ID: 915492812

View in Genome Browser
Species Human (GRCh38)
Location 1:156260805-156260827
Sequence CAGGCAGAGCAGAGGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 689}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915492812 Original CRISPR CAGGCAGAGCAGAGGGGCTC AGG Intronic
900136661 1:1120515-1120537 CAGTCAGGGCCGAGGAGCTCAGG - Intergenic
900393137 1:2442516-2442538 CAGGCAGAGCTGACGGGCCCAGG + Intronic
900421146 1:2556460-2556482 CTGGCAGCAGAGAGGGGCTCAGG - Exonic
900585789 1:3431641-3431663 CAGGCAGCTCAGAGAGGCCCGGG - Intronic
900645202 1:3705881-3705903 CCTGCAGAGCCGAGGGCCTCTGG + Intronic
901280020 1:8026527-8026549 CAGGCAGAGGAGCGGAGCTGCGG - Intergenic
901633379 1:10658666-10658688 AGAGCAGAGCAGAGGGGCTGGGG - Intronic
901639395 1:10685806-10685828 AGGGCAGGGCAGAGGGGCTGGGG + Intronic
901925968 1:12566297-12566319 CAGGCTGACCAGGGGGCCTCAGG - Intergenic
902219606 1:14956720-14956742 CAAGCAGGGAAGAGGGGCCCTGG + Intronic
902232369 1:15036227-15036249 CAGGCAGGGCAGAGGGGGATGGG - Intronic
902301879 1:15507743-15507765 TAGGCAGTGCAGTGGGGGTCTGG - Intronic
902359141 1:15932562-15932584 CAGGCAGGGGAGAGGGAATCTGG + Exonic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
902895535 1:19477260-19477282 CAGGCAGAGAGGATGGGCTGGGG - Intronic
902933565 1:19747891-19747913 CAGCCGCAGCAAAGGGGCTCAGG - Intronic
903044235 1:20553668-20553690 CAGGCGGCGCAGTGGGGCGCGGG - Exonic
903238042 1:21963540-21963562 CAACCAGAGCAGAGGGTCCCTGG + Intergenic
903351016 1:22716618-22716640 CAGGCAGGGCACAGTGGCTCAGG - Intronic
903514481 1:23901472-23901494 CAGGCATAGAAGATGAGCTCAGG + Intronic
903760881 1:25697981-25698003 CAGGCAGTGCAGGGGAGCTCTGG - Intronic
904128814 1:28260497-28260519 GAGGGAGAGCGCAGGGGCTCTGG + Intronic
904410933 1:30324557-30324579 CAGGCAGAGCAGGGGCTGTCTGG + Intergenic
904890728 1:33777484-33777506 CAGGCAGGGCAGTGGAGCACAGG - Intronic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905355741 1:37382946-37382968 CTGGCATAGTAGAGGTGCTCAGG - Intergenic
905628640 1:39506042-39506064 CAGTCAGATCGGAGGGGCCCCGG + Intronic
905692723 1:39955062-39955084 GAGGCGGGGCAGCGGGGCTCGGG + Intergenic
906375775 1:45295519-45295541 CAGGCCGGGCACAGTGGCTCAGG + Intronic
906613992 1:47222829-47222851 GAGGCAGAGCATAGGGGCGAGGG - Intronic
907029615 1:51157874-51157896 CTGCCAGACCAGAGGGGCTGGGG - Intergenic
907359950 1:53906319-53906341 CAGGGAGGGCAAAGGGGCCCAGG + Intronic
907380869 1:54086880-54086902 AAGGCAGGGCAGCGGGGCTAGGG + Intronic
907407093 1:54260348-54260370 CAGGGCGAGCAGTGGGGCTCTGG + Intronic
908217091 1:61964882-61964904 CAGGCAGAACACATGGGGTCAGG + Intronic
908765130 1:67547620-67547642 CAGGCAGATCACATGGGGTCAGG - Intergenic
910206692 1:84755326-84755348 CAGGCAGAGCCCAGGGGATGAGG - Intergenic
910601104 1:89033597-89033619 CTGGAAGAGAAGAGGTGCTCTGG + Intergenic
912115027 1:106395172-106395194 TAGGCAGAGCAAAGGGGATGAGG - Intergenic
912379451 1:109239501-109239523 AAGGCAGAGCAGGGGCGTTCAGG - Intergenic
912386791 1:109274768-109274790 CAGGAAAAGGAGAGGGGCTGGGG - Exonic
912430694 1:109626976-109626998 CAGGCAGGGCAGAGGTGCCCAGG - Intronic
912508353 1:110172023-110172045 GAGGGATGGCAGAGGGGCTCTGG - Intronic
912511066 1:110190418-110190440 CTGGCAGAGCAGTGAGGCTGAGG - Intronic
915284181 1:154842388-154842410 CAGGCCGAGGAGAGGGGCCCTGG + Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915513005 1:156396983-156397005 CAGGCAGATCACTGGGGCCCAGG - Intergenic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916216951 1:162404052-162404074 TAGGCAGGGCACAGTGGCTCAGG + Intronic
916674497 1:167054365-167054387 CAAGAAGAGCAGAGGAGCACTGG - Exonic
918005285 1:180536050-180536072 CAGGCAGATCACTTGGGCTCAGG + Intergenic
918249251 1:182686801-182686823 CAGCAAGAGAAGAGGGGCTGAGG + Intergenic
918345755 1:183605811-183605833 CAGGCAGATCACTTGGGCTCAGG + Intergenic
919340326 1:196298665-196298687 CAAGGAGGGCAGAGGGGCTGGGG - Intronic
919520475 1:198582035-198582057 CCAGCAGAGCAGCTGGGCTCTGG + Intergenic
920306205 1:205019787-205019809 GAGGCAGAGCAAAGAGGCTCAGG - Exonic
920312824 1:205058542-205058564 GAGGCAGAGACCAGGGGCTCAGG - Intronic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
921128001 1:212195335-212195357 CATGCAGGGCAGTGGGGCCCTGG - Intergenic
921582966 1:216916247-216916269 CAGGGAGAGCTGAGGGTCCCTGG - Intronic
921946092 1:220887090-220887112 ACGGCAGAGCTGGGGGGCTCAGG + Intergenic
922181344 1:223235490-223235512 CAGGCAGAGCACAGAGGATTTGG - Intronic
922317857 1:224458353-224458375 TATGCTTAGCAGAGGGGCTCTGG + Intronic
922608013 1:226902866-226902888 TAGGCAGAGGAGGGTGGCTCTGG - Intronic
922810135 1:228410754-228410776 CAGGCCTAGGAGAGAGGCTCAGG + Intronic
1062802943 10:393548-393570 CAGGCAGATCAGTGGAGGTCAGG + Intronic
1064063235 10:12157780-12157802 CCGGCCGGGCACAGGGGCTCAGG - Intronic
1064520281 10:16193664-16193686 TAGGCAGGGCACAGTGGCTCAGG + Intergenic
1065201265 10:23315666-23315688 CAGGCAGATCACTTGGGCTCAGG - Intronic
1065561491 10:26968414-26968436 CAGGGTGAGCACAGGGGCTGTGG - Intergenic
1067182250 10:43997148-43997170 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1067800477 10:49354920-49354942 CCAGCAGGGCAGGGGGGCTCAGG + Intergenic
1068588812 10:58832431-58832453 CAGGCAGAGCACATGAGGTCAGG + Intergenic
1069185544 10:65418015-65418037 AAGGCAGAGCAAAGGGGTTGGGG - Intergenic
1069536444 10:69257175-69257197 ATGGCAGAGCAGAGGGGCCTGGG - Intronic
1069572623 10:69503677-69503699 CATGTAGAGCAGCGGGGCTGGGG + Intronic
1069655477 10:70084827-70084849 CAGGCAGAGCACTTGAGCTCAGG - Intronic
1069747215 10:70723276-70723298 GAAACAGAGCAGAGGGGCTAAGG + Intronic
1069773435 10:70913551-70913573 CAGGCAGCGCACAGGGGACCTGG - Intergenic
1070624404 10:78039857-78039879 TGGGCAGAGCAGAGGGGCAGAGG + Intronic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070806527 10:79274160-79274182 CCTGCAGCACAGAGGGGCTCAGG + Intronic
1070812462 10:79305336-79305358 CAAACATGGCAGAGGGGCTCAGG + Intronic
1070850138 10:79556813-79556835 GAGGCAGAGCTGAGGGGACCAGG + Exonic
1071579606 10:86756963-86756985 CGGGGAGGCCAGAGGGGCTCGGG + Intronic
1073071846 10:100799181-100799203 CTGGGGGAGCAGTGGGGCTCAGG - Intronic
1073185847 10:101614580-101614602 CGGGCAGAGCAGGGGCTCTCAGG - Intronic
1073842681 10:107516087-107516109 TAGGCCAAGCACAGGGGCTCAGG + Intergenic
1074698022 10:116068301-116068323 GAGGTTGAGCAGAGAGGCTCTGG + Intronic
1074780154 10:116796733-116796755 GGGGCTGGGCAGAGGGGCTCAGG - Intergenic
1075015971 10:118910292-118910314 GAGGCGGAGGAGAGGGGCTGGGG - Intergenic
1075763231 10:124872445-124872467 GATGCACAGCAGAGGGGCTCAGG + Intergenic
1076112935 10:127874413-127874435 CAGGCCGAGGAGAGGTGCTTGGG - Intergenic
1076375972 10:129985097-129985119 CAGGCTGGGCATAGCGGCTCAGG + Intergenic
1076470842 10:130716903-130716925 CAGGCACAGCCATGGGGCTCCGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077024924 11:434916-434938 CTGGCAGAGGGGAGGGACTCAGG - Intronic
1077035645 11:493178-493200 CAGACAGCGCCCAGGGGCTCTGG + Intergenic
1077280902 11:1745033-1745055 CAGCCAGGGCAGAGAGGCTTTGG - Intronic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1078084575 11:8225929-8225951 CAGCCAGGGCTGAAGGGCTCTGG + Intronic
1078144972 11:8716289-8716311 CATGGAGAACACAGGGGCTCTGG + Intronic
1078184039 11:9036515-9036537 ATGGCTGAGCAGAGGGGCTCTGG - Intronic
1078196319 11:9139875-9139897 CAGGCAGGTCAGAGGGGCAAAGG + Intronic
1078413151 11:11144015-11144037 CAGGCTGAGCAGGGCGGCCCAGG - Intergenic
1078535834 11:12172844-12172866 CAGGCAGGTCAGAGGTTCTCTGG + Intronic
1078715175 11:13832903-13832925 CAGGCAGAGCATAAGTGCTCCGG - Intergenic
1078989564 11:16632839-16632861 CAGGAGGAGCGGAGTGGCTCAGG + Intronic
1079111105 11:17605691-17605713 CAGGCAGAGTAGGTGGGCTGGGG + Intronic
1079383787 11:19961024-19961046 CAGGAAAAACAGGGGGGCTCAGG - Intronic
1080483460 11:32677995-32678017 CAGGCCGAGCACAGTGGCTCAGG + Intronic
1082130275 11:48480176-48480198 AAGGCAGGGCACAGTGGCTCAGG - Intergenic
1083265783 11:61546274-61546296 CAGCCAGGCCAGAGGGGCACCGG + Intronic
1083306564 11:61764838-61764860 CAGGCAGAGGAGTGGAGCTCTGG + Intronic
1083310385 11:61780804-61780826 GAGCCAGAGGAGAGGGGCGCTGG - Intronic
1083594834 11:63914230-63914252 CAGGCAGGGCCCAGAGGCTCTGG + Intronic
1084166323 11:67376333-67376355 CAGGCATGGCAGAGGGGCACTGG - Intronic
1084422449 11:69067115-69067137 CAGGAGGAGCAGAGGGGCCCAGG - Intronic
1084470729 11:69357560-69357582 CCAGCAGAGCAGAGGGTCTGGGG + Intronic
1084524387 11:69686717-69686739 GAGGCTGATCAGAGGGGCCCTGG + Intergenic
1084970371 11:72768242-72768264 CAGAAAGAGCAGAGGGGCACTGG - Intronic
1085390250 11:76178625-76178647 CAGGCAGAGGTGTGGGGCTGTGG + Intergenic
1085390992 11:76182106-76182128 CAGGCAGAGCCCTGGGGCTTTGG - Intergenic
1085494703 11:76958075-76958097 TAGGCAGGGCACAGTGGCTCAGG - Intronic
1085514628 11:77105152-77105174 CGGGCACAGCAGAGGGACTCAGG - Intronic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087735276 11:101826065-101826087 CTGGCAGATCAGTGGAGCTCAGG + Intronic
1087900329 11:103633059-103633081 TAGGCTGAGCACAGTGGCTCAGG - Intergenic
1088351884 11:108898799-108898821 CCAGAAGAGCAGAGGGGCTTTGG + Intronic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088728413 11:112659340-112659362 CATCCAGAGCAGTGAGGCTCTGG + Intergenic
1088963645 11:114696053-114696075 CAGGCTGAGCTCAGTGGCTCAGG + Intronic
1089223201 11:116893070-116893092 CAGGCAGAGCACAGAGGATTTGG + Intronic
1089255511 11:117192022-117192044 CAGGCTGAGCAGAGCAGGTCAGG - Intronic
1089331310 11:117690837-117690859 GTGGGAGAGTAGAGGGGCTCTGG + Intronic
1089668566 11:120035801-120035823 CAGGCAGGGCAGAAAGACTCTGG - Intergenic
1089679326 11:120110578-120110600 CAGTGAGAACAGAGGGGCCCGGG + Intergenic
1089744824 11:120609343-120609365 CAGGAAGATCAGAGGAGCCCAGG - Intronic
1089849237 11:121482158-121482180 CAGGCAGAGGACTGGGGCTTTGG + Intronic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1090483239 11:127086464-127086486 CAGGAAGGGTAGAGTGGCTCAGG - Intergenic
1090618976 11:128544475-128544497 AAGGCAGGGGTGAGGGGCTCAGG - Intronic
1090918240 11:131186023-131186045 CATGAAGAGCAGTGTGGCTCTGG + Intergenic
1092731420 12:11538596-11538618 CAGGCACTGCAGAGGGGAGCCGG - Intergenic
1092844472 12:12571346-12571368 CAGGCAGATCACTTGGGCTCAGG + Intergenic
1094011496 12:25814868-25814890 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1095213362 12:39520497-39520519 CTGGCTGGGCACAGGGGCTCAGG + Intergenic
1095351776 12:41222110-41222132 AAGGCAGTACAGAGGGCCTCTGG - Intronic
1096177539 12:49532928-49532950 CAGACAGACAAGAGGGGCACAGG - Intergenic
1096281193 12:50255325-50255347 CAGGCAGATCACATGAGCTCAGG + Intronic
1096632616 12:52938493-52938515 CAGGCCAAGCACAGTGGCTCAGG + Intronic
1096789573 12:54036371-54036393 AAAGGGGAGCAGAGGGGCTCTGG + Intronic
1099226144 12:79971853-79971875 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1099448281 12:82777914-82777936 CAGGCAGAGGACAGGGGCCTTGG - Intronic
1100878801 12:98993448-98993470 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1101791273 12:107929956-107929978 CTGGCAGGGCAGTGGGGCTCTGG + Intergenic
1101939452 12:109089234-109089256 GAGGGAGAGCAGAGGGACTCTGG - Intronic
1102028427 12:109726626-109726648 CAGGAGCAGCAGGGGGGCTCAGG + Intronic
1102378794 12:112445865-112445887 CAGGCAGATCAGCTGGGGTCGGG - Intronic
1102795902 12:115688594-115688616 CAGGCAGAGAGTAGGTGCTCAGG + Intergenic
1102982370 12:117251958-117251980 CAGGCAGATCATTTGGGCTCAGG - Intronic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1103512764 12:121486557-121486579 CAGGCAGAGCACATGAGGTCAGG + Intronic
1103514200 12:121496374-121496396 CAGGAAGAGCAGAAGCGCTCAGG + Intronic
1103522456 12:121545612-121545634 CAGGGAGAGCGGAGGGGCTGAGG - Intronic
1103897125 12:124280067-124280089 AAGGCAGAGCAGGCAGGCTCAGG - Intronic
1103907544 12:124335284-124335306 CAGGCAGAGCAGAGCTGGTCAGG + Intronic
1104024718 12:125017380-125017402 CAGGCAGATCACTGGAGCTCAGG - Intronic
1104751760 12:131244630-131244652 CAGCCAGGGCAGAAGAGCTCAGG + Intergenic
1104780134 12:131414445-131414467 CAGCCAGGGCAGAAGAGCTCAGG - Intergenic
1104996865 12:132663576-132663598 CTGGGAGAGAAGAGGGGCTATGG + Intronic
1105024470 12:132839071-132839093 CAGGCAGCTCAGAGAGCCTCTGG - Intronic
1105706888 13:22972774-22972796 CAGGCAGAGAAGAGCAGCTCAGG - Intergenic
1106026505 13:25960420-25960442 GAGGGAGAGCAGAGGGCCTGAGG - Intronic
1106313997 13:28577800-28577822 CAGGCAGAGCAGAGGGCTTTGGG - Intergenic
1106563101 13:30863416-30863438 AAGGCAGAGCAGGCAGGCTCAGG - Intergenic
1106824480 13:33504822-33504844 GAGGCAGTGCACAGTGGCTCAGG - Intergenic
1107016356 13:35710725-35710747 CAGGCTGGGTATAGGGGCTCAGG - Intergenic
1107707107 13:43119196-43119218 CAGGCAAAGCAGAGGATCACTGG - Intergenic
1108132224 13:47314332-47314354 GAGGCAGGGCACAGTGGCTCAGG - Intergenic
1108442169 13:50466014-50466036 CAGGCAGAGTGGAGGGCCACTGG - Intronic
1108452875 13:50585024-50585046 CAGGCAGAGGACAGGGACTTGGG + Intronic
1110137856 13:72090486-72090508 CAGGCAGAGGAGAGTGCATCTGG - Intergenic
1110427874 13:75390046-75390068 CAGGCAGATCAGTTGGGGTCAGG + Intronic
1110993080 13:82069072-82069094 CAGGAAGAGCAGAGTGGCTCAGG + Intergenic
1113599397 13:111558008-111558030 CAGGCAGAGCTGAGGGTGTGGGG + Intergenic
1113900270 13:113793092-113793114 CAGGCAGAGCAGAGCAGAGCTGG - Intronic
1113977399 13:114238621-114238643 CAGGCAGAGGAGTGGAGCACTGG - Intronic
1114411777 14:22507614-22507636 AGGGAAGAGCAGAGGGGCTTAGG + Intergenic
1114528714 14:23381959-23381981 CAGGAAGGACAGATGGGCTCAGG + Intergenic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1116021945 14:39471874-39471896 TAGGCAGAGCACAGAGGATCTGG - Intergenic
1117213723 14:53528175-53528197 CAGGCAGAGGGCAGGGGATCAGG - Intergenic
1117469531 14:56028383-56028405 CAGCCAGAGAAGAGCTGCTCTGG + Intergenic
1117737025 14:58777854-58777876 CATGCAGAGCAGAGGGGCAAGGG - Intergenic
1118252427 14:64174297-64174319 CAGGCAGATCAGTTGAGCTCAGG - Intronic
1118533390 14:66731832-66731854 TGCACAGAGCAGAGGGGCTCAGG - Intronic
1118810206 14:69267618-69267640 CAGGCAGAGTGGAGTGGCCCAGG + Intronic
1118885553 14:69863023-69863045 AAGGATGAGCAGAGGGGCTGAGG + Intronic
1119640532 14:76311127-76311149 CAGGAAGGTCAGAGGGTCTCTGG + Intronic
1119867034 14:77982390-77982412 CAGGCAGATCACTGGAGCTCAGG - Intergenic
1120180659 14:81339372-81339394 CAGGCAGAGCTGTGCTGCTCTGG + Intronic
1120763867 14:88310541-88310563 CAGGCAGAGCAGACAGCCACAGG - Intronic
1120858037 14:89229879-89229901 CAGGCAGAGGAGAACAGCTCAGG + Intronic
1120874657 14:89364487-89364509 CAGGCAGGGAGGAGAGGCTCTGG + Intronic
1121017753 14:90558693-90558715 CCGGCAGGGCAGAGGAGCGCTGG - Intronic
1121469431 14:94140414-94140436 TAAGCAGGTCAGAGGGGCTCTGG + Intergenic
1122194062 14:100071746-100071768 CTGGTAGAGAGGAGGGGCTCTGG + Intronic
1122479870 14:102040124-102040146 CAGGCCGGGCACAGTGGCTCAGG - Intronic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122745524 14:103895114-103895136 CAGCCAGAGCAGGGGGCCTGGGG - Intergenic
1122981316 14:105193532-105193554 CTGGCAGAGCGGGGAGGCTCTGG - Intergenic
1123008269 14:105334843-105334865 CTGCCAGACCAGAGGGGCTCTGG - Intronic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1123196096 14:106618177-106618199 CAGGCAGATCAGTTGCGCTCAGG - Intergenic
1202918144 14_KI270723v1_random:3580-3602 GAGGAAGCGGAGAGGGGCTCCGG - Intergenic
1202926485 14_KI270724v1_random:31007-31029 GAGGAAGCGGAGAGGGGCTCCGG + Intergenic
1124249675 15:28098650-28098672 CAGGCAGGGGCCAGGGGCTCAGG - Intronic
1124404136 15:29379277-29379299 CAGGCTTCACAGAGGGGCTCAGG - Intronic
1124630145 15:31331534-31331556 AAAGCAGAGCAGAGGGCATCTGG + Intronic
1124630148 15:31331553-31331575 CTGGCAGAGCAGAGGGCATCTGG + Intronic
1125506618 15:40271246-40271268 CAGAAAGAGCAGAAGGGCTTGGG + Intronic
1125580634 15:40782954-40782976 CAGGCAGGGCAGATGTGCTTCGG - Intronic
1125617202 15:41025431-41025453 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1125860217 15:42992031-42992053 AAGGCTGAGCACAGTGGCTCAGG - Intronic
1126040035 15:44581432-44581454 CAGGCAGATCAGTTGAGCTCAGG - Intronic
1126142616 15:45450372-45450394 CAGGCGTAGCAGAGGGGCTCCGG + Intergenic
1126621809 15:50647462-50647484 CAGGCCGGGCACAGTGGCTCAGG + Intronic
1126920106 15:53511676-53511698 CTGTCAGAGCAGAGAGGCTCAGG - Intergenic
1127384215 15:58454124-58454146 CAGGGAGAGAACAGGTGCTCAGG - Intronic
1127430657 15:58904236-58904258 CAGGTAGAGCACCTGGGCTCAGG - Intronic
1128439438 15:67690759-67690781 CAGGCAGATCACTGGGGGTCAGG - Intronic
1128496550 15:68201523-68201545 CAGGGAGAGCAGTGGGCCTTGGG - Intronic
1128525797 15:68411437-68411459 CAGGCAGAGCACAGGAGACCAGG + Intronic
1128710934 15:69871487-69871509 CAGGTAGAGCAGTTGGGATCTGG + Intergenic
1128758564 15:70199261-70199283 GGGGCAGAGGAGAGGAGCTCTGG + Intergenic
1128949126 15:71856553-71856575 TAGGCAGAGCAAAGTGGCTACGG + Intronic
1129263996 15:74384240-74384262 CAGGGGGTGCAGAGGGGCTAAGG - Intergenic
1129600653 15:76996389-76996411 CAGCCAGAGCTGAGGGGCAGAGG - Intronic
1129679295 15:77648976-77648998 CATGCAGAGCTGAGGGGTTCTGG - Intronic
1130037415 15:80374410-80374432 AAGGCAGACCAGAGGGGTACAGG - Exonic
1130403463 15:83578283-83578305 CAGGCTGAGGGCAGGGGCTCCGG - Intronic
1132042444 15:98536686-98536708 CAGGCAGGGCATGGTGGCTCAGG + Intergenic
1132095854 15:98984289-98984311 CAGGCCGAGCACGGTGGCTCAGG - Intronic
1132466499 16:79756-79778 CAGGCAGCGGACAGGGGTTCAGG - Intronic
1132669574 16:1097084-1097106 CAGGCCAAGCTGAGGGGCTGCGG - Intergenic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132887117 16:2187136-2187158 CAGGCAGGGCAGAGGGGCAGTGG - Intronic
1132956453 16:2596853-2596875 CAGGCAGAGCAGAGGGGCCAGGG + Intronic
1133002333 16:2857636-2857658 CGTCCAGAGCCGAGGGGCTCAGG - Intronic
1133083856 16:3346113-3346135 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1133100083 16:3474210-3474232 GAGTCAGAGCAGAGCTGCTCAGG + Intronic
1133287057 16:4695371-4695393 CAGGCAGAGCAGGGTGGTCCGGG + Exonic
1134030201 16:10985931-10985953 CAGGCAGATCAGTTGAGCTCAGG - Intronic
1135117740 16:19737858-19737880 TATGCAGAGAAGAGGAGCTCAGG - Intronic
1136296872 16:29308891-29308913 CAGGCAGAGGAGACGGGCAGAGG - Intergenic
1137060155 16:35786230-35786252 CAGTCAGAGTAGAGGAGTTCAGG - Intergenic
1137604820 16:49780392-49780414 CAGGCGGAGCACAGGGGTGCTGG + Intronic
1137633227 16:49962818-49962840 CAGGCAGATCACATGAGCTCAGG + Intergenic
1137720850 16:50626519-50626541 CAGGCAGACGCCAGGGGCTCAGG + Intronic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1137812933 16:51370364-51370386 CAGGCAGAGGAGAGGAGGCCAGG - Intergenic
1138191813 16:55019238-55019260 CAGGCAGAGGGCAGAGGCTCGGG + Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1139516332 16:67454449-67454471 GAGGCAGAGCAGAAGGGCCCGGG + Intronic
1139573107 16:67825590-67825612 CAGGAAGGGCAGAGGGCTTCAGG + Intronic
1139590421 16:67930066-67930088 CTGGCAGACAAGAGGGCCTCCGG + Exonic
1139612724 16:68070376-68070398 CATGCAGAGGGGAGGGTCTCAGG - Intronic
1139847100 16:69929019-69929041 CATGCAGTGCAGAGGGTCCCAGG + Intronic
1140023345 16:71260706-71260728 CAGGGAGAGCATATGTGCTCAGG + Intergenic
1140481846 16:75266308-75266330 GGGGGAGGGCAGAGGGGCTCCGG - Intronic
1140891657 16:79290136-79290158 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1141041491 16:80676358-80676380 CAGGAAGAACAGCTGGGCTCAGG + Intronic
1141139369 16:81487221-81487243 CAGGTAGAGCAGTGAGGCTCAGG - Intronic
1141618987 16:85226719-85226741 CAGGCAGCCCAGGGAGGCTCAGG - Intergenic
1142363169 16:89636755-89636777 CAGGCAGAGGGGATGGGCTCTGG - Intronic
1142417777 16:89952433-89952455 CAGGCAGATCTGAGCAGCTCTGG - Intronic
1142658647 17:1412182-1412204 CAGGCAGATCAGCTGAGCTCAGG + Intergenic
1142969856 17:3604019-3604041 CAGGCACAGGCCAGGGGCTCTGG + Intergenic
1143378421 17:6480635-6480657 CAGGCAGAACAGAGGTGCAGAGG + Intronic
1143491717 17:7289087-7289109 CAGGCAGATCAGTTGGGGTCAGG - Intronic
1143724519 17:8836156-8836178 TAGCCATAGCGGAGGGGCTCAGG - Intronic
1143761030 17:9104522-9104544 AGGGCAGAGCAGAGGGGGTCTGG + Intronic
1144478229 17:15607740-15607762 CAGGGAGACCCTAGGGGCTCTGG - Intronic
1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG + Intronic
1144920065 17:18755966-18755988 CAGGGAGACCCTAGGGGCTCTGG + Intronic
1145290637 17:21542779-21542801 CTGGCAGAGAAGTGGGGTTCAGG + Intronic
1145880757 17:28351110-28351132 CAGGAGGAGGACAGGGGCTCAGG - Intronic
1145993100 17:29090940-29090962 AAGACAGATCAGAGGGCCTCAGG + Intronic
1146912815 17:36659159-36659181 AAGGCAGGGTGGAGGGGCTCAGG + Intergenic
1147536604 17:41326157-41326179 CAGGAGGAACAGAGGTGCTCAGG - Intergenic
1147937926 17:44024230-44024252 CAGGCAGAGCAGAGAGCCCAGGG + Intergenic
1148263736 17:46207694-46207716 CAGGTTGAGCACAGGGGATCAGG + Intronic
1148267728 17:46239843-46239865 TAGGCTGAGCACAGTGGCTCAGG - Intergenic
1148407012 17:47424206-47424228 CAGGCTGTGCAGGGGGGCTGCGG + Intronic
1148476172 17:47930129-47930151 GATGCAGAGCTGAGGGGCTGAGG - Intergenic
1148937244 17:51173295-51173317 CAAGAAGAGGAGAGGGGCTAAGG + Intergenic
1149647388 17:58250049-58250071 CAGGAATAGGAGAGGGGCTCTGG - Intronic
1149741909 17:59054891-59054913 CAGGCAGATCACTTGGGCTCAGG - Intronic
1150335320 17:64326538-64326560 CAGGCAGAGCAGAGGAAATAGGG - Intronic
1150445416 17:65224392-65224414 CAGGCAGAGCCGGGGTGGTCAGG - Intronic
1150457007 17:65314229-65314251 CTGACACAGCAGAGGGTCTCTGG + Intergenic
1150478571 17:65492129-65492151 GAGGAAGAGGAGAGGGGCTCTGG + Intergenic
1151660579 17:75516169-75516191 CAAGGAGGGCAGAAGGGCTCAGG - Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1151954127 17:77372366-77372388 CAGGCAGGGCCGAGGGGCTGGGG - Intronic
1151956513 17:77382867-77382889 CAGGCAGGGCAGCGGGGCTAGGG - Intronic
1152250383 17:79209401-79209423 CAGGCAGGACAGAGGCACTCGGG + Intronic
1152594436 17:81231545-81231567 GAGGCAGAGCAGGGCGGGTCCGG + Intronic
1153341224 18:3977297-3977319 CAGGCAGATCACTGGAGCTCAGG - Intronic
1153520409 18:5947571-5947593 CAGGCAATGCAGAAGGTCTCAGG + Intergenic
1154070842 18:11149807-11149829 CACGCAGAGCCGCGGGGCTGCGG - Intergenic
1154369003 18:13740603-13740625 CAGGCAGATCACCTGGGCTCAGG - Intronic
1155077659 18:22374822-22374844 CAGGCAGAGCACTTGAGCTCAGG + Intergenic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1157275382 18:46306939-46306961 CAGGCCGAGCGCAGTGGCTCAGG - Intergenic
1157447405 18:47755770-47755792 CAGGAAGAGCAGAGGATGTCAGG - Intergenic
1158357581 18:56638379-56638401 CAGCCAGAGCTGAGCGGCGCGGG - Exonic
1158597424 18:58828299-58828321 CCGGCTCAGCATAGGGGCTCAGG - Intergenic
1158700520 18:59741737-59741759 CATGCTGAGAAGAGGGGCTTGGG - Intergenic
1160050692 18:75430668-75430690 CAGTCAGTGCAGAGGAGTTCAGG + Intergenic
1160088176 18:75800033-75800055 CAGGCAGAACAGAGAGTCACTGG + Intergenic
1160213319 18:76902870-76902892 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1160519712 18:79497684-79497706 CAGCCAGAGAAGAGTGGCTGGGG - Intronic
1160773614 19:844496-844518 CAGGCAGGGGAGAGGCGCGCAGG - Intronic
1161056940 19:2195416-2195438 GAGACAGAGCAGATGGGCCCGGG - Intronic
1161298825 19:3533029-3533051 CAGGTGGGGCAGAGGGGCTGTGG + Intronic
1161437049 19:4269849-4269871 CAGGCAGGGCACAATGGCTCAGG - Intergenic
1161480047 19:4505884-4505906 CAAGGAGAGCAGGGGGGCTGAGG - Intronic
1161481939 19:4515494-4515516 CAGGCAGATCAGTTGAGCTCAGG - Intronic
1162052718 19:8044411-8044433 AAGGCAGAGCAAGGTGGCTCAGG + Intronic
1162582187 19:11538287-11538309 CCGGCACAGCAGAGGGACTCGGG - Intergenic
1162690133 19:12423018-12423040 CAGGCCGAGCACAATGGCTCAGG + Intronic
1163608252 19:18287546-18287568 CAGGCCGGGCACAGTGGCTCAGG + Intergenic
1163730917 19:18948753-18948775 AAGGCAGCTCAGAGGGCCTCTGG + Intergenic
1163769035 19:19179642-19179664 CAGGCAGGTCAAAGGGGCCCTGG - Intronic
1163798312 19:19349675-19349697 CAGGCAGAGCCCCAGGGCTCAGG + Intronic
1163906622 19:20154319-20154341 CAGGCAGGGCGCAGTGGCTCAGG + Intergenic
1164545482 19:29158319-29158341 CAGATCCAGCAGAGGGGCTCTGG + Intergenic
1164651786 19:29895902-29895924 CAGGCAGATCACTGGGGGTCAGG + Intergenic
1165760505 19:38318762-38318784 CTGGCAGAGGAGTGGGGCTTGGG - Intergenic
1165830537 19:38728279-38728301 CAGGCATAGCAGAGGAGGCCGGG - Intronic
1166244309 19:41514972-41514994 GAGGCCGGGCAGAGGCGCTCTGG - Intergenic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1166571899 19:43802342-43802364 GAGGCAGAGCAGAATGACTCTGG + Exonic
1166698423 19:44867620-44867642 TGGGCATAGCAGAGGGGCACGGG + Intronic
1166761132 19:45224986-45225008 TAGGTAGATCAGAGGGGCACAGG + Intronic
1166796191 19:45427817-45427839 CTGGCGGAGCAGAGAGGCCCCGG - Intronic
1166897730 19:46034486-46034508 AAGGCAGAACAGAGTGGTTCAGG - Intergenic
1166924640 19:46258976-46258998 CAGGCAGATCAGCTGAGCTCAGG - Intergenic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167516356 19:49925304-49925326 CAGGCCGGGCACAGTGGCTCAGG + Intronic
1167868911 19:52351227-52351249 CAGGCAGATCACCTGGGCTCAGG + Intronic
1167889590 19:52528665-52528687 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167894672 19:52571274-52571296 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167898741 19:52602198-52602220 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167903156 19:52637361-52637383 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167904552 19:52647982-52648004 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167909330 19:52689465-52689487 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167913841 19:52724758-52724780 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167921345 19:52785754-52785776 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167925852 19:52820612-52820634 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167930038 19:52856601-52856623 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167934173 19:52892833-52892855 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167937849 19:52922390-52922412 CAGACAGAGCAGAGTGGTGCTGG - Intergenic
1167940348 19:52941656-52941678 CAGACAGAGCAGAGTGGTGCTGG - Intronic
1167946366 19:52992323-52992345 CAGACAGAGCAGAGTGGTGCTGG - Intergenic
1167991825 19:53366703-53366725 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167995217 19:53396153-53396175 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1167999475 19:53432949-53432971 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1168003847 19:53469710-53469732 CAGACAGAGCAGAGTGGTGCTGG + Intronic
1168261757 19:55199021-55199043 CTGGCAGGGCACAGTGGCTCAGG + Intronic
1168339831 19:55616577-55616599 CAGGCGGGGCAGCGGAGCTCGGG - Exonic
1168421993 19:56210397-56210419 TAGGCAGAGCAGAGAGGATTCGG - Intergenic
1168427300 19:56249017-56249039 TAGGCAGAGCAGAGAGGATTCGG - Intronic
1168715547 19:58525101-58525123 CAGGCACAGCCGAGAGGTTCTGG - Intronic
925066657 2:933057-933079 CAGGCAGCGCTGCGGGGCTCTGG + Intergenic
925253982 2:2466512-2466534 CAGGCACAGCACAGGTGCTGGGG + Intergenic
925260302 2:2522929-2522951 AAGGCAGAGCAGGGGGCCACCGG - Intergenic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925338250 2:3114625-3114647 CAGGCAGAGTGGGGGAGCTCAGG + Intergenic
925410130 2:3635085-3635107 CAGGCAGGGGAGAGGGGGACAGG - Intronic
925894778 2:8462893-8462915 CAGCCAGGGGTGAGGGGCTCTGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926686815 2:15704480-15704502 CAGGCACAACAGAGGGACACTGG - Intronic
926710520 2:15875857-15875879 TAGGCTGAGCACAGTGGCTCAGG + Intergenic
927381363 2:22482715-22482737 CTGTCAGAGGACAGGGGCTCTGG + Intergenic
927529476 2:23781381-23781403 CAGGCTGGGCACAGTGGCTCAGG + Intronic
928395839 2:30942721-30942743 CACGCAGAGGAGAAGGGCTGAGG + Intronic
928918447 2:36500097-36500119 CAGGCAGATCACTGGAGCTCAGG + Intronic
929380015 2:41338054-41338076 GAGGGAGAGGAGAGGGGATCAGG + Intergenic
930014389 2:46960374-46960396 CAGGTATACCAGAGGAGCTCAGG - Intronic
931234800 2:60404128-60404150 CAGGCACAGCAGAGGGGTAAGGG - Intergenic
931552230 2:63459686-63459708 CAGGCAGATCACCGGAGCTCAGG + Intronic
931956945 2:67438212-67438234 CAGGCATAAGAGAGGGGCTGAGG - Intergenic
932307656 2:70715425-70715447 CAGGCAGAGCAGAGATGCAAGGG + Intronic
932465649 2:71922472-71922494 CAGGGAGAGAAAAGGGGGTCTGG - Intergenic
932526555 2:72475821-72475843 CAGCTAGGGCAGAGGGGCTGAGG - Intronic
932580258 2:72988802-72988824 CAGCCAGACCATAAGGGCTCAGG + Intronic
932642162 2:73460150-73460172 CATGAAGAGCAGTGGGGCTGAGG - Intronic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
934183424 2:89649513-89649535 CAGGCACAGCCTGGGGGCTCGGG + Intergenic
934520113 2:95014789-95014811 CAGGAAGAGAAGAGCTGCTCTGG - Intergenic
934657739 2:96124807-96124829 GAGGCAGTGCTGAGGGGCTGGGG - Intronic
935281593 2:101522453-101522475 CATGCAGAGGACAGGGGATCTGG + Intergenic
935327356 2:101948900-101948922 CAGGAAGAGCTGAGGGGGTTTGG + Intergenic
935650017 2:105374155-105374177 CCGGCATGGCAGAGAGGCTCTGG + Intronic
936488189 2:112945555-112945577 CAGCCAGAGTGGAGGGGCTGGGG + Intergenic
937060361 2:118976323-118976345 CAGAAAGTGCAGATGGGCTCTGG - Intronic
937228600 2:120383973-120383995 CAGACACAACAGAGGGGCCCAGG + Intergenic
937853416 2:126656105-126656127 CGGGCCGAGGGGAGGGGCTCTGG - Exonic
937885888 2:126899767-126899789 CAGACAGAGCCAAGGGGTTCTGG - Intronic
937952234 2:127397615-127397637 TAGGCAGTGGGGAGGGGCTCTGG - Intergenic
938094631 2:128453348-128453370 CTGGCAGGGAAGAGGGGCTGGGG + Intergenic
938196701 2:129334889-129334911 CAGGCAGTGCTGACGGCCTCAGG + Intergenic
938689353 2:133772944-133772966 CAGGCAGATCACCTGGGCTCAGG - Intergenic
939592058 2:144076835-144076857 CAGGCCGGGCACAGTGGCTCAGG + Intronic
940001616 2:148972207-148972229 AAGGCAGGGCACAGTGGCTCAGG - Intronic
940209868 2:151245312-151245334 CAGTCAGAGCAGAGTGGTTGAGG - Intergenic
940458731 2:153935622-153935644 CAGGCACAGCAGAGCAGTTCAGG + Intronic
940995303 2:160143058-160143080 CAGGCAGATCATTTGGGCTCAGG + Intronic
941587630 2:167380078-167380100 CAGGAAGAGTAGGGTGGCTCAGG + Intergenic
941872645 2:170401700-170401722 CTCGGAGAGCAGAGGGTCTCAGG + Intronic
942037164 2:172021638-172021660 TAGACAGAGAAGAGCGGCTCAGG + Intronic
942248319 2:174026774-174026796 CAGCCAGAGCAGAGTGACTAAGG - Intergenic
944061991 2:195579434-195579456 CAGGCTGGGCCCAGGGGCTCAGG - Intronic
944791569 2:203134946-203134968 CAGGCAGATCACAGGAGGTCAGG + Intronic
944817516 2:203393280-203393302 CAGGCAGAGCACTTGAGCTCAGG - Intronic
945121481 2:206461970-206461992 GAAGCAGAGGAGAGGGGCTAAGG + Intronic
946031776 2:216711043-216711065 AGGGCAGAGCAGAGGGGCAGCGG + Intergenic
946331877 2:219014082-219014104 CAGGCAGAACAGAGAGGCAGGGG + Intronic
946410066 2:219511345-219511367 CAGGGAGAGCAGTGGGTTTCTGG - Intergenic
946843739 2:223840932-223840954 CAGGCCGGGCACAGTGGCTCAGG + Intergenic
947361277 2:229347867-229347889 CAGACACAGCAGAGGGCCTAAGG - Intergenic
947574832 2:231264776-231264798 CAGGCTGGGCACAGTGGCTCAGG - Intronic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
948063772 2:235061692-235061714 CGGGCAGGGCAGAGGGGCAAGGG - Intergenic
948592808 2:239062252-239062274 CAGGAAGCGCAGAGGGGCCTTGG - Intronic
948603795 2:239122207-239122229 CCTGCAGAGCGGAGGGCCTCGGG - Intronic
948771365 2:240252805-240252827 CATACAGGGAAGAGGGGCTCAGG + Intergenic
949003695 2:241633244-241633266 CAGGAGGGGCAGAGGGGCTCTGG + Exonic
949031538 2:241799544-241799566 CAGGCAGGGGAGAGGGTCCCAGG - Intronic
1169053975 20:2604708-2604730 CAGGGAGGGGAGAGGGGCTGAGG + Intronic
1169316296 20:4593320-4593342 CACGCAGAGGACAGGGGCACAGG - Intergenic
1169791181 20:9412420-9412442 CAAGCAGAGAAGAGAGGCTCTGG - Intronic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1170080472 20:12469269-12469291 CAGGAAGACCCGAGGAGCTCAGG - Intergenic
1170957177 20:20991866-20991888 CAGGAAGAGGAGAGTGGCACAGG - Intergenic
1171124258 20:22587592-22587614 CAGGGAGAGCAGAGGAGGCCTGG - Intergenic
1171394328 20:24821772-24821794 CATGCAGAGCAGAGTTGGTCCGG - Intergenic
1172195807 20:33090682-33090704 CAGGCAAAGGAGAGGGTCACAGG - Intronic
1172390982 20:34565085-34565107 CAGACTGGGCAAAGGGGCTCTGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172467835 20:35169832-35169854 CAGGCTGTGCACAGTGGCTCAGG + Intergenic
1172506919 20:35469735-35469757 CAGGGAGTGCAGACGGGCTGGGG + Intronic
1172606125 20:36215314-36215336 GAAGCAGAGCAGAGTGGCTGGGG - Intronic
1172691479 20:36793400-36793422 CTGGCTGGGGAGAGGGGCTCTGG + Exonic
1172780050 20:37431261-37431283 CAGGAAGAACAGATGGGCTGTGG - Intergenic
1172839639 20:37894591-37894613 CAGGCAGAAGACAGGGCCTCAGG - Intergenic
1173807993 20:45938745-45938767 CAGGCAGAGAAGAGGGGGAGGGG + Intronic
1173818387 20:46005002-46005024 CAGCCAGGCCAGAGAGGCTCTGG - Intergenic
1174204753 20:48830080-48830102 CAGGCTGGGCACAGTGGCTCCGG + Intergenic
1174557478 20:51406199-51406221 GTGGCAGAGCAGTGTGGCTCAGG + Intronic
1175121732 20:56721202-56721224 CAGGGAGAGAAGGGGTGCTCTGG + Intergenic
1175299541 20:57933243-57933265 CAGGCAGGGGAGAGGGGCTGAGG - Intergenic
1175370385 20:58484361-58484383 AAGGCACAGCACAGGGACTCTGG + Intronic
1175727085 20:61325905-61325927 CAGGCCAACCAGACGGGCTCTGG - Intronic
1175945411 20:62556349-62556371 CGTGCAGGGGAGAGGGGCTCGGG - Intronic
1176226691 20:64004268-64004290 CAGGCAGAGAAGCTGGGCTAAGG + Intronic
1176247521 20:64104524-64104546 CAGACACAGCAGGGGGGCACAGG + Intergenic
1176893804 21:14351577-14351599 CAGGCAGATCACTGGAGCTCAGG - Intergenic
1178430488 21:32514567-32514589 AACACACAGCAGAGGGGCTCAGG - Intronic
1178846683 21:36179963-36179985 CAGGCAGAGGAGAGGGGCAAAGG - Intronic
1178858803 21:36272366-36272388 CAGGCCGGGCACAGTGGCTCAGG + Intronic
1179133089 21:38656144-38656166 CAGGGAGGGCAGAGAGGTTCAGG + Intronic
1179411952 21:41168698-41168720 CGGGGAACGCAGAGGGGCTCGGG + Intronic
1179553242 21:42156595-42156617 CAGCCAGAGCTGGGGGTCTCAGG - Intergenic
1179631383 21:42680579-42680601 CAGGCAGTGCAGGAGGGCACAGG - Intronic
1179717907 21:43299459-43299481 AGAGAAGAGCAGAGGGGCTCGGG - Intergenic
1179985795 21:44919751-44919773 CTGACAGAGGAGAGGGGCCCCGG + Intronic
1180006957 21:45027284-45027306 CAGGCAGTGAGGAGGTGCTCCGG + Intergenic
1180231990 21:46432155-46432177 CAGGCAGAGCCCAGCGGCTGCGG + Exonic
1181496483 22:23290075-23290097 CAAGGACAGCAGAGGGGGTCGGG - Intronic
1181523107 22:23460532-23460554 CAGGCCAAGTAGAGTGGCTCTGG - Intergenic
1182027785 22:27134095-27134117 CAGGGAGGGCAGAGGGGATGGGG + Intergenic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182318974 22:29466098-29466120 CAGGCAGAGCCCTGGGGCCCAGG + Intergenic
1183104615 22:35607155-35607177 CAGGAGGAGCTGAGGGGCTGGGG - Exonic
1183180691 22:36257858-36257880 CACTCAGAGCAAAGGGGCTAGGG - Intronic
1183314043 22:37127572-37127594 CAGGCTGAGAAGTGGGGCTGAGG + Exonic
1183385155 22:37510048-37510070 CAGGCTGGGTAGCGGGGCTCAGG - Intronic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1183831953 22:40422929-40422951 CAGGCAGAGGTGTGGGGCTGGGG + Intronic
1184045756 22:41971424-41971446 CAGGCAGGGGTGAGGAGCTCAGG - Intergenic
1184128090 22:42501543-42501565 CAGGGAGAGATAAGGGGCTCAGG + Intergenic
1184136880 22:42554856-42554878 CAGGCAGAGATAAGGGGCTCAGG + Intronic
1184496107 22:44842546-44842568 CAGGCAGACCTCAGTGGCTCAGG + Intronic
1184642332 22:45879257-45879279 AAGAGAGAGCAGAGGGGCTGGGG + Intergenic
1185246833 22:49777168-49777190 GAGGAAGAGCAGAGGGAGTCAGG + Intronic
949846891 3:8380679-8380701 CAGGCAGAGCACAGGCTGTCAGG - Intergenic
949878610 3:8644006-8644028 CAGGCAGTGCAGAGGGGTGGTGG - Intronic
949967079 3:9365869-9365891 CAGGCCGAGCGCAGTGGCTCAGG - Intronic
950289809 3:11774552-11774574 CAGGGAGAGCAGTAGGGCCCTGG - Intergenic
950764313 3:15262010-15262032 GAGCCTGAGCAGGGGGGCTCTGG + Intronic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
951466790 3:23009661-23009683 CAGGCAGATCACTTGGGCTCAGG + Intergenic
952342517 3:32457917-32457939 GAGGCAGAGCAGAGGGTGTGGGG + Intronic
952846925 3:37695634-37695656 CAGGCAGAGCATGGGGGCAGTGG - Intronic
953125549 3:40088646-40088668 CAGGCAGTGCAGAGGCCCTTAGG + Intronic
953424226 3:42780000-42780022 CAGGCAGATCACTTGGGCTCAGG + Intronic
953906119 3:46869066-46869088 CAGGCAGAGCTGGGGAGCTGGGG - Intronic
953909686 3:46885545-46885567 CCTGGAGAGCAGTGGGGCTCTGG - Intronic
954683282 3:52357506-52357528 CAGGCCCCGCTGAGGGGCTCTGG + Intronic
954688903 3:52385459-52385481 CAGGCATTGGGGAGGGGCTCGGG - Intronic
955489660 3:59469609-59469631 TAGGCAGAGCTGAAGAGCTCTGG - Intergenic
956218142 3:66871749-66871771 CAGGCAGATCACTTGGGCTCAGG + Intergenic
957188272 3:76971883-76971905 CAGGCAGTGCAGAGGTGAGCAGG + Intronic
957219580 3:77364522-77364544 CAGGCATATCAGAGGTTCTCTGG + Intronic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
961039008 3:123663895-123663917 CAGGCTCAGCAGAGGGGCCAAGG - Intronic
961232528 3:125330181-125330203 CAGGCTGAGCGCAGTGGCTCAGG + Intronic
961369927 3:126422912-126422934 CAGGCAGGGCAGAGGGGCTGGGG + Intronic
961684649 3:128621281-128621303 CAGGCAGAACACTTGGGCTCAGG + Intronic
961786372 3:129349640-129349662 CAGGGACAGCCGAGGGCCTCAGG + Intergenic
962251049 3:133836305-133836327 CAGGCAGATCAGAGCCGCCCAGG - Intronic
962412753 3:135155574-135155596 CAGGCAGATCAGTGGCGCTCAGG + Intronic
962891142 3:139674043-139674065 CAGGGACAGCAGAGAGGCACAGG + Intronic
965530707 3:169767766-169767788 CACGGAGAGAAGAGGGCCTCTGG + Exonic
966508695 3:180736297-180736319 CAGGCAGGGCAGAGAGGATCTGG - Intronic
966720291 3:183055613-183055635 CAGGCTGAGCACAGTGGCTCGGG + Intronic
966928571 3:184661180-184661202 CAGGCAGGCAGGAGGGGCTCAGG + Intronic
967312403 3:188118256-188118278 CAGGCAGAGGATTGGGGCTAAGG + Intergenic
967881554 3:194305410-194305432 AAGGCAGAGCTGTGGGGCTGTGG + Intergenic
968513488 4:1005349-1005371 CAGGCAGGGCACATGGGCTTTGG - Intergenic
968663688 4:1809614-1809636 TAGGGAGAGCAGAGGGGATGGGG - Intergenic
968759728 4:2436547-2436569 CAGGCAGAGCAGAGAGTGCCAGG - Intronic
968840899 4:3005016-3005038 CAAGCAGAGCAGAGAGGGCCTGG - Intronic
968941370 4:3640462-3640484 CTGGGAGGGAAGAGGGGCTCAGG + Intergenic
969048672 4:4356950-4356972 CAGACAGAGCAGAAAGGCGCAGG - Intronic
969570749 4:8006776-8006798 CAGGCAGGGCAAGGGGGCTATGG - Intronic
969684829 4:8665591-8665613 CAGGCAGAGCAGAGGCTCTGGGG - Intergenic
969841555 4:9886771-9886793 CAGACTGAGAAGGGGGGCTCAGG - Intronic
970843242 4:20501509-20501531 CAGGCAGATCACTGGAGCTCAGG - Intronic
971320217 4:25599556-25599578 CTGGCAGGGCACAGTGGCTCAGG - Intergenic
971440098 4:26676434-26676456 CAGGCTGGGCACAGTGGCTCAGG + Intronic
971458931 4:26873475-26873497 TGGCCAGAGCAGGGGGGCTCTGG + Intronic
972488599 4:39565549-39565571 CAGGCAGATCACTTGGGCTCAGG - Intronic
972645786 4:40966732-40966754 CAAGCACAGCAGAGAGGCTGAGG + Intronic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
974717842 4:65693888-65693910 CAGGCAGAGCACTTGGGCCCAGG - Intergenic
978298844 4:107242257-107242279 CTGGCTGAGCACAGTGGCTCAGG + Intronic
978749748 4:112232579-112232601 CTGGCAGAGCAGGTGGGATCTGG + Intronic
979218018 4:118189276-118189298 CAGGCAGAGCACCTGAGCTCAGG - Intronic
979538963 4:121857398-121857420 CAGGCTGGGCACAGCGGCTCAGG - Intronic
980794520 4:137663462-137663484 GAGGCCCAGCAGAGGGGCCCTGG - Intergenic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
984067034 4:175061899-175061921 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
984427549 4:179607225-179607247 AAGGAAGAGCAGATGGCCTCGGG + Intergenic
984857536 4:184207872-184207894 CAGGCGGTGGAGAGGGGCCCAGG - Intronic
985331653 4:188843873-188843895 ATGGCAGGGCACAGGGGCTCAGG - Intergenic
985379175 4:189374233-189374255 CAGGCAGAGCCCAGGGCCTATGG - Intergenic
985587342 5:747632-747654 TAGTCAGGGCAGAGGGGATCGGG - Intronic
985659732 5:1151067-1151089 CTGGCACAGCAGTGAGGCTCTGG - Intergenic
985661581 5:1159904-1159926 CAGCCAGGTCAGAGGGACTCAGG + Intergenic
985762495 5:1757427-1757449 TGGGGTGAGCAGAGGGGCTCAGG + Intergenic
986439025 5:7762399-7762421 CAGTCAGAGCTCAGGGGCCCAGG - Intronic
986484993 5:8227108-8227130 CAGGCCGAGCGCAGGAGCTCAGG + Intergenic
986772841 5:10989163-10989185 CTGCCAGTGCAGAGGGGCACTGG + Intronic
986786884 5:11122943-11122965 AGGGCAGAGCTGAGGGCCTCTGG + Intronic
987202919 5:15595398-15595420 CAGGCAGACCAGATCGGCTGAGG + Intronic
990155957 5:52877647-52877669 CAGGCAGAGAGGAGAAGCTCAGG - Intronic
990631946 5:57680032-57680054 CAGGCACAGAAGAGGAGGTCTGG + Intergenic
991674717 5:69079579-69079601 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
992194825 5:74328695-74328717 CTGTCAGAGCAGAGGGGCAGTGG + Intergenic
992368311 5:76115911-76115933 CAGCAAGAGTAAAGGGGCTCAGG - Intronic
992378221 5:76210671-76210693 CAGGAAGGGGAGAGGGGCTGGGG - Intronic
992639546 5:78757306-78757328 GAGGCAGAGAAGAGAAGCTCTGG - Intronic
992750547 5:79856957-79856979 GAGGCAGAGAAGGTGGGCTCAGG + Intergenic
993991275 5:94661005-94661027 CAGGAATATCAGTGGGGCTCCGG + Intronic
995298496 5:110549331-110549353 GAGGCCAAGCAGAGTGGCTCAGG + Intronic
995542811 5:113201102-113201124 CTGGCTGGGCACAGGGGCTCAGG + Intronic
995622302 5:114039625-114039647 CAGGAAGAGTAGGGTGGCTCAGG + Intergenic
995759054 5:115544610-115544632 CAGGCGGAGCAGGGCGGCCCGGG - Exonic
997186189 5:131884376-131884398 CAGGAAGAGCAGTAAGGCTCTGG + Intronic
997237059 5:132278779-132278801 CAGGTGGGGCAGAGGGACTCAGG - Intronic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
998007387 5:138666008-138666030 CAGGCCCAGCAGTGGGGCTGAGG + Intronic
999083602 5:148867229-148867251 AAGGAGGAGCAGAGGGGCTTGGG + Intergenic
999417580 5:151412600-151412622 TAGGCAGCGCACAGAGGCTCTGG + Intergenic
999655609 5:153807753-153807775 CAGGCAGAGGGGAGGGGCAGGGG - Intronic
999673833 5:153979618-153979640 CAGGGAGATCAAAGGGGCTGAGG - Intergenic
999997060 5:157102299-157102321 CAGGCAGATCACTGGAGCTCAGG - Intronic
1000432982 5:161173046-161173068 TAGGAATAGCAGAGGGGCTGTGG + Intergenic
1001128443 5:169042482-169042504 CTAGGAGAGCAGAGGGGCACCGG - Intronic
1001200421 5:169711054-169711076 CAGGCAGAGCAAAGGAACTGAGG - Intronic
1001580406 5:172794300-172794322 CAGCTAGAGCAGAGGGGCCTTGG + Intergenic
1001619074 5:173067111-173067133 CAGGCCGAGCACGGTGGCTCAGG - Intronic
1001806284 5:174589547-174589569 CAGGCAGAGCAGATGGCATGAGG - Intergenic
1001886299 5:175293483-175293505 CATGCAGAGCACAAGGGATCAGG - Intergenic
1002081661 5:176741086-176741108 CAGGGAGAGCACAGCGGCTGTGG + Intergenic
1002363402 5:178691854-178691876 CATGCTGTGCAGAGGGGCCCTGG + Intergenic
1002562679 5:180092996-180093018 CAGGCAGAGGAGAGGAGCCGAGG - Intergenic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1003494614 6:6653387-6653409 CAAGCGGAGCAGAGGGACTGTGG - Intronic
1003715589 6:8642659-8642681 CAGGCAGAGAAGAGGCACACAGG - Intergenic
1004305371 6:14497243-14497265 CAGGTAGAGCAGAGGAGATGGGG - Intergenic
1004982617 6:21042898-21042920 AAGCCAGAGCAGAGGCGTTCAGG - Intronic
1005707594 6:28470653-28470675 ATGGCAGGGCACAGGGGCTCAGG + Intergenic
1005959628 6:30686149-30686171 AAAGCAGGGCAGAGGGGCTAAGG + Exonic
1006037150 6:31222872-31222894 CAGCCAGGGCAGGGGGGCTGAGG - Intergenic
1006429881 6:33988938-33988960 AAAGCAGGGCAGAGGTGCTCAGG - Intergenic
1006445003 6:34075103-34075125 CGGGCAGTGCAGTGGGGCTGTGG + Intronic
1006729101 6:36222281-36222303 CAGGCAGAACTGAGGGGGCCAGG + Intronic
1007623271 6:43227860-43227882 CAGGCAGATCACTTGGGCTCAGG + Intronic
1007638758 6:43318926-43318948 CAAGCAGAGCAGAAGGACTGGGG + Intronic
1007706775 6:43795845-43795867 GAGACAGAGATGAGGGGCTCTGG - Intergenic
1007765600 6:44158046-44158068 CAGGCAGGGCTGAGGGGCACTGG + Intergenic
1008085623 6:47241059-47241081 CAGGCATATAAGATGGGCTCTGG + Intronic
1008555866 6:52672327-52672349 CAGGAAGAGCTGGGGGGCTCAGG + Intronic
1008610766 6:53182814-53182836 CAGGCCGGGCACAGTGGCTCAGG - Intergenic
1009638713 6:66302321-66302343 CAGGCCCAGCACAGTGGCTCTGG + Intergenic
1009988023 6:70805566-70805588 TTGGAAGAGAAGAGGGGCTCTGG + Intronic
1010986227 6:82427660-82427682 CAGGCAGTCCAGAAGGACTCCGG + Intergenic
1011381148 6:86743469-86743491 CAGGGAGAGCATAGAAGCTCTGG - Intergenic
1011842853 6:91523533-91523555 CATGCAGAGCTGAGGCTCTCTGG - Intergenic
1012528545 6:100206416-100206438 CCTCCAGAGCAGAGGGGCTCTGG - Intergenic
1013811462 6:114049391-114049413 CAGGCAGATCACAGGAGCTCAGG - Intergenic
1015454519 6:133410937-133410959 GAGGAACAGCAGAGGGGCTGAGG - Intronic
1017545848 6:155450180-155450202 CTGGCAAAGCAGTGGGGTTCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018340922 6:162850498-162850520 CAGGGAGGGGAGAGGGGCTGAGG + Intronic
1018587376 6:165376631-165376653 CAGGCTGGGCACAGCGGCTCTGG + Intronic
1018887874 6:167956826-167956848 CAGGAAAAGGAGAGAGGCTCTGG - Intronic
1019468389 7:1203227-1203249 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1019568740 7:1697931-1697953 CAGACAGGGCAGTGGGGCTGGGG + Intronic
1019588223 7:1816026-1816048 CAGGCCAAGCAGAGTGGCTCCGG + Exonic
1019621065 7:1992209-1992231 AAGTCAGAGCAGTGGCGCTCTGG - Intronic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1022266001 7:28755476-28755498 CAGCCAGACCATAGAGGCTCAGG + Intronic
1022819038 7:33940475-33940497 CACTCAGATCTGAGGGGCTCAGG - Intronic
1022883138 7:34611563-34611585 AAGTCAGAGCAGAGGAGGTCTGG + Intergenic
1023030809 7:36089226-36089248 TGGGCAGGGCAGCGGGGCTCTGG - Intergenic
1023849510 7:44142210-44142232 AGGGCACAGCAGAGGGGCTGGGG + Intergenic
1023905018 7:44515989-44516011 CAGGCAGGGCACAGGGCATCAGG + Intronic
1023905023 7:44516008-44516030 CAGGCAGGGCACAGGGCATCAGG + Intronic
1024570906 7:50722199-50722221 TGGGCAGGGCAGAGGGGCTGTGG - Intronic
1024583463 7:50820351-50820373 CAGGCAAAGAACTGGGGCTCAGG - Intergenic
1024871323 7:53964568-53964590 TAGGCAGAGAAGAGAAGCTCTGG + Intergenic
1026586761 7:71661782-71661804 CAGGGAGAGCTGAGGGACTTTGG + Intronic
1026972728 7:74477943-74477965 CAGGCAGTGCAGGGGGGCCCTGG - Intronic
1026992625 7:74595879-74595901 CCAGCAGAACAGAGGGGGTCTGG - Intronic
1028165174 7:87530157-87530179 CACACAGATCAGAGTGGCTCTGG - Intronic
1028908832 7:96185001-96185023 CATGCAAAGCAGAAGGCCTCAGG - Exonic
1029137836 7:98387198-98387220 CAGGCGGAGGAGAGGGGCTGCGG + Intronic
1029333429 7:99879429-99879451 CAGGCAGGGGACAGTGGCTCAGG + Intronic
1029600307 7:101559355-101559377 CAGGCAGAGAATAGCAGCTCAGG + Intergenic
1031764802 7:125764520-125764542 CAGGCAGATCACTGGAGCTCAGG - Intergenic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1032230693 7:130070916-130070938 CACGCATAGCAGAGGGACTGGGG + Intronic
1032708343 7:134441458-134441480 CAGCCTGTGCAGTGGGGCTCTGG + Intergenic
1033206409 7:139426916-139426938 CAGGCAGATCGCTGGGGCTCAGG - Intergenic
1034541195 7:151759333-151759355 CAGTCAAAGGAGAGGGGCTGCGG - Intronic
1034840616 7:154392044-154392066 CAGGCAGATCAGTTGAGCTCAGG + Intronic
1036125396 8:6057484-6057506 CAGGCAGAGCAGGGCGGGGCTGG - Intergenic
1036479874 8:9130188-9130210 CAGGGAGAGGAGAGGAGCTGTGG + Intergenic
1036620670 8:10422970-10422992 GAGGCAGGGCAGTGGCGCTCCGG - Intronic
1036777762 8:11625301-11625323 AAGGCAGAGAGGAGGGGCACAGG + Intergenic
1037305709 8:17501293-17501315 GAGGCCGAGCACAGTGGCTCAGG - Intronic
1037451982 8:19024698-19024720 CAGGAAGGGGAGAGGGGGTCTGG + Intronic
1037770163 8:21794133-21794155 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1038226283 8:25661021-25661043 CAGGCAGATCAGTTGAGCTCAGG - Intergenic
1038319374 8:26513739-26513761 CAGGTGGAGGAGAGGGGCACTGG + Intronic
1039535269 8:38305283-38305305 CAGGCAGAGCAGCAGTGCTGAGG + Exonic
1039890295 8:41681432-41681454 TGGCCAGAGCAGAGGGGCTCAGG - Intronic
1040015210 8:42693888-42693910 CAGGCAGATCACAGGAGGTCAGG - Intergenic
1040928949 8:52714331-52714353 CTGTCAGAGCCGAGGGGCCCAGG + Exonic
1042091765 8:65166359-65166381 CAGGCAGAGGACAGAGGCTCCGG - Intergenic
1042107889 8:65348313-65348335 TAGGCAGAGAACAGGGCCTCAGG + Intergenic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1042499840 8:69496785-69496807 GAGGCAAAGCACAGTGGCTCAGG - Intronic
1043683760 8:83064041-83064063 CAGGCAGGGCAGTGGTGGTCAGG - Intergenic
1043949171 8:86289075-86289097 CAGGCAGATCACCTGGGCTCAGG + Intronic
1044669627 8:94665773-94665795 CTGGCCGGGCACAGGGGCTCAGG - Intronic
1044902254 8:96959228-96959250 CAGCCAGAAAAGAGGTGCTCAGG + Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045254256 8:100506405-100506427 CAGGTAGAGCAGAGGCTCTCAGG - Intergenic
1047362050 8:124178341-124178363 CAGGCAGGGCTGAGGGGTGCGGG - Intergenic
1048319446 8:133386925-133386947 GAGGCAAAGCAGTGGGGCTATGG + Intergenic
1049065200 8:140308094-140308116 CAGGCAGAGCAGGGAAGCACAGG + Intronic
1049238132 8:141522981-141523003 CTTGCTGAGCAGAGGGGCTGGGG + Intergenic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049662546 8:143826200-143826222 GCGGCACAGCAGAGGGGCTCTGG + Intronic
1049688679 8:143949457-143949479 GGGGCAGAGCAAAGGGTCTCTGG + Intronic
1049804106 8:144531164-144531186 CAGGCACAGCTGAAGGGCACAGG + Intronic
1049804118 8:144531223-144531245 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804130 8:144531282-144531304 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804143 8:144531341-144531363 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804155 8:144531400-144531422 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804169 8:144531459-144531481 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804181 8:144531518-144531540 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804195 8:144531577-144531599 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804209 8:144531636-144531658 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804222 8:144531695-144531717 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804236 8:144531754-144531776 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804250 8:144531813-144531835 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804262 8:144531872-144531894 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804276 8:144531931-144531953 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804289 8:144531990-144532012 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804302 8:144532049-144532071 CAGGCACGGCAGAAGGGCACAGG + Intronic
1050102066 9:2129646-2129668 CAGGGAGGGCAGAGAGGCTGGGG - Intronic
1051367521 9:16331746-16331768 AAAGCAGAGCAGAGGGCCCCAGG + Intergenic
1051430933 9:16979712-16979734 CAGGCAGATCACATGAGCTCAGG + Intergenic
1051455186 9:17247433-17247455 GAGGCAGAGCACAGGGACTGTGG - Intronic
1052095545 9:24379835-24379857 CCAGAAGAGCAGAGGGGCTTTGG + Intergenic
1053167245 9:35853476-35853498 GAGACAGAGAAGTGGGGCTCAGG - Intronic
1053415039 9:37942121-37942143 CAAGAAGAGCTGAGGGGCACTGG - Intronic
1056658691 9:88529201-88529223 CGGGGAGGGGAGAGGGGCTCAGG + Intergenic
1056813490 9:89782512-89782534 GAGGCAGCCCAGAGGGGCCCAGG - Intergenic
1056986681 9:91370103-91370125 CAGGCAGACCACTTGGGCTCAGG + Intergenic
1057268761 9:93635526-93635548 CAGGCAGAGAAGAGCAGCTGGGG - Intronic
1057518280 9:95739471-95739493 CAGGCAGAGGTGGGGGGTTCAGG + Intergenic
1057585507 9:96324973-96324995 TAGCCAGAGCAGAGGACCTCTGG + Intronic
1057618903 9:96618659-96618681 GAGGCCCAGGAGAGGGGCTCGGG + Intronic
1058316012 9:103567740-103567762 CAGGCAGGGCACGGTGGCTCAGG + Intergenic
1058851033 9:109012836-109012858 CAGGCGGAGGAGCCGGGCTCGGG + Intronic
1059108600 9:111533398-111533420 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1059327975 9:113516142-113516164 CAGGGAGACCAGAGAGGCACAGG - Intronic
1060089079 9:120727332-120727354 CAGGAATAGCAGAAGGGCTCTGG + Intergenic
1060145248 9:121247231-121247253 CAGCCAGACCAGAGGTGCTCAGG + Intronic
1060445594 9:123684443-123684465 AAGGCAGTGCAGTTGGGCTCTGG - Intronic
1060666217 9:125433570-125433592 CTGGGGCAGCAGAGGGGCTCAGG + Intergenic
1060672112 9:125478974-125478996 AAGGCAGAGCAGTTAGGCTCAGG + Intronic
1060999797 9:127896716-127896738 GAGCCAGAGCAGAGGAGTTCGGG - Intronic
1061185271 9:129049297-129049319 CAGGCAGTGGAGGAGGGCTCAGG + Intronic
1061625242 9:131837504-131837526 GAGGCAGGGCAGGGGTGCTCAGG + Intergenic
1061750066 9:132770971-132770993 CTGGCTGAGCAGGGGGCCTCAGG + Intronic
1061782492 9:133004220-133004242 CAGGCCGGGCTGAGGGGCGCTGG - Intergenic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1061866452 9:133493985-133494007 GGGGCAGGGCAGAGGGGCACAGG + Intergenic
1061866477 9:133494071-133494093 GGGGCAGGGCAGAGGGGCACAGG + Intergenic
1061866490 9:133494114-133494136 GGGGCAGGGCAGAGGGGCACAGG + Intergenic
1061896731 9:133652217-133652239 CAGGCAGAGCCGAGGGGTGGGGG - Intronic
1062048461 9:134435241-134435263 CAGGCCGTGCACAGGGGCCCTGG + Intronic
1062468833 9:136693279-136693301 CGGGCTGAGCACAGGGGGTCGGG - Intergenic
1062495512 9:136829741-136829763 CAGGAAGAACAGTGGGGCTATGG - Intronic
1062582536 9:137234865-137234887 GAGGCAGAGCAGCAGGGCTGAGG - Intronic
1187834131 X:23413739-23413761 CAGGCAGATCACATGAGCTCAGG + Intergenic
1188650491 X:32626187-32626209 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1189506460 X:41615906-41615928 AAGGCCGAGCACAGTGGCTCAGG - Intronic
1190166502 X:48077258-48077280 TAGGCAGAGCACAGTGGCTCAGG + Intergenic
1191251159 X:58260843-58260865 CAGGCCCAGCACAGGGGCTGTGG - Intergenic
1192168427 X:68840253-68840275 CAGGAAGAGAAGAGTGGCCCAGG + Exonic
1193713221 X:84903659-84903681 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1194248433 X:91542957-91542979 CAGGCAGGGCAAGGTGGCTCAGG + Intergenic
1194671717 X:96741709-96741731 CAGGCAGATCACATGAGCTCAGG - Intronic
1195094245 X:101490330-101490352 AAGGCAGACCAGAGGGTCTGTGG + Exonic
1197341929 X:125285582-125285604 CAGGCTGTGCGCAGGGGCTCAGG - Intergenic
1199807255 X:151312641-151312663 CTGGCAGAGCAGAGGGGTGTAGG - Intergenic
1200567444 Y:4784477-4784499 CAGGCAGGGCAAGGTGGCTCAGG + Intergenic
1200734441 Y:6779134-6779156 CAGGTTCAGTAGAGGGGCTCAGG - Intergenic
1201069055 Y:10127739-10127761 CAGGCAGACCAGGTGGCCTCAGG + Intergenic