ID: 915490442

View in Genome Browser
Species Human (GRCh38)
Location 1:156247438-156247460
Sequence GCAGGCGGAGCCGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915490433_915490442 10 Left 915490433 1:156247405-156247427 CCTTGGCACAAGTGGAGGGGCTG 0: 1
1: 1
2: 4
3: 28
4: 211
Right 915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG 0: 1
1: 0
2: 5
3: 23
4: 264
915490428_915490442 20 Left 915490428 1:156247395-156247417 CCGGCACATTCCTTGGCACAAGT 0: 1
1: 0
2: 0
3: 21
4: 173
Right 915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG 0: 1
1: 0
2: 5
3: 23
4: 264
915490426_915490442 26 Left 915490426 1:156247389-156247411 CCTCTCCCGGCACATTCCTTGGC 0: 1
1: 0
2: 1
3: 8
4: 150
Right 915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG 0: 1
1: 0
2: 5
3: 23
4: 264
915490423_915490442 30 Left 915490423 1:156247385-156247407 CCCGCCTCTCCCGGCACATTCCT 0: 1
1: 0
2: 0
3: 29
4: 325
Right 915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG 0: 1
1: 0
2: 5
3: 23
4: 264
915490424_915490442 29 Left 915490424 1:156247386-156247408 CCGCCTCTCCCGGCACATTCCTT 0: 1
1: 0
2: 2
3: 36
4: 615
Right 915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG 0: 1
1: 0
2: 5
3: 23
4: 264
915490427_915490442 21 Left 915490427 1:156247394-156247416 CCCGGCACATTCCTTGGCACAAG 0: 1
1: 1
2: 2
3: 45
4: 389
Right 915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG 0: 1
1: 0
2: 5
3: 23
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915490442 Original CRISPR GCAGGCGGAGCCGCCCCAGG AGG Intronic
900188719 1:1344502-1344524 GCAGGCAGGGCCAGCCCAGGTGG + Intronic
900191182 1:1352962-1352984 GCAAGGGGTGCAGCCCCAGGTGG + Exonic
900287236 1:1907526-1907548 GCAGGCCCAGCCTCCCCAGGAGG - Intergenic
900458656 1:2789780-2789802 GCAGGGGGCGCCGCACCCGGGGG - Intronic
900488769 1:2935954-2935976 GGAGACGGACCCGCCCCAGTGGG + Intergenic
900743537 1:4344772-4344794 GCAGGCTGAGCTGACCAAGGAGG - Intergenic
901005704 1:6170649-6170671 GCAGCAAGGGCCGCCCCAGGTGG + Intronic
901115517 1:6840766-6840788 GCAGGAGGAGCCAGCACAGGAGG + Intronic
901644603 1:10709746-10709768 GCAGGGGGATGCGCACCAGGGGG + Intronic
903447819 1:23433514-23433536 GCAGCTGGAGCAGGCCCAGGCGG - Exonic
905520657 1:38597024-38597046 TCAGGTGGAGCCGCCGGAGGTGG - Intergenic
906146671 1:43564702-43564724 ACAGACGGTGCCACCCCAGGGGG + Intronic
907051131 1:51330489-51330511 GCGGGCGGCGCTGCCCCAGCCGG + Intronic
912428364 1:109614055-109614077 GCTGGCGGAGCCTCCTCAGGTGG + Exonic
913978646 1:143488196-143488218 GGAAGCGGAGCAGCGCCAGGAGG - Intergenic
914073055 1:144313844-144313866 GGAAGCGGAGCAGCGCCAGGAGG - Intergenic
914106099 1:144652516-144652538 GGAAGCGGAGCAGCGCCAGGAGG + Intergenic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
914869042 1:151458587-151458609 GGCGGCGGAGCGGCCCCTGGGGG - Intronic
915070394 1:153261311-153261333 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070410 1:153261356-153261378 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070436 1:153261455-153261477 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG + Intronic
915556754 1:156665092-156665114 GCAGGCTGAGGCGCCTCAGAGGG - Intergenic
919769031 1:201145369-201145391 GCAGGAGGGGCTGCCTCAGGTGG + Intronic
922085070 1:222338669-222338691 CCAGGCTGAGCCACCCCTGGTGG - Intergenic
923372607 1:233328117-233328139 CGAGGCCGAGCCGCCCGAGGAGG - Exonic
923490239 1:234478275-234478297 GCAGGCGGGGCTGGGCCAGGCGG - Exonic
1070767906 10:79067180-79067202 GCACCCGGAGGCGGCCCAGGCGG - Intergenic
1070794709 10:79209923-79209945 ACAAGCTGAGCAGCCCCAGGAGG - Intronic
1071529418 10:86377445-86377467 GCCGCGCGAGCCGCCCCAGGAGG + Intergenic
1076606957 10:131695390-131695412 GGAGGGGGAGAGGCCCCAGGAGG + Intergenic
1076729275 10:132430111-132430133 GCAGGCGGAGGACACCCAGGTGG + Intergenic
1076792743 10:132785705-132785727 GCCGGGGCAGCCCCCCCAGGAGG + Exonic
1077014390 11:393382-393404 GGGGGCGGGGCCGCCCCAGGGGG - Intronic
1077038696 11:507691-507713 ACATGCGGAGCCGCCCCAGGGGG - Intergenic
1077136547 11:1002304-1002326 ACAGGAGGAGCCGGCCGAGGCGG - Intronic
1079128640 11:17735297-17735319 GCAGGCGGGCCCGCCGCCGGGGG + Exonic
1081851498 11:46277949-46277971 GGAGGCGGCGCGGCCCCGGGTGG - Exonic
1082010858 11:47448829-47448851 GCACGCGGAAGCGCCCCATGAGG + Exonic
1083751975 11:64765984-64766006 GGAGGGGGAGGGGCCCCAGGCGG + Intronic
1083914125 11:65728874-65728896 GTAGGCAAAGCCACCCCAGGGGG - Intergenic
1084436825 11:69147680-69147702 GCAGTCTCAGCCGACCCAGGTGG - Intergenic
1084628849 11:70332055-70332077 GGAGGCGGAGCTGGCCCAGAGGG + Exonic
1085038158 11:73311762-73311784 GCAGGCCGAGCTGCCTCAGGGGG - Exonic
1087117896 11:94544190-94544212 GTGGGCGGAGGCGCCGCAGGAGG + Exonic
1089159060 11:116423922-116423944 GCAGGTTGAGCCGCCCCGTGAGG - Intergenic
1089459751 11:118645608-118645630 GCAGGCCGAGTTGCCCCCGGTGG - Exonic
1090593267 11:128294158-128294180 GCAGGCGGGGCAGGCACAGGAGG - Intergenic
1091451595 12:575594-575616 GCAGAAGGAGCCGTCTCAGGAGG - Intronic
1092174123 12:6391170-6391192 TGAGGCTGAGCAGCCCCAGGGGG - Exonic
1092207003 12:6620837-6620859 CCACGCGGGGCCGCCGCAGGTGG + Exonic
1092659557 12:10723231-10723253 GCAGGCGGCGGCGGCCGAGGTGG + Exonic
1096237538 12:49939931-49939953 GCAGGAGGAGGAGCCCCAGGGGG - Intergenic
1097278868 12:57832097-57832119 GCAGGCTCAGCCTCCCCAGTTGG + Intronic
1097925304 12:65121092-65121114 GGAGGCCGGGCCGCCGCAGGAGG - Exonic
1101321510 12:103677017-103677039 TCAGGAGGAGCCTCACCAGGAGG - Intronic
1103339864 12:120215575-120215597 GCGGGCGGAGCAGCCCCGGAGGG - Intronic
1103939124 12:124492468-124492490 ACAGGAGGAGCTGTCCCAGGAGG + Intronic
1104040956 12:125130312-125130334 GGAGGCTGAGCCACCCCTGGGGG - Intronic
1104761336 12:131299052-131299074 GCAGGGAGCGCAGCCCCAGGTGG + Intergenic
1104818439 12:131661740-131661762 GCAGGGAGCGCAGCCCCAGGTGG - Intergenic
1104849429 12:131864265-131864287 GGAGGAGGAGCCACCCCTGGGGG - Intergenic
1105220684 13:18323200-18323222 GGAAGCGGAGCAGCGCCAGGAGG + Intergenic
1105472467 13:20705126-20705148 GCAGGAGGAGCTGCCCTAGGGGG + Intronic
1106246388 13:27953896-27953918 GCAGCCGGAGCCGCCGCAGGAGG - Intergenic
1113418868 13:110154407-110154429 CCAGGCGGCACTGCCCCAGGAGG + Intronic
1113855915 13:113445437-113445459 GCAGGCGGATGCCCACCAGGTGG + Intronic
1113949031 13:114060917-114060939 GCAGACGGAGCCCCCACAGCCGG + Intronic
1113949062 13:114061008-114061030 GCAGACGGAGCCCCCACAGCCGG + Intronic
1113969996 13:114181407-114181429 GCTGGCAGAGCCGTCCCACGGGG + Intergenic
1119193599 14:72701364-72701386 ACAGATGGATCCGCCCCAGGGGG - Intronic
1121101516 14:91253403-91253425 GCAGGCGGAGACGCCCCGCCCGG + Intronic
1121600669 14:95200600-95200622 GCAGGAGGAGCCTCCCCATCAGG + Intronic
1122366201 14:101196174-101196196 GCAGGCGCAGCCCTGCCAGGGGG - Intergenic
1122558311 14:102593020-102593042 GGAGGCGGCGGCGCCCGAGGCGG - Exonic
1122647857 14:103207152-103207174 GGAGTTGGAGCCGCCCCGGGCGG + Intergenic
1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG + Intronic
1123476838 15:20596801-20596823 GCAGGTGGAGAGGCCCCAGGTGG + Intergenic
1123641173 15:22403563-22403585 GCAGGTGGAGAGGCCCCAGGTGG - Intergenic
1123807906 15:23894369-23894391 GCAGGCTGAACCACCCCACGTGG - Intergenic
1124129405 15:26971238-26971260 GTGGGCGGCGCCGCGCCAGGGGG + Intergenic
1124237372 15:28002358-28002380 GCAGGCGGAGCAGGCCCTGCAGG - Intronic
1127323680 15:57872797-57872819 GCAGGCGCAGCAGCCCAAAGAGG + Intergenic
1127358711 15:58226412-58226434 GCTGGCAGAGCATCCCCAGGGGG - Intronic
1128344011 15:66842515-66842537 GCGGGCGAAGCCGGCCCAGCCGG - Intergenic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1129363944 15:75043050-75043072 GCAGGAGGGGCCACCCAAGGAGG - Intronic
1131693951 15:94855942-94855964 GCAGGGCGAGCTGCCCCGGGAGG + Intergenic
1132178100 15:99731756-99731778 GCAGCGGGAGCTGGCCCAGGAGG - Exonic
1132311236 15:100859453-100859475 ACAGGAGGAGAAGCCCCAGGAGG - Intergenic
1132336306 15:101050615-101050637 GCAGGTGAGGCCGGCCCAGGAGG - Intronic
1132767522 16:1541991-1542013 GCAGGCCCACCAGCCCCAGGAGG - Exonic
1132857507 16:2053383-2053405 GCAGCCGGAGCGGCCGCTGGAGG + Exonic
1132863787 16:2083978-2084000 GCAGCCAGGGCCGGCCCAGGTGG - Intronic
1134095458 16:11415672-11415694 ACAGGCAGAGCATCCCCAGGAGG + Intronic
1136626855 16:31466700-31466722 CCAGCCGGGGCCGGCCCAGGCGG - Exonic
1136694233 16:32062453-32062475 GCATGTGGAGCAGCCCCAGCTGG - Intergenic
1136794730 16:33005717-33005739 GCATGTGGAGCAGCCCCAGCTGG - Intergenic
1136875175 16:33848675-33848697 GCATGTGGAGCAGCCCCAGCTGG + Intergenic
1136930893 16:34417071-34417093 GTAGGCAGAGCAGCCCCTGGAGG + Intergenic
1136973680 16:34994737-34994759 GTAGGCAGAGCAGCCCCTGGAGG - Intergenic
1140759662 16:78099629-78099651 GTCGGCGGAGCGGCCCCTGGAGG + Exonic
1141829244 16:86500499-86500521 GCTGGTGGGGCCTCCCCAGGAGG + Intergenic
1141840107 16:86568526-86568548 GCAGGCGCCGCCGCCCCCGCCGG + Exonic
1142182162 16:88676599-88676621 GCAGGCGGGGCTGCCCCGAGTGG + Intergenic
1142246098 16:88970765-88970787 GCAGACGGTGCTGGCCCAGGAGG - Intronic
1203096993 16_KI270728v1_random:1267367-1267389 GCATGTGGAGCAGCCCCAGCTGG - Intergenic
1142858881 17:2749354-2749376 GGCGCCGGAGCGGCCCCAGGGGG - Intergenic
1143565804 17:7719872-7719894 GCAGGCTGAGCTCCCCAAGGAGG + Exonic
1146910613 17:36646310-36646332 CCAGATGGAGCGGCCCCAGGTGG - Intergenic
1147690664 17:42312706-42312728 GCAGGTGCCACCGCCCCAGGGGG + Intergenic
1148549397 17:48541746-48541768 GCAGGAGGCGCCGGCCCAGCCGG - Intronic
1149849253 17:60025789-60025811 GCCTGCTGAGCCGCCCCCGGCGG + Intergenic
1149860915 17:60120735-60120757 GCCTGCTGAGCCGCCCCCGGCGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1152596337 17:81239480-81239502 GCAGGAGGAGCCGCGCGGGGAGG + Intronic
1152610002 17:81310714-81310736 GCAGGCGGTGCTGCCCCAGCGGG + Intergenic
1152716954 17:81904853-81904875 GCAGGCGGCACAGCCCCTGGGGG - Exonic
1152720756 17:81922826-81922848 GAAGGCGGAGCTGCAGCAGGAGG - Exonic
1152818580 17:82423961-82423983 GCAGGAGGAGCCGGGGCAGGGGG - Intronic
1154231384 18:12559126-12559148 GCAGGGGGAGGCGCCCCCTGGGG + Intronic
1154231386 18:12559139-12559161 GCAGATGGAGCCTCCCCAGGGGG - Intronic
1158589548 18:58768340-58768362 GGAGCCGCAGCCGCCCCATGGGG + Intergenic
1160500811 18:79400461-79400483 GCCGCCGCGGCCGCCCCAGGTGG + Intronic
1160543523 18:79638315-79638337 GCAGAAGGAGCCGCTCCCGGGGG + Intergenic
1160562331 18:79766556-79766578 GGAGCCTGACCCGCCCCAGGAGG + Intergenic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1160862719 19:1244521-1244543 GCAGGCGCGGCTTCCCCAGGTGG - Exonic
1160991793 19:1863208-1863230 GGACCCGGAGCCGCCCCGGGGGG - Exonic
1161168408 19:2800884-2800906 GCAGGAGAAGCAGCCCCACGGGG - Intronic
1161264823 19:3359423-3359445 GCAGCCGGAGCCGCCGCAGCCGG + Intergenic
1161447772 19:4327884-4327906 GGAGGCGGAGCCAGCCCTGGGGG - Intronic
1161470424 19:4454273-4454295 GCAGGCGGAAGAGCCCCTGGAGG + Intronic
1161767709 19:6216347-6216369 CCAGCCGGAGTCGCCCCGGGTGG + Intronic
1162027020 19:7900196-7900218 GCAGGCTGAGCCTCTGCAGGTGG - Exonic
1162330753 19:10027780-10027802 GCAGGCGCAGCTGCTCCGGGCGG + Intergenic
1163435815 19:17294489-17294511 GCGGGCGAAGCCGGCCCTGGTGG + Exonic
1163741601 19:19017299-19017321 GCAGGCAGAGCTGCCCCTGATGG - Intronic
1163843960 19:19628287-19628309 GGAGGCGGGGCTCCCCCAGGTGG - Intronic
1165427844 19:35755613-35755635 GCAGCCGGATCCACGCCAGGCGG + Exonic
1166571911 19:43802393-43802415 GCGGGAGGAGCTGTCCCAGGTGG - Exonic
1166682617 19:44778124-44778146 GCCGGCGGAGGCGGCCCCGGGGG + Exonic
1166701119 19:44882225-44882247 GCAGGCGCAGGGGCCACAGGCGG + Exonic
1166851318 19:45762895-45762917 GCAGGTGGGGTCACCCCAGGAGG + Intronic
1167146006 19:47681096-47681118 GCAGGCGCAGCAGCCCCCGCAGG + Exonic
1167158028 19:47750980-47751002 GCAGGGCGAGCTGCCCCGGGAGG + Exonic
1167699119 19:51031984-51032006 GCAGGCGCAGCCGCAGCAGCCGG + Exonic
925801833 2:7609448-7609470 GCAGGAGCAGCCTCTCCAGGGGG + Intergenic
931869997 2:66446437-66446459 GCAGGCGTGGCCACCCCGGGAGG - Intronic
934183372 2:89649276-89649298 GGAAGCGGAGCAGCGCCAGGAGG - Intergenic
934293654 2:91723447-91723469 GGAAGCGGAGCAGCGCCAGGAGG - Intergenic
934553790 2:95277107-95277129 GCAGGTGGGATCGCCCCAGGAGG - Intronic
934783266 2:96986403-96986425 GCAGGAGCAGGCTCCCCAGGCGG + Exonic
938289491 2:130141855-130141877 GCAGGAGGGGCCTCCCCGGGTGG - Intronic
938467039 2:131531083-131531105 GCAGGAGGGGCCTCCCCGGGTGG + Intronic
939004123 2:136765942-136765964 GCGGGCGGGGACGCCCCACGCGG + Intronic
943333759 2:186589971-186589993 GGAGGAGGAGCCGGCCCGGGAGG - Intergenic
943580087 2:189674472-189674494 GCAGCCGCAGCGCCCCCAGGCGG - Intronic
947810912 2:233003464-233003486 GCAGGCAGGGCTGCTCCAGGCGG - Intronic
948728154 2:239947169-239947191 GCAGGCGGGACGGCCCCAGATGG - Intronic
1169141593 20:3229988-3230010 GGTGACGGGGCCGCCCCAGGTGG - Intronic
1171123764 20:22585046-22585068 GAGGCCGGAGCCGCCCCAGAGGG - Intronic
1171320428 20:24239060-24239082 GCAGGCAGAGCCACAGCAGGTGG - Intergenic
1173223260 20:41146392-41146414 GCAGGTGGAGGGACCCCAGGGGG - Intronic
1174317434 20:49713660-49713682 GCAGCCGCAGCAGCCCCCGGCGG + Exonic
1174409004 20:50321583-50321605 GCTGTGGGAGCTGCCCCAGGCGG + Intergenic
1175410147 20:58762401-58762423 GCCAGCAGAGCAGCCCCAGGCGG + Intergenic
1176009080 20:62882165-62882187 GGAGGCGGCGGCGACCCAGGAGG + Exonic
1176109345 20:63404399-63404421 GCAGGCGGGGCCACACCTGGCGG + Intergenic
1176370442 21:6058961-6058983 GCAGGCGTCGCGGCCCCAGCAGG - Intergenic
1176547555 21:8208301-8208323 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1176566506 21:8391348-8391370 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1176574382 21:8435535-8435557 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1176610994 21:8986827-8986849 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1179753077 21:43479580-43479602 GCAGGCGTCGCGGCCCCAGCAGG + Intergenic
1180041684 21:45283357-45283379 GCAGGGGGAGCAGCCTCAGCAGG + Intronic
1180094635 21:45550235-45550257 GCAGGAGGCGCCTCCCCAGGAGG - Intergenic
1180115861 21:45704494-45704516 CCTGGCAGAGGCGCCCCAGGGGG + Intronic
1180609260 22:17085133-17085155 GCAGCAGGAGCAGCCCCAGCAGG - Exonic
1180876154 22:19176201-19176223 CCAGGCAGACCCGGCCCAGGCGG + Exonic
1181626209 22:24123978-24124000 GCAGGCAGAGCCTCACCTGGAGG - Intronic
1182102726 22:27669507-27669529 ACAGAGGGAGCCGCCCCATGGGG + Intergenic
1182322948 22:29490115-29490137 GGAGGAGGAGAAGCCCCAGGAGG + Exonic
1183077676 22:35437090-35437112 GCATGCAGAACAGCCCCAGGAGG + Intergenic
1183282126 22:36937629-36937651 CCAGCCGGAGCCCCCACAGGAGG + Exonic
1183398963 22:37589901-37589923 GCAGGAGGAGCTGGCCGAGGGGG - Intergenic
1183484636 22:38082460-38082482 AGAGGCGGGGCCGGCCCAGGGGG - Intronic
1183642224 22:39099702-39099724 GCAGCCGGTGCCCTCCCAGGTGG + Intronic
1183829354 22:40409678-40409700 GCAGGCGCAGCAGCCCCTGAAGG + Exonic
1184418164 22:44364053-44364075 TCAGGGCGAGCCCCCCCAGGGGG - Intergenic
1185014650 22:48335833-48335855 CCAGGAGGAGCTGCCCCAGCAGG - Intergenic
1185037742 22:48488854-48488876 CCTGGCAGTGCCGCCCCAGGTGG + Intergenic
1185055124 22:48575434-48575456 GCAGTCGCTGCCGGCCCAGGTGG - Intronic
1185069508 22:48648318-48648340 GCATCCGGAGCCCCCACAGGGGG - Intronic
1185379084 22:50498773-50498795 GGAGGCGGAGCCGTCAGAGGAGG - Intergenic
1203252428 22_KI270733v1_random:124586-124608 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1203260485 22_KI270733v1_random:169672-169694 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
950435380 3:12976261-12976283 GCAGCAGTGGCCGCCCCAGGAGG + Intronic
954133388 3:48571044-48571066 GCAGGCCGGGCCCCCACAGGAGG - Intronic
955067498 3:55545774-55545796 GCAGGAGGACCCGGCCCAGTGGG - Intronic
959704898 3:109330670-109330692 GCAGGCGGCTCCCCCACAGGAGG + Exonic
968454283 4:689188-689210 GCAGGCGGTCCCGGCCCACGCGG - Exonic
968473560 4:792507-792529 GCAGGAGGCGCTGCGCCAGGCGG - Exonic
968751101 4:2389432-2389454 GCAGGCTGAGCCTCCTCATGTGG - Intronic
968775488 4:2537138-2537160 GCGGGCGGCGCCGCCCCCGGAGG + Intronic
969431948 4:7160524-7160546 GCAGGGGGTGCTGCCCCAGAGGG + Intergenic
969608229 4:8212768-8212790 GCAGGCGGAGCTGGCCCCGGAGG - Exonic
969617104 4:8260077-8260099 GCAGGAGGATCCTCCCCCGGAGG - Intergenic
969710558 4:8840749-8840771 CGGGGCTGAGCCGCCCCAGGTGG + Intergenic
970691946 4:18630628-18630650 GCAGCCAGAGCCTCCCCAGCGGG - Intergenic
974033877 4:56800284-56800306 GCAGGCTGAGCCGCCTGAGCTGG + Intergenic
980695995 4:136356192-136356214 GCAGGTGGGGGCGCCCAAGGAGG - Intergenic
984578200 4:181475966-181475988 GCAGGCGGTGCGGCTCCAGCGGG + Intergenic
995354621 5:111224094-111224116 GCATCCGGAGCCGCCCTAGCCGG + Exonic
997353580 5:133248114-133248136 GGAGACAGAGCCGCCACAGGAGG - Intronic
997883534 5:137611506-137611528 GCAGGCAGGCCAGCCCCAGGTGG - Intergenic
998164752 5:139836688-139836710 GGAGGAAGAGCAGCCCCAGGAGG - Intronic
998369361 5:141651099-141651121 ACAGGTGAAGCCGGCCCAGGAGG - Exonic
998384524 5:141748838-141748860 GCAGGGAAAGCCGGCCCAGGAGG - Intergenic
1001643856 5:173265470-173265492 GCAGGCTGAGCTGCCCAGGGAGG - Intergenic
1002374681 5:178780171-178780193 GGAGGCTGAGCCACCCCTGGGGG + Intergenic
1002927871 6:1615107-1615129 GCCGGCGCTGCGGCCCCAGGCGG + Intergenic
1002991834 6:2245614-2245636 GCGGGCCGAGCCGGCCAAGGCGG + Exonic
1003053357 6:2798925-2798947 GGGGGCGGAGCCGGGCCAGGTGG + Intergenic
1006367048 6:33621897-33621919 GCAGGAGGAGCCTCCCTCGGCGG + Intronic
1006787877 6:36679995-36680017 CCAGGCGGCGGCGCCCCAGGGGG - Intronic
1007225585 6:40311527-40311549 GCAGGCGGAGCCCCTCCCTGGGG - Intergenic
1008659557 6:53652143-53652165 GCAGCCGAAGACGCCCCTGGAGG - Exonic
1014109243 6:117602239-117602261 GCAGCCGGAGGGGGCCCAGGGGG - Exonic
1016982171 6:149863801-149863823 GCAGCAGGAGCGGCCTCAGGAGG - Exonic
1017684197 6:156895531-156895553 GCAGGAGGGGACACCCCAGGAGG - Intronic
1017852191 6:158314448-158314470 GTAGGCTGCGCCTCCCCAGGTGG + Intronic
1018704768 6:166455700-166455722 GCACACGGAGCCGCTCGAGGAGG + Intronic
1019016888 6:168886411-168886433 ACTGGCGGGGCCTCCCCAGGTGG + Intergenic
1019287500 7:231106-231128 GCAGGAGCAGCAGCCCCAGCAGG + Intronic
1019288041 7:233522-233544 GCAGGCTGAGCTCCCCCGGGAGG + Intronic
1019476593 7:1247459-1247481 GCAGTCGGGGCAGCTCCAGGGGG + Intergenic
1019497719 7:1348153-1348175 GCAGGCAGGGCTGCCCCAGCTGG + Intergenic
1019537524 7:1537076-1537098 GTAGCCGGGGGCGCCCCAGGAGG - Intronic
1019605653 7:1908925-1908947 GCATGAGCAGCGGCCCCAGGGGG + Intronic
1019621677 7:1995533-1995555 GCGGGCGCAGGAGCCCCAGGCGG + Intronic
1019733568 7:2639876-2639898 GCAGGAGAAGCAGCCCCCGGTGG - Intronic
1020105741 7:5421455-5421477 CCAGGCGGAGCTGCGCGAGGCGG + Exonic
1022286087 7:28957059-28957081 GCTCGCGCAGCCGGCCCAGGTGG + Exonic
1024006498 7:45228215-45228237 GCAGGTGGAGGAGGCCCAGGGGG + Intergenic
1025263373 7:57437645-57437667 GCAGGCCGAGGTGCCCAAGGTGG - Intergenic
1025635875 7:63318478-63318500 GCAGGCTGAGACGCCCAAGGCGG + Intergenic
1025646821 7:63429702-63429724 GCAGGCTGAGACGCCCAAGGCGG - Intergenic
1025713450 7:63931890-63931912 CCAGGCAGACCCGGCCCAGGTGG - Intergenic
1025740499 7:64192252-64192274 GCAGGCCGAGGTGCCCAAGGCGG - Intronic
1026377880 7:69770438-69770460 GCAGGTGGAGGCGCCGCAGTGGG + Intronic
1026764989 7:73154836-73154858 ACCGGGGGAGCCCCCCCAGGCGG + Intergenic
1027082179 7:75237776-75237798 ACCGGGGGAGCCCCCCCAGGCGG - Intergenic
1029037944 7:97541443-97541465 GCAGGGGGCCCCGCCCCATGGGG - Intergenic
1034342815 7:150368978-150369000 GCAGGTGGAGCGGCCCCCCGCGG - Intronic
1034424465 7:151007310-151007332 GCAGGAGGAGGCATCCCAGGGGG - Intronic
1034555854 7:151849961-151849983 GCAGGAGCAGCTTCCCCAGGTGG - Intronic
1034977718 7:155457909-155457931 GCGGCCGGAGCCGGCCCGGGCGG + Intergenic
1035282344 7:157785961-157785983 GCACCCAGAGCCGGCCCAGGGGG - Intronic
1037928778 8:22865325-22865347 GCAGCGGGAGACGCCGCAGGGGG - Intronic
1038544429 8:28414143-28414165 ACTTGAGGAGCCGCCCCAGGTGG + Intronic
1040701829 8:50075167-50075189 GCAGCCGGAGCCTCCCCAATGGG + Intronic
1045096266 8:98800890-98800912 GCAGCCGGAGCCTCCCCAACAGG + Intronic
1045507870 8:102791250-102791272 GCAGGCAGAGCCTCCCCGGGGGG + Intergenic
1048573616 8:135674348-135674370 GCAGTCAGAGCTGTCCCAGGAGG + Intergenic
1049040780 8:140110671-140110693 GCAGGGGGAGCTGCTGCAGGGGG - Intronic
1049040807 8:140110760-140110782 GCAGGGGGAGCTGCTTCAGGGGG - Intronic
1049040827 8:140110815-140110837 GCAGGGGGAGCTGCTGCAGGGGG - Intronic
1049433805 8:142577103-142577125 GCAGGTGGAGACACCCCAGCAGG - Intergenic
1049615460 8:143573932-143573954 GCAGACGGAAGTGCCCCAGGCGG + Intergenic
1049654664 8:143792314-143792336 GCACGCGCAGCCGCTCCTGGTGG + Exonic
1052837745 9:33264477-33264499 GCCGGCGGCGGCGCCCCTGGTGG + Exonic
1056243287 9:84669936-84669958 GTAGCCGAGGCCGCCCCAGGGGG - Intronic
1056552617 9:87664139-87664161 GAAGGCAGAGGAGCCCCAGGTGG - Intronic
1056580426 9:87885428-87885450 GTAGGTGGAGAGGCCCCAGGTGG - Exonic
1059461327 9:114432313-114432335 GCAGGCGCAGGAGCCCCAGGAGG + Intronic
1059470878 9:114504406-114504428 GCTGTCGGGGCCGCCCCAGGCGG + Exonic
1060232725 9:121837716-121837738 GGAGGCAGTGCCACCCCAGGAGG - Intronic
1060596764 9:124853319-124853341 GGAGGTGGAGCCGCAGCAGGCGG - Intergenic
1060776822 9:126380665-126380687 GCAGGCAGCGCCCCCTCAGGTGG + Intronic
1061590062 9:131592330-131592352 GCAGGCGGAGACACCAGAGGGGG - Intronic
1062578280 9:137218488-137218510 GCAGGCTCAGCAGCGCCAGGCGG - Intergenic
1062589306 9:137266342-137266364 GCAGCCGGAGCAGCAGCAGGAGG - Exonic
1203468833 Un_GL000220v1:107737-107759 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1203476654 Un_GL000220v1:151709-151731 GCCGGCGGCGGCGCCCCACGAGG - Intergenic
1189333871 X:40158349-40158371 GCAGGCGGCGCTGCCCCCGGCGG + Intronic
1190747332 X:53332363-53332385 GCAGGAGCAGCCGCCACAGTGGG - Intergenic
1190881441 X:54495347-54495369 GCCGGCGGAGCGGCGCCCGGCGG + Exonic
1192428394 X:71096657-71096679 GCCGTCCGAGCCGCCCGAGGTGG + Exonic
1193620688 X:83749957-83749979 GCAGGTGGGGGCCCCCCAGGAGG - Intergenic
1196871236 X:120115589-120115611 GCCGGAGGAGCCGGCCCAGGCGG - Exonic
1200107606 X:153723852-153723874 GGAGGCGAAGCGGCCCCGGGCGG - Exonic