic
938465527 2:131522378-131522400 CTGGGGCACAAGGAGGAGGGAGG + Intergenic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
940618764 2:156084232-156084254 ATAGGGATCCATCAGGAGGGAGG - Intergenic
942449039 2:176097879-176097901 CTGGGGAACCTGATCGAGGGAGG - Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944904579 2:204250015-204250037 CTTAGGAACCACCAGGAGGCTGG - Intergenic
945026854 2:205627921-205627943 CTGGGAAGCCTGCAAGAGGGAGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
947808259 2:232983172-232983194 TTGGGGAGCCAGCAGTGGGGAGG + Intronic
948028828 2:234800086-234800108 CTGGGGAATCAGCAGCCAGGTGG + Intergenic
948029031 2:234801293-234801315 CTGGGGAACCAGCAGCCGGGTGG + Intergenic
948113948 2:235479813-235479835 CTGCAGAACCAGCATGGGGGTGG - Intergenic
948588484 2:239035586-239035608 CGGGGGAGCCCGCAGGAGAGCGG - Intergenic
948787045 2:240358242-240358264 ATGGGGAACCAGCATGGGGCTGG + Intergenic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169949889 20:11032224-11032246 CTGGGAAACCAGTGGGATGGTGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1172275339 20:33676120-33676142 CTGGGGAATCAGCAAAGGGGAGG - Exonic
1172307057 20:33888322-33888344 CTGGGAAACCACCAGGAGCTAGG - Intergenic
1175116407 20:56685741-56685763 CTGAGGAGCAAGCAGGAGGCTGG - Intergenic
1175227783 20:57454905-57454927 CTGGGGATTCTGCAGGAGGCTGG + Intergenic
1175266547 20:57706877-57706899 CAGGGGAACCAGCAGTGGGTGGG + Intronic
1175286409 20:57839760-57839782 CTAGTGAATGAGCAGGAGGGTGG + Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176145556 20:63563846-63563868 CGGGGCCACCAGCAGCAGGGCGG - Exonic
1178884600 21:36475380-36475402 CTGCGGCTACAGCAGGAGGGTGG - Intronic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180300806 22:11035136-11035158 CTGGGGGACTAGCAGAAGAGAGG + Intergenic
1180700996 22:17781412-17781434 CTGGGGAACTAACTGCAGGGAGG - Intergenic
1180859403 22:19068706-19068728 ATGGGGGACCAGCAGGCAGGGGG - Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181335761 22:22126419-22126441 CTCAGGAGCCAGCAGGAGGTGGG - Intergenic
1182426870 22:30278247-30278269 CTGGAGAGCCAGCAGGGTGGGGG + Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183589664 22:38772667-38772689 CTGGGGAAGCAGCCGCAGAGGGG - Intronic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183663704 22:39235516-39235538 GTGGGGTGCCAGGAGGAGGGAGG - Intronic
1183758107 22:39789820-39789842 CTGGGGAATGAGCAGGCTGGTGG + Intronic
1184311223 22:43644326-43644348 ATGGGGAACAAGCAGGGAGGAGG + Intronic
1184372313 22:44090300-44090322 TTCGGGGACCAGGAGGAGGGGGG - Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184485689 22:44777550-44777572 ATGGGTAACGAGCAGTAGGGAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
1185173451 22:49306290-49306312 CTGGGGATTAGGCAGGAGGGAGG + Intergenic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185347901 22:50318549-50318571 CTGGGGCAGGAGCGGGAGGGAGG + Intronic
949433326 3:4002095-4002117 CTGGGAAAACTGCATGAGGGTGG + Intronic
949944215 3:9177446-9177468 CTGGGGGACCTGGAGGAGGCAGG + Intronic
951243451 3:20313796-20313818 CGGGGGAAGAAGCAGGATGGAGG - Intergenic
952097274 3:29968443-29968465 ACAGGGATCCAGCAGGAGGGTGG - Intronic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
953479157 3:43234528-43234550 CTGGGGAAAGAGGAGGAGTGAGG - Intergenic
954035382 3:47848414-47848436 CTGGGGACCAGGCAGGTGGGAGG + Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954375566 3:50192522-50192544 CTGGTCAACCAGCTGGAGGTGGG + Intronic
954760381 3:52869540-52869562 TTGGGGACCCAGGAGAAGGGAGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955391382 3:58524746-58524768 AGGGGGAACCCTCAGGAGGGAGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955929702 3:64044504-64044526 CTTTGGAACAAGCAGGTGGGTGG - Intergenic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956757214 3:72400732-72400754 CTAGGCAAGCAGCAGAAGGGAGG - Intronic
960965682 3:123103129-123103151 CTGGGCATCCAGCCTGAGGGTGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961359567 3:126358295-126358317 CTGAGGATCCAGCTGGAGTGTGG - Intergenic
961373355 3:126446190-126446212 CTGGAGAATCTGCAGGAGTGGGG + Intronic
961392157 3:126558549-126558571 CTTGGGAAGCAGCAACAGGGTGG - Intronic
961742371 3:129040774-129040796 CTGGGGAAACTGCAGGAGTCAGG + Intergenic
961805296 3:129485004-129485026 GTGGGGACCAGGCAGGAGGGAGG - Intronic
962139223 3:132771159-132771181 CTGGGGTCCAAGGAGGAGGGAGG + Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962930403 3:140030604-140030626 CTGAGGAAACAGCACCAGGGTGG + Intronic
968088368 3:195884932-195884954 CTGGGGGCCCAGCAGGGGAGGGG - Exonic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968582233 4:1400484-1400506 CTGGGGACCCAGTAGGAGTGTGG + Intergenic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968705178 4:2074316-2074338 CTGGGGAACCAGGGGTCGGGCGG - Intronic
968985698 4:3873340-3873362 CTGGGGAAGCAGCAGGGCAGTGG - Intergenic
969308432 4:6338710-6338732 CTAGGGGCCCAGCAGGAAGGGGG - Intronic
969331249 4:6474450-6474472 CTGAGGAACATGCGGGAGGGTGG - Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
969837142 4:9851048-9851070 GTGGGGCACCAGCAGGAGTTGGG - Intronic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
972382188 4:38529485-38529507 CTGAGGAACCACAAGGAGTGTGG + Intergenic
972766217 4:42153731-42153753 CTGAGGAAGCTGCAGGAGAGAGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
976080708 4:81351750-81351772 CTGGGGCTACAGCAGGTGGGAGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
982278180 4:153658341-153658363 CTGGGGAAAGAGCAGCAAGGTGG - Intergenic
982330655 4:154178561-154178583 CTTGGCAACCACCATGAGGGTGG - Intergenic
983610069 4:169632746-169632768 CTGGGGAACTAGCAGGGGTTGGG + Intronic
984004052 4:174287025-174287047 CTGGCTAACCAGCAGGAGTTTGG + Intronic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
985102510 4:186472828-186472850 CTGAGGAACCAGCAGATGAGAGG + Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986965623 5:13267440-13267462 CTGGGGAAGCAGCTGGGAGGGGG - Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993509922 5:88758314-88758336 CTGAGGAACCAGCAGAAGTTAGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
996417699 5:123227971-123227993 CTGGGGACCCAGTGGGAGTGGGG - Intergenic
998396185 5:141819849-141819871 CTGGGGCCCCAGGAGGAGAGGGG - Intergenic
998443170 5:142178965-142178987 CTCAGGCACCAGCAGGAGAGGGG - Intergenic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999324848 5:150637580-150637602 CTGGGGAACCCGCAGGGGTTGGG + Intronic
1000104319 5:158044415-158044437 TTGGGGAAAGGGCAGGAGGGGGG + Intergenic
1001164477 5:169351087-169351109 CTGGGGAGCCAGTAGGAGCGAGG + Intergenic
1001541448 5:172542704-172542726 CCGGGGCGCCAGCAGGATGGTGG - Intergenic
1002061467 5:176628290-176628312 CTGGGGAGGAGGCAGGAGGGAGG + Intronic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002322717 5:178385087-178385109 CTGGGGAACAAGCATTGGGGTGG + Intronic
1002375316 5:178784659-178784681 CTGAGGAACCAACAGTGGGGAGG + Intergenic
1002593548 5:180307101-180307123 CTGAGGAGCCAGCGGGAAGGAGG - Intronic
1002741648 5:181438821-181438843 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1003415129 6:5900205-5900227 CTAGGGAAGCAGGAGGAAGGAGG + Intergenic
1004044338 6:12011503-12011525 CTGGGGAACCAGCACACGGCGGG - Intronic
1004363839 6:14995504-14995526 ATGGGAAACCATCAGGACGGTGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005896781 6:30185648-30185670 TCGGGAAACCAGCAGGAGGTGGG + Exonic
1005942291 6:30569583-30569605 ATGGGGAACAAACAGGAAGGAGG - Intergenic
1006378406 6:33684293-33684315 GTGGGGAAGTAGCTGGAGGGAGG + Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1011565114 6:88665422-88665444 CTTGGGAACAGGTAGGAGGGGGG - Intronic
1013099473 6:106974848-106974870 CTGGGGAACCCGGAGCGGGGCGG - Intronic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017622962 6:156317775-156317797 CTGGGAAAGCCCCAGGAGGGGGG - Intergenic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1018988838 6:168658159-168658181 CTGTGGAACCATCAGGGGTGAGG - Intronic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019246788 6:170714586-170714608 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019756948 7:2777622-2777644 GTGAGGAAGCAGCAGGAAGGTGG + Intronic
1019921639 7:4167012-4167034 CTGGGGAAGACCCAGGAGGGTGG - Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1021163516 7:17305112-17305134 ATAGGGCAGCAGCAGGAGGGTGG + Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1023507685 7:40917760-40917782 CTGAGGACCCAGCAAGAAGGTGG - Intergenic
1023983598 7:45082932-45082954 GTTGAGAACCAGCAGGAAGGAGG - Exonic
1024231804 7:47368722-47368744 CCGAGGGACCAGCAGTAGGGTGG - Exonic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1027295301 7:76763784-76763806 ATAGGGATCCATCAGGAGGGTGG + Intergenic
1029593167 7:101520726-101520748 CTGGGGAAGGAGCATGAGAGGGG - Intronic
1029637363 7:101793944-101793966 CTGGGGAGCAGGGAGGAGGGAGG + Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032699930 7:134370599-134370621 CTGGGGAATGGGCAGGAGTGGGG + Intergenic
1034520303 7:151614311-151614333 ATGGGGGAGCAGCAGCAGGGTGG + Intronic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035501354 8:93375-93397 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
1035784643 8:2250992-2251014 CTGGGGAACCTGCAGAAGGTTGG + Intergenic
1035808164 8:2470721-2470743 CTGGGGAACCTGCAGAAGGTTGG - Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1038450278 8:27634802-27634824 GTGGTGAGCCAGCAGCAGGGTGG + Intronic
1038593321 8:28861273-28861295 ATAGGGAACCAGATGGAGGGTGG - Intronic
1038776352 8:30534532-30534554 ATGGGGAACCAGAAGAACGGGGG + Intronic
1039058983 8:33558567-33558589 GTGGGAGTCCAGCAGGAGGGAGG - Intronic
1039588916 8:38730228-38730250 CTAGGGAACCCGCTGGAGGTGGG + Intronic
1040008701 8:42642900-42642922 CTGGGGCAGCAGCAGGGGGCAGG - Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040723837 8:50357124-50357146 GTGGGAAATGAGCAGGAGGGAGG - Intronic
1041018667 8:53616476-53616498 CCAGGGAACCTCCAGGAGGGGGG + Intergenic
1041729783 8:61052040-61052062 CTGGGGAACCATCAGTGAGGGGG + Intergenic
1042745182 8:72099451-72099473 CTGGGCAACAAGAAAGAGGGAGG - Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1044540047 8:93398637-93398659 CTTGGGAAGCAGCAGGAAAGAGG - Intergenic
1044543944 8:93438124-93438146 CTGTGGAACAATCAGGAGGTTGG - Intergenic
1045261385 8:100577884-100577906 TTGGGAAACCAGCAGGAGATTGG - Intronic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1046260888 8:111766021-111766043 TTGGGGAACCAGAAGGAGAGTGG - Intergenic
1047006085 8:120621864-120621886 CTGGGGATCGGGGAGGAGGGAGG - Intronic
1047220397 8:122914070-122914092 TTGGGGTTCCAGGAGGAGGGAGG - Intronic
1047727139 8:127693858-127693880 CTTAGGGGCCAGCAGGAGGGTGG - Intergenic
1048558370 8:135505446-135505468 CCTGGGAATCAGCAGGCGGGAGG - Intronic
1048770188 8:137886728-137886750 CTGGGGGACAAGCAGGAAAGAGG + Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049199877 8:141334805-141334827 CCGGGCACCCAGCAGGAGGCTGG - Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1053004343 9:34594122-34594144 CAGGGGCACCATTAGGAGGGGGG + Intergenic
1053217327 9:36283102-36283124 CTGGGGACCTCGGAGGAGGGAGG - Intronic
1053543592 9:38999486-38999508 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053808022 9:41822991-41823013 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1054622570 9:67364437-67364459 CTGGGTAAGCAGCAGGATAGGGG + Intergenic
1054825806 9:69572412-69572434 CTGGGGAAGGAGTAGGAGTGAGG - Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057488761 9:95506600-95506622 CTGGGGACGAAGCAGAAGGGAGG + Intronic
1058176216 9:101738515-101738537 TGGGGGAGCCTGCAGGAGGGTGG - Exonic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1058560966 9:106228852-106228874 CAGGGGAGCCAGCAGAAAGGAGG - Intergenic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060472206 9:123957437-123957459 GTGGGGAGTCAGCAGGATGGCGG - Intergenic
1060825953 9:126688314-126688336 CTGGGGAAGGGGCAGCAGGGCGG - Intronic
1061488719 9:130933707-130933729 CTGGGGAAGCGGCGGGCGGGTGG + Intronic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061878057 9:133554690-133554712 CGAGGTAACCAGGAGGAGGGAGG + Exonic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1062048014 9:134433294-134433316 CTGGGGCACCAGCAGGACCTGGG + Intronic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062390989 9:136333791-136333813 GTGGGGGACCAGGAGGAGAGGGG + Intronic
1062482509 9:136759164-136759186 CTGGGGGAGCTGCAGGAGGCCGG - Intergenic
1203607560 Un_KI270748v1:70037-70059 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1188095606 X:26017391-26017413 CTGCAGAGCCAGCAGGAGTGAGG + Intergenic
1189336839 X:40175591-40175613 CTCGCCAACCTGCAGGAGGGAGG + Intronic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1190501447 X:51082672-51082694 CTGGGGAAGCAACATGATGGTGG - Intergenic
1190522418 X:51294010-51294032 CTGGGGTATCAGCAACAGGGTGG + Intergenic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1191016237 X:55813310-55813332 CCGGGGAGCCAGCAGGGGGCTGG + Intergenic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193348484 X:80430881-80430903 CTAGGAAACCAGCAAGATGGAGG - Intronic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1194077771 X:89417653-89417675 CTAGGAACCCACCAGGAGGGAGG + Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196001992 X:110795987-110796009 GTGGGGAGCGAGCGGGAGGGCGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199129999 X:144174011-144174033 CTGGGGGACCAGAAAGAGAGTGG + Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic
1200247699 X:154534735-154534757 CCGGGGACCCAGCATGAGGCAGG - Intronic
1200430420 Y:3073198-3073220 CTAGGAACCCACCAGGAGGGAGG + Intergenic