ID: 915495778

View in Genome Browser
Species Human (GRCh38)
Location 1:156281999-156282021
Sequence TCCAGAGCGTTCTTGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915495778_915495781 5 Left 915495778 1:156281999-156282021 CCAAATCCCAAGAACGCTCTGGA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 915495781 1:156282027-156282049 AAGTCGTTCGTGACCCTTCCAGG 0: 1
1: 0
2: 2
3: 3
4: 33
915495778_915495785 24 Left 915495778 1:156281999-156282021 CCAAATCCCAAGAACGCTCTGGA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 915495785 1:156282046-156282068 CAGGCCAAGACTTTCTCATTCGG 0: 1
1: 0
2: 2
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915495778 Original CRISPR TCCAGAGCGTTCTTGGGATT TGG (reversed) Intronic
902128412 1:14237262-14237284 TCCAGAGCACTCCTGAGATTCGG - Intergenic
902229364 1:15017982-15018004 TCCATAGGGTTCTTGGAAATGGG - Intronic
903031948 1:20470007-20470029 TCCTGAACCTTCTTGGGATATGG - Intergenic
903191088 1:21656559-21656581 TCCAGAAGCTTCCTGGGATTGGG - Intronic
905352756 1:37358968-37358990 TCCAGAGCCTTCTTAGCATAGGG - Intergenic
905380610 1:37559125-37559147 TCCACAGGGATCTTGGGAATGGG - Intronic
907489313 1:54799076-54799098 TCCAGAGAGAGTTTGGGATTTGG - Intronic
907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG + Intronic
910289924 1:85589610-85589632 ACCACAGCATTCTTGGGGTTGGG + Intergenic
910710663 1:90176517-90176539 TCTAGAGAGGTCTTGTGATTTGG + Intergenic
911446856 1:98005789-98005811 CCCAGAGGGTTCATGGGTTTTGG + Intergenic
914341508 1:146764115-146764137 TCCAGAGCTTACATGGGGTTGGG - Intergenic
915443021 1:155958232-155958254 TCCAGAGCTCTCGTGGGCTTGGG + Intronic
915495778 1:156281999-156282021 TCCAGAGCGTTCTTGGGATTTGG - Intronic
920706986 1:208258698-208258720 TCCAGGGTGATCTTAGGATTGGG + Intergenic
921223415 1:212992249-212992271 TCCAGAGAGTTCAAGGGATTGGG - Exonic
922080666 1:222292805-222292827 TCCAGAGCGTTCTGAGGGTTAGG - Intergenic
1063218776 10:3947224-3947246 TACAGAGCTTTCTTAGAATTGGG - Intergenic
1064760171 10:18610844-18610866 TTCAAAGAGTTCTGGGGATTAGG + Intronic
1065626450 10:27634346-27634368 TCCAGAGCTTTCTGTGGGTTTGG + Intergenic
1068512823 10:57987531-57987553 TCCAGTGCATTGTTGGGCTTTGG - Intergenic
1069767916 10:70877372-70877394 TTCAGAAGGTTCTTGGGATATGG + Exonic
1084035366 11:66506603-66506625 TCCAGAGGCTTCCTGGGATTTGG + Intronic
1086261359 11:84945277-84945299 CTCACAGCGTTCTTGGGCTTGGG - Intronic
1087218383 11:95519293-95519315 TGCAGAGTGTTCTTGAGATGGGG + Intergenic
1093676470 12:21946126-21946148 TCCAGAGCAGTCATGGGGTTGGG - Intergenic
1100008303 12:89921293-89921315 TCCAGAGCTCTTCTGGGATTTGG + Intergenic
1103556262 12:121768559-121768581 TCCAGAACTCTCTTGGGACTGGG - Intronic
1103706523 12:122877251-122877273 TCCAGTGTGTACTTGGAATTTGG + Intronic
1103783077 12:123412454-123412476 TACACAGGGTTCTAGGGATTAGG + Exonic
1110901624 13:80832024-80832046 TCCAGAGTGTTACTGGGCTTGGG + Intergenic
1117971522 14:61255367-61255389 CCCAGAGAGGTCTTGAGATTGGG + Intronic
1125035703 15:35121641-35121663 TCCAGAGCTGTCTGGGAATTTGG - Intergenic
1125254212 15:37744786-37744808 TCCAGATCTTTTCTGGGATTGGG - Intergenic
1126849202 15:52787329-52787351 CCCAAAGCGTTCTTTGGGTTTGG - Intronic
1133081924 16:3328676-3328698 TCAAGAGAGTTGTTGGGATAAGG - Intergenic
1136679341 16:31946621-31946643 ACCAGAGCATTATTGGGCTTGGG + Intergenic
1138547306 16:57727575-57727597 CCCAAAGAGTACTTGGGATTTGG + Intronic
1140833020 16:78769039-78769061 TCAAGAGAGTTGTTGGGGTTGGG + Intronic
1141731225 16:85824551-85824573 TCAGGAGCCTTCTGGGGATTTGG + Intergenic
1144814486 17:18024488-18024510 TTCAGAGCACTCGTGGGATTTGG - Intronic
1146770968 17:35568327-35568349 TCCCGGGAGTTCGTGGGATTTGG + Intergenic
1153095225 18:1393580-1393602 TCCATAGAGATATTGGGATTTGG + Intergenic
1156321356 18:36027142-36027164 TCCAGAACTTTTTTGGGAGTTGG - Intronic
1157621413 18:49019204-49019226 CCCAGAGCGCCCTTGGCATTGGG + Intergenic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1158835492 18:61327335-61327357 GCCAGAGCGTTGTTGAGAGTGGG + Intergenic
1159260613 18:66006865-66006887 ACCAGAGTGTTATTGGGCTTGGG + Intergenic
1162225595 19:9219097-9219119 CCCAGAGTGGTCTGGGGATTGGG - Intergenic
1162992414 19:14312214-14312236 ACCAGAGCTTCCTGGGGATTGGG + Intergenic
1166241582 19:41498458-41498480 TCCAGAGCCTGCTTGGGATCAGG - Intergenic
1166408191 19:42538832-42538854 ACCACAGCATTCTTGGGCTTGGG - Intronic
1168474330 19:56665003-56665025 TCGATATGGTTCTTGGGATTCGG + Exonic
925116383 2:1382016-1382038 GCCAGTGCCTCCTTGGGATTGGG - Intronic
930595995 2:53388588-53388610 TCCAGAACGTTCTATGGAATTGG + Intergenic
933592428 2:84247651-84247673 TCCAGAGCTTTGTGGGGATGGGG - Intergenic
937568111 2:123321156-123321178 TCCAGAGCCATGGTGGGATTTGG - Intergenic
938970084 2:136423838-136423860 TCCAGGGCGTACGTGGGAGTCGG - Intergenic
942014386 2:171796318-171796340 TCCTGTGCGTTGTTGGGATTTGG - Intronic
942391658 2:175501832-175501854 ACCACAGCATTCTTGGGCTTGGG - Intergenic
942432317 2:175925597-175925619 TCTTGAGTGTTCTTGGGATGAGG - Exonic
1172708201 20:36898947-36898969 AACAGAGCCTTCTGGGGATTTGG + Intronic
1181237475 22:21456374-21456396 TCCCCAGCGATTTTGGGATTTGG + Intergenic
1181492857 22:23271568-23271590 TCCAGAGAGTTCTTGGTCGTTGG - Exonic
949543468 3:5052501-5052523 TCCATAGAGTTGTTGGGAGTAGG + Intergenic
950398104 3:12749519-12749541 CCCAGAGAATTCTTGAGATTTGG + Intronic
952331536 3:32368030-32368052 TCCAAGGCTTGCTTGGGATTGGG + Intronic
953129178 3:40121479-40121501 CCCAGATTGTTCTTGGGATGGGG - Intronic
953205443 3:40823681-40823703 TCCAGAGCTTTCTGTGGAATTGG - Intergenic
953875365 3:46663599-46663621 TCCAGAGAGTTCTTGGGCTCAGG + Intergenic
955673400 3:61425699-61425721 TCCAGAATGTTCTTGGTATCTGG + Intergenic
961975690 3:131022747-131022769 GCAAGAGCCTTCTTGGCATTGGG - Intronic
967671193 3:192237738-192237760 TTCACCGTGTTCTTGGGATTGGG + Intronic
969548377 4:7847487-7847509 TCCAGAGAGTTCTTTTGATTGGG - Intronic
973819127 4:54647176-54647198 TCCAGAGCATTGAAGGGATTTGG + Intergenic
974791174 4:66691922-66691944 TCCAGAGCTTTCCTGAGATGGGG + Intergenic
979396849 4:120198718-120198740 ACCACAGCGTTCTTGGGCTTGGG + Intergenic
981429037 4:144639776-144639798 TCCAGAGCCCCCTTGGAATTAGG + Intergenic
981692331 4:147523399-147523421 ACTAGAGTGTGCTTGGGATTTGG + Intronic
982683254 4:158458479-158458501 ACCAGAGCGTTATTGGGCATGGG - Intronic
985602079 5:840721-840743 ACCAGAGCGTGCTGGGGATGGGG + Intronic
988612109 5:32736608-32736630 TCCTGAGCATTCTTAGAATTTGG + Intronic
992118181 5:73562951-73562973 TCCAGTGTGTTCTTGGAATCTGG + Exonic
992881428 5:81114196-81114218 GCTAGAGAGTTCTTGGAATTTGG + Intronic
994091984 5:95817778-95817800 TCCAGTGCGTTCCTGGTACTCGG - Intronic
994216997 5:97149032-97149054 CCCAGAGCTGTCTTGGTATTTGG + Intronic
994235484 5:97357821-97357843 ACCACAGCGTTATTGGGCTTGGG - Intergenic
994976115 5:106809196-106809218 TCCTGAGCTTTCTTGGATTTAGG + Intergenic
1004199786 6:13536910-13536932 TGCAGAGCTTTTTTTGGATTTGG + Intergenic
1010863450 6:80942149-80942171 CCCAGAAGGTTCTAGGGATTTGG - Intergenic
1013295295 6:108753458-108753480 TCCAGGGCTTTCTTCAGATTTGG - Intergenic
1014016145 6:116532477-116532499 TTTATAGCATTCTTGGGATTTGG - Intronic
1014633692 6:123818466-123818488 TGCAGAACCTTCTTGGGTTTGGG - Intronic
1017906529 6:158760581-158760603 CCCAGAAGGTTCTTGGGACTTGG + Intronic
1022717850 7:32914896-32914918 TCCAGAGGGTTCTCATGATTTGG + Intergenic
1029235737 7:99116879-99116901 TCCAGATCGTTTTTGCTATTTGG - Intronic
1034635465 7:152563891-152563913 TTCAGAGGGTTCTTGGCCTTAGG - Intergenic
1036226143 8:6959384-6959406 TCAAGAGGGTTCTTGGGCCTGGG + Intergenic
1041557704 8:59176361-59176383 TCCACAGGGTTGTTAGGATTAGG + Intergenic
1046258972 8:111741173-111741195 TATAGAGCGTAATTGGGATTTGG + Intergenic
1047410812 8:124623087-124623109 TCAAGACAGTTCTTTGGATTAGG - Intronic
1047849304 8:128839270-128839292 TACAGAGATTTCTTTGGATTTGG - Intergenic
1053276889 9:36789983-36790005 TCCAGAGCATTCTGGAGACTTGG + Intergenic
1058620731 9:106880080-106880102 TCCAGAGCTTTCCTAGGAATGGG + Intronic
1059350732 9:113662992-113663014 TCCAGATGGTGCTTGGCATTAGG + Intergenic
1062670373 9:137705335-137705357 TCCTGAGTGTTCTTGAGTTTGGG + Intronic
1188856490 X:35202385-35202407 TCCAGAACATTCCTGGAATTTGG - Intergenic
1189034913 X:37485831-37485853 ACCACAGCGTTATTGGGCTTGGG + Intronic
1196745650 X:119069809-119069831 CCCACAGGGTTCTGGGGATTAGG + Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201980292 Y:19899901-19899923 TCCACAGCATTCTTGGGCTTGGG + Intergenic