ID: 915494553

View in Genome Browser
Species Human (GRCh38)
Location 1:156272470-156272492
Sequence TAAGCATCAGAGAACCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915494546_915494553 16 Left 915494546 1:156272431-156272453 CCACAATACTCATTCAAAGCTGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 915494553 1:156272470-156272492 TAAGCATCAGAGAACCTGTAGGG 0: 1
1: 0
2: 0
3: 18
4: 166
915494548_915494553 -6 Left 915494548 1:156272453-156272475 CCAGGCCCAACCAATGCTAAGCA 0: 1
1: 0
2: 0
3: 13
4: 129
Right 915494553 1:156272470-156272492 TAAGCATCAGAGAACCTGTAGGG 0: 1
1: 0
2: 0
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915494553 Original CRISPR TAAGCATCAGAGAACCTGTA GGG Intronic
901283441 1:8057762-8057784 TAAGCAGCTGAGTAGCTGTATGG + Intergenic
902120710 1:14163092-14163114 TTAGCAGCAGTGAATCTGTATGG + Intergenic
903130064 1:21273264-21273286 TACTCAGCAGAGAACCTGGAAGG - Intronic
903666783 1:25012917-25012939 TAAGCATCAAAGTACCCCTAAGG + Intergenic
907421527 1:54350824-54350846 AAAGCATCTGAGAAGCTGTGCGG - Intronic
908947029 1:69510816-69510838 TAAACAACAGAGAACGTTTATGG + Intergenic
909851474 1:80470082-80470104 TAAGCAATATAGAACCTGAACGG + Intergenic
909888767 1:80976287-80976309 TCAGAATCAGAGAACCTGGTTGG - Intergenic
910393752 1:86771196-86771218 TATGCATCATAGAACATGTTGGG - Intergenic
912028500 1:105208213-105208235 AAAGCATCAGATAACCTACAAGG + Intergenic
912931250 1:113964515-113964537 TAAGCATCCAAAAACCTGAAAGG + Intronic
915494553 1:156272470-156272492 TAAGCATCAGAGAACCTGTAGGG + Intronic
916458228 1:164993012-164993034 TAAGTGTCAGAGAACCAGAAAGG - Intergenic
917128561 1:171715399-171715421 TTACCAACAGAGAAGCTGTATGG + Intronic
919527976 1:198678772-198678794 AAAGCATCAAAGAATCTTTAAGG - Intronic
919866472 1:201786800-201786822 TTAGCATCAGAGAGCCTGAATGG + Intronic
921843054 1:219848582-219848604 AAAGCATCAGGTAACCTATAAGG + Intronic
922166677 1:223121449-223121471 TAGTCATCAGAGTGCCTGTAAGG - Intronic
922421023 1:225461329-225461351 TAAACATCAGCAAACCTGGATGG - Intergenic
923277718 1:232413138-232413160 GAAGAACCAAAGAACCTGTAAGG - Intronic
924930052 1:248722419-248722441 AAAGCACCAGATAACCTATAAGG + Intronic
1062819197 10:521534-521556 TGAGCATCACTGCACCTGTAAGG + Intronic
1064158933 10:12926758-12926780 TAAGCATAAGAAAGCTTGTAGGG + Intronic
1065676103 10:28176275-28176297 TAAGCCTGAGAGACCCTGTCAGG + Intronic
1068123361 10:52807588-52807610 TATGCCTCAGAGAACCTGAGTGG - Intergenic
1069704051 10:70446249-70446271 AAAGCATCTGAGAACCTCAAGGG - Intronic
1069809774 10:71149744-71149766 TAAGCATCAGAGATCTAGCATGG + Intergenic
1072381611 10:94878277-94878299 AAAGCATCAGGTAACCTATAAGG - Intergenic
1074343660 10:112659257-112659279 GAAGCAGCAGAAAACCTGAATGG - Intronic
1077821292 11:5744343-5744365 CAAGCATCATAGAACCAGTTAGG - Intronic
1080235278 11:30061158-30061180 TAAGCTTGTGAGAATCTGTAAGG + Intergenic
1080527186 11:33135077-33135099 TAAGAATCAGATAACCTTTAAGG - Intronic
1080763678 11:35276537-35276559 TAAGCATGTGAGCACCTGCATGG + Intronic
1080978213 11:37367241-37367263 AAAGCATCAGGTAACCTATAAGG + Intergenic
1085565561 11:77510123-77510145 TAAGCATTATAGAACATGTAGGG + Intergenic
1086598579 11:88604950-88604972 TCAGAGTCAGAGAACCTGTTGGG + Exonic
1087386521 11:97476514-97476536 TTATCTTCAGAGAACCTGGAGGG + Intergenic
1088125914 11:106423226-106423248 TAAGCATCATATCACCTGTAAGG - Intergenic
1090041752 11:123298338-123298360 TATGCATCAGATAACCAGGAAGG + Intergenic
1095516348 12:43010507-43010529 TGAGCATTAGAGACCCTGTGAGG + Intergenic
1100970483 12:100064538-100064560 GAAGCACCAGGTAACCTGTAAGG + Intronic
1102273874 12:111564502-111564524 TATGCAACAGAGAAGCTATATGG + Intronic
1103097692 12:118145139-118145161 AAAGCATCAAAGAATCTTTAAGG + Exonic
1105678296 13:22699366-22699388 TAAGGAACACAGAACCTATATGG - Intergenic
1106071152 13:26412359-26412381 GAATCATCAGAGAAGCTCTATGG - Intergenic
1108070358 13:46622653-46622675 TAAGGAACTGAGAACCTGTAAGG + Intronic
1108866309 13:54926890-54926912 TCTGCTTTAGAGAACCTGTAAGG + Intergenic
1110969293 13:81740664-81740686 GAAGCATCAAATAAACTGTAGGG + Intergenic
1111243213 13:85502948-85502970 TTAGCAGCAGTGAATCTGTATGG + Intergenic
1113547445 13:111165056-111165078 TACCAATCAGAGAACATGTAGGG + Intronic
1115870467 14:37795389-37795411 TTAGCATCAGAGAAATTGAATGG + Intronic
1116406237 14:44569412-44569434 AAAACATCAGATAACCTATAAGG + Intergenic
1116892112 14:50278949-50278971 TAAACAACATAGAACCTGCAAGG - Intronic
1118182878 14:63510875-63510897 GAAGCAGCAGGGAACCTGTTGGG + Intronic
1118990266 14:70791391-70791413 TAAGCTGCAGAGAACCTCCACGG + Intronic
1119016599 14:71063227-71063249 TATGCAACAGAGAATGTGTATGG - Intronic
1120400187 14:84021658-84021680 AAAGCATCAGGTGACCTGTAAGG - Intergenic
1121758502 14:96423340-96423362 AAAGCATCAAAGAATCTTTAAGG - Intronic
1125434511 15:39630666-39630688 TAAGCCTCAGAGAAATTGAATGG + Intronic
1125761835 15:42101818-42101840 AAATCATCAAAGAACCTGTTTGG - Intergenic
1127337020 15:57997613-57997635 TAAGCATCATAAAATGTGTAGGG - Intronic
1127425922 15:58856520-58856542 AAATCATCAAAGAACCTGTTTGG + Exonic
1132133148 15:99304012-99304034 TCAGTATCAGATAACCTGTACGG + Intronic
1135883077 16:26278303-26278325 AAAGCATTAGGTAACCTGTAAGG - Intergenic
1138262533 16:55635528-55635550 TTAGCAGCAGTGAATCTGTACGG - Intergenic
1140047243 16:71449199-71449221 TAGGCATCAGAGAATCCATACGG - Exonic
1141264317 16:82482418-82482440 TATGCATCAGGGAATATGTAAGG + Intergenic
1143874885 17:9984227-9984249 GAAGCATCAGAGGACCAGAAGGG - Intronic
1146147348 17:30431764-30431786 TAACCACCAAAGAACCTATAAGG - Exonic
1150838058 17:68582533-68582555 TAAGTATCAAATAACCTGTAAGG + Intronic
1152810210 17:82378206-82378228 TCTGCATCAGAGAAGCTGCAAGG - Intergenic
1158199856 18:54927905-54927927 GAAGCAGCAGGGAGCCTGTAGGG + Intronic
1159221054 18:65463545-65463567 TAAGCATCAGAGACCTGGTGAGG + Intergenic
1164268994 19:23652709-23652731 TCAACATCAGTGAATCTGTATGG - Intronic
1164505848 19:28860673-28860695 TGACCATCAGAGAAACAGTATGG - Intergenic
1165830143 19:38726601-38726623 GAAGCATCTGTGGACCTGTATGG - Intronic
1165960577 19:39531009-39531031 TATGCATTAGAAAACCTGAAAGG + Exonic
1166553924 19:43685563-43685585 TAAAGATCAGAGAAGCTGGATGG + Intergenic
925319456 2:2951082-2951104 ACAGAATCAGAGAACCTGAATGG - Intergenic
925385676 2:3460024-3460046 TCGGCATCAGAGAACCAGGAGGG - Intronic
925577379 2:5374410-5374432 GAAGCATCAGGGAACCTTTCAGG - Intergenic
928136670 2:28693117-28693139 TAAGCATCAATGACCCTATAAGG + Intergenic
928901981 2:36329234-36329256 TAAGCATCATACAATCTATATGG - Intergenic
930735227 2:54771742-54771764 TATGCCTCAAAGAAACTGTATGG - Intronic
931862580 2:66371813-66371835 TAACCATGAGAGAACCAGTTTGG - Intergenic
933712920 2:85340918-85340940 AAAGCATCAAAGAATCTTTAAGG - Intergenic
933844582 2:86315060-86315082 TAAACATCAAAGACCCTGCAGGG + Intronic
933848716 2:86348630-86348652 TCAGGTTCAGAGAACCTGTAAGG + Intergenic
936491432 2:112976103-112976125 TAAGTATCAGAGAAATTGGAGGG - Intronic
936634074 2:114235404-114235426 TAAGCTTCAGACACCCAGTAAGG + Intergenic
939610329 2:144302061-144302083 TAAGCCTCTGAGAACCTTAAGGG + Intronic
943226978 2:185190232-185190254 AAAGCATCAGAGAGCCAGAAAGG - Intergenic
944088932 2:195883149-195883171 TAAGAATCAGAAAACCTGGCCGG + Intronic
945249174 2:207749065-207749087 ACAGTATCAGAGAACCTGCAGGG + Intronic
1170139309 20:13109972-13109994 TCAGAATCAGAGAACCCTTAGGG - Intronic
1170669660 20:18420063-18420085 TAAGCATCAGAAAAGTTGTTTGG - Intronic
1171386789 20:24775005-24775027 AAAGCATAACAGACCCTGTAGGG + Intergenic
1172802920 20:37590942-37590964 TAAGCACCAGAGACCCTCTGAGG - Intergenic
1173277721 20:41598950-41598972 TAAGGGTCAGAGGACCCGTAGGG - Intronic
1175473766 20:59254096-59254118 TGAGCATCTGAGAAGATGTATGG - Exonic
1176416082 21:6475470-6475492 TAAGGCCCAGAGAACTTGTAAGG - Intergenic
1178581095 21:33839354-33839376 CAAGGATCAGAGAACCTTCAGGG + Intronic
1179254813 21:39706436-39706458 TTAGCAGCAGTGAATCTGTATGG + Intergenic
1179691582 21:43083804-43083826 TAAGGCCCAGAGAACTTGTAAGG - Intergenic
1181516679 22:23418098-23418120 TGGGCATCAGGGAACCTGTCGGG - Intergenic
1185058280 22:48592383-48592405 TAAGCATCAGAGGACCTTGGAGG + Intronic
949337446 3:2991415-2991437 TAAGAATCAGAGGACCTCTGTGG - Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955825336 3:62940147-62940169 TTAGCAGCAGGGAAGCTGTATGG - Intergenic
955930109 3:64047879-64047901 AAAGCATCACAGAAACAGTACGG + Intergenic
956068768 3:65425153-65425175 TAAACATCATACAATCTGTACGG + Intronic
956184934 3:66553397-66553419 TAGGCCTCGGAGAACCTGCAGGG + Intergenic
959666424 3:108927119-108927141 AAAGCATCAGGCAACCTATAAGG - Intronic
960657908 3:120026403-120026425 TAAGCCAAAGAGAACCTGTAAGG + Intronic
961077270 3:123993569-123993591 TAAGCATCAGTGAACAAGTGGGG + Intergenic
961249242 3:125485669-125485691 GAAGCATAAGACAATCTGTATGG - Intronic
961307305 3:125967752-125967774 TAAGCATCAGTGAACAAGTGGGG - Intergenic
962985993 3:140536519-140536541 TGACCATCAGTGAACCTGTGAGG - Intronic
963987072 3:151608605-151608627 TAAGCATCCGAGAAACAATATGG - Intergenic
965439897 3:168699627-168699649 TAAGCATAATATAAACTGTAAGG + Intergenic
965928771 3:174016247-174016269 TGAGCATCAGAGAAACTTTTGGG + Intronic
966702297 3:182867912-182867934 TATGCAACAGAGACCATGTATGG + Intronic
967037185 3:185656679-185656701 GAATCATCAGAGAAGCTGAAAGG - Intronic
967537641 3:190625240-190625262 TAAGCATCAGAAAAATTGTATGG + Intronic
967576510 3:191101003-191101025 AAAGCCTCAGAGAAACTGTAGGG - Intergenic
968213949 3:196872069-196872091 GAAGCTTCAGTTAACCTGTACGG + Intronic
970217361 4:13773965-13773987 GAAGCACCAGGTAACCTGTAAGG - Intergenic
972986495 4:44772304-44772326 TCAGCAGCAGTGAATCTGTATGG - Intergenic
973024784 4:45254053-45254075 CAAGCATCACAGAACCCATAAGG - Intergenic
973307236 4:48666412-48666434 TAAGAATTAGAGAACCAATAGGG + Intronic
974783097 4:66580449-66580471 TAAGCATCAGAGAACCACCTGGG - Intergenic
975583828 4:75930698-75930720 TAAGCATAATGGAAGCTGTAGGG - Intronic
976967184 4:91057458-91057480 GAAGCATGAGAGAAACAGTAAGG + Intronic
977509870 4:97949773-97949795 AAAGCATCAGGTAACCTGTAAGG - Intronic
978199669 4:106011186-106011208 AAAGCATCAGGTAACCTATAAGG - Intergenic
978465210 4:109001395-109001417 TAGGCATCTGAGATCCTGTCAGG + Intronic
979664091 4:123291758-123291780 AAAGCATCAGATAACTTGAAAGG - Intronic
979996860 4:127441621-127441643 TAACCATCACAGAAACTGCAAGG - Intergenic
980420054 4:132547261-132547283 TTAGCAGCAGCGAATCTGTACGG - Intergenic
982334989 4:154225261-154225283 GAAGCATCAGAGAACCACCAAGG - Intergenic
983526409 4:168764677-168764699 GAAGAATCTGAGAAGCTGTAAGG - Intronic
984489809 4:180418683-180418705 TAAGGGGCAGAGAGCCTGTATGG + Intergenic
984839932 4:184058925-184058947 TAGGCATCAGAGAACATGAGGGG - Intergenic
986539700 5:8830801-8830823 AAAGCATCAGATAACCTATAAGG + Intergenic
986712985 5:10501413-10501435 TCAGCATCAGAGGAACTGCAAGG + Intergenic
987300529 5:16593636-16593658 GAAGCATCAGATAACATGAATGG + Intronic
992898798 5:81271713-81271735 AAAGCATCAGGTAACCTATAAGG + Intergenic
992987962 5:82253115-82253137 TAAGGTCCAGAGAGCCTGTAAGG - Intronic
994355999 5:98794289-98794311 TAAGAGTCAAAGCACCTGTAAGG - Exonic
997630471 5:135364610-135364632 TGAGCAGCAGAAAACCTGTTAGG + Intronic
998632932 5:143920286-143920308 CTAGCATCAGATAACCTGGAAGG + Intergenic
1004250512 6:14019509-14019531 TAAGCATGAGAGAAAATATATGG + Intergenic
1005132834 6:22530721-22530743 TCAGCACCAGAGAAGCTGTGAGG - Intergenic
1005848875 6:29803703-29803725 TAAGCAGCAGAGTAGCTGTTTGG + Intergenic
1007879112 6:45141994-45142016 AAAGCATCAGGTAACCTATAAGG + Intronic
1013790917 6:113835471-113835493 TAAGTTTCAGAAAAACTGTAAGG - Intergenic
1014887641 6:126801167-126801189 TAAGTATAAGAGAGTCTGTAAGG + Intergenic
1015085725 6:129289007-129289029 TAAGCACCAAAGACCCAGTAGGG + Intronic
1019583594 7:1782686-1782708 TAATCATCAGAGAATCTGCTCGG + Intergenic
1020378692 7:7517551-7517573 TAAGCATCAGAGAATTTGATAGG + Intronic
1024385996 7:48752531-48752553 TCAGCATCAGAGAAGCTGGCTGG - Intergenic
1024664269 7:51530186-51530208 TAGGCATCAGATGACTTGTAAGG - Intergenic
1028783032 7:94758680-94758702 AAAGCATCAGGTAACCTATAGGG + Intergenic
1029645537 7:101853400-101853422 TAAGCATCAGAGAAAATAAATGG - Intronic
1029885221 7:103862591-103862613 GAACCATCAGAGAACCTGAAAGG - Intronic
1030865632 7:114698830-114698852 TAAGCATCAGAGAAGGTTTGAGG - Intergenic
1031501318 7:122521381-122521403 CAAGCAGCAGAGAACTTGTAGGG - Intronic
1034429366 7:151033597-151033619 TAGCCATCAGAGTACCTGTAAGG - Exonic
1036533224 8:9617604-9617626 TACTTATTAGAGAACCTGTATGG - Intronic
1036684421 8:10899720-10899742 GAAGCCTCAGAAAACCAGTAAGG - Intronic
1039098664 8:33915619-33915641 AAAGCAACAGTGAACCTGTCAGG - Intergenic
1039723990 8:40195633-40195655 TACTCATCTGAGAAACTGTAAGG - Intergenic
1045141307 8:99286662-99286684 TCAGAATCAGATAACCTGCAAGG + Intronic
1047029279 8:120859303-120859325 TAAGCAACAGAGAATTTATAAGG - Intergenic
1051888753 9:21922567-21922589 TTAGCAGCAGTGAATCTGTATGG - Intronic
1052794999 9:32915442-32915464 TTAGCAGCAGAGAACCTAGAAGG + Intergenic
1056671909 9:88637443-88637465 AAAGCATCAGGTAACCTATAAGG - Intergenic
1056934302 9:90904018-90904040 AAAGCATCAGTGAAGCAGTACGG + Intergenic
1057634874 9:96755188-96755210 TAAGGATCAGGAACCCTGTAGGG - Intergenic
1060497664 9:124130200-124130222 TAAGGATCAGAGGACTTGCAGGG - Intergenic
1188732075 X:33661596-33661618 AAATCATCAGAAAAGCTGTAAGG - Intergenic
1189683865 X:43543864-43543886 TTAGCAGCAGAGAATCTGTATGG + Intergenic
1197903196 X:131395170-131395192 TAAGCATCACACAACATGAAAGG + Intronic
1198563686 X:137881107-137881129 TAAGCATCAGAGACCCAATATGG + Intergenic
1198821829 X:140656135-140656157 TTACCATCAGAGAAGCTGTGGGG + Intergenic