ID: 915496953

View in Genome Browser
Species Human (GRCh38)
Location 1:156288626-156288648
Sequence TAACAAGAGCAGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1648
Summary {0: 1, 1: 1, 2: 24, 3: 221, 4: 1401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915496953_915496956 -10 Left 915496953 1:156288626-156288648 CCACACCTGGCCTGCTCTTGTTA 0: 1
1: 1
2: 24
3: 221
4: 1401
Right 915496956 1:156288639-156288661 GCTCTTGTTACTTTTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 201
915496953_915496957 -2 Left 915496953 1:156288626-156288648 CCACACCTGGCCTGCTCTTGTTA 0: 1
1: 1
2: 24
3: 221
4: 1401
Right 915496957 1:156288647-156288669 TACTTTTGATACAGGATTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915496953 Original CRISPR TAACAAGAGCAGGCCAGGTG TGG (reversed) Intronic
900158851 1:1213977-1213999 CCACGAGTGCAGGCCAGGTGAGG - Exonic
900188043 1:1342162-1342184 CAACAAGAGCAGGGTGGGTGGGG + Intronic
900230735 1:1555841-1555863 TAAAAAAATCAGGCCAGGTGGGG + Intronic
900352620 1:2243059-2243081 TGAGCAGAGCAGGGCAGGTGGGG - Intronic
900663585 1:3798679-3798701 TGACAAAGCCAGGCCAGGTGTGG + Intergenic
900721770 1:4180782-4180804 TAACAAGTGCACCCCTGGTGGGG - Intergenic
900782390 1:4626601-4626623 AAGGAAGGGCAGGCCAGGTGTGG + Intergenic
901093043 1:6655811-6655833 AAACAAGAACAGGCCGGGTGTGG + Intronic
901250567 1:7775637-7775659 GAACATTATCAGGCCAGGTGCGG - Intronic
901280693 1:8032189-8032211 TAATAAAAACAGGCCAGGCGCGG - Intergenic
901283237 1:8056058-8056080 AAAAAACACCAGGCCAGGTGTGG - Intergenic
901538018 1:9895785-9895807 AAACAAAACAAGGCCAGGTGCGG - Intronic
901609754 1:10488445-10488467 TAAAAATTTCAGGCCAGGTGCGG - Intronic
901665177 1:10822123-10822145 AAACAAAAGTTGGCCAGGTGCGG - Intergenic
901669359 1:10846423-10846445 CAAAAAGAGCAGGCCAGGCGCGG - Intergenic
901732551 1:11290686-11290708 TAAAACCACCAGGCCAGGTGTGG + Intronic
901816819 1:11799030-11799052 TAAAAAAAAAAGGCCAGGTGCGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
901908086 1:12432101-12432123 AGAAAAGAGCAAGCCAGGTGCGG + Intronic
902073747 1:13765753-13765775 GGCCAAGTGCAGGCCAGGTGCGG - Intronic
902210804 1:14903157-14903179 AAATAAGAGGCGGCCAGGTGTGG - Intronic
902396795 1:16136327-16136349 TAATAATAAAAGGCCAGGTGTGG + Intronic
902423660 1:16302250-16302272 TAAGAAGGGCAGGCCGGGTGCGG + Intronic
902458044 1:16550220-16550242 ATACAAGTGCTGGCCAGGTGTGG - Intergenic
902494113 1:16857699-16857721 ATACAAGTGCTGGCCAGGTGTGG + Intronic
902589694 1:17464892-17464914 GAACAGGCACAGGCCAGGTGCGG + Intergenic
902589856 1:17466020-17466042 GAACAGGCACAGGCCAGGTGTGG - Intergenic
903166095 1:21521519-21521541 TAACAAAGCCAGGCCAGCTGTGG - Intronic
903200160 1:21730469-21730491 AAATAAAAACAGGCCAGGTGCGG + Intronic
903477578 1:23630370-23630392 AAAAACCAGCAGGCCAGGTGTGG + Intronic
903517073 1:23918465-23918487 AAACAGAAGCAGGCCGGGTGCGG + Intergenic
903689605 1:25163392-25163414 AAAAAAAAACAGGCCAGGTGCGG + Intergenic
904110108 1:28119378-28119400 TTCCCAGATCAGGCCAGGTGCGG + Intergenic
904125421 1:28235120-28235142 AGAAAAGAGCAGGCCAGGCGCGG - Intergenic
904166969 1:28563257-28563279 TAACAAAGGTAGGCCGGGTGCGG + Intronic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
905542646 1:38772560-38772582 GGACATGAGCAGGTCAGGTGAGG - Intergenic
905652328 1:39664777-39664799 CAAGAAAAGCAGGCCAGGTGCGG - Intronic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
905897563 1:41558571-41558593 CCCCAAGAGCAGGCCAGGAGGGG - Intronic
905909111 1:41641671-41641693 GAACCAGAGCAGGCCCTGTGGGG + Intronic
906046324 1:42833845-42833867 TAAAAGGTTCAGGCCAGGTGTGG - Intronic
906132316 1:43468053-43468075 TGCCAAGGGCAAGCCAGGTGTGG + Intergenic
906342037 1:44988792-44988814 AAACAATAATAGGCCAGGTGCGG + Intergenic
906470772 1:46128788-46128810 CTACAAGAGTAGGCCAGGCGCGG + Intronic
906542244 1:46596090-46596112 TAACAAGAAGGGACCAGGTGGGG - Intronic
906988418 1:50711753-50711775 AAAAAAGAACAGGCCGGGTGTGG - Intronic
907085426 1:51668329-51668351 TAAGAAAAGGGGGCCAGGTGTGG + Intronic
907128315 1:52072340-52072362 TAAAAACAGCTGGCCAGGCGCGG - Intronic
907143732 1:52213358-52213380 AAACAGGATGAGGCCAGGTGCGG + Intronic
907434056 1:54432638-54432660 AAAAAAGAACAGGCCAGGCGCGG + Intergenic
907465149 1:54630218-54630240 TAAAAAAAACAAGCCAGGTGTGG + Intronic
908009834 1:59764723-59764745 TAACATATTCAGGCCAGGTGCGG - Intronic
908171356 1:61508172-61508194 AAAAAAGATAAGGCCAGGTGCGG + Intergenic
908209290 1:61883457-61883479 GAACAAGTATAGGCCAGGTGTGG + Intronic
908245208 1:62222425-62222447 TTACAAAATCTGGCCAGGTGTGG + Intergenic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
908577328 1:65474715-65474737 TAGCAAGAAAAGGCCAGGTGCGG + Intronic
908781714 1:67697078-67697100 TAACAGATGCAGGCCAGGTGCGG + Intergenic
908814831 1:68021002-68021024 TTAAAGGAGAAGGCCAGGTGCGG - Intergenic
908844371 1:68310017-68310039 TACCAAGAGAAGGCCAGGCATGG + Intergenic
909224847 1:73006174-73006196 GAAAAAGAGCAGGCCAGGCGTGG - Intergenic
909456302 1:75853353-75853375 AAAAAAAATCAGGCCAGGTGTGG - Intronic
910873220 1:91853855-91853877 TAACAAAAATTGGCCAGGTGTGG + Intronic
910932358 1:92455071-92455093 TAAAAATTGCAGGCCGGGTGGGG - Intergenic
910969434 1:92840300-92840322 GAAAAAAATCAGGCCAGGTGTGG - Intronic
910971002 1:92855786-92855808 AAAAAAAATCAGGCCAGGTGTGG + Intronic
911463696 1:98223877-98223899 AAACGTGATCAGGCCAGGTGTGG + Intergenic
911588229 1:99715618-99715640 TAACAAAAGCAATGCAGGTGAGG + Exonic
911935924 1:103971686-103971708 TAACAAGAGAATGCCAGGCGCGG - Intergenic
912101319 1:106209657-106209679 TAGGAAGAGCTGGCCAGGAGGGG + Intergenic
912188831 1:107314112-107314134 TAAAAAATGAAGGCCAGGTGTGG + Intronic
912246973 1:107969686-107969708 CAAAAAAAGCAGGCCAGGCGCGG - Intergenic
912449420 1:109760104-109760126 TTACTAGTCCAGGCCAGGTGAGG + Intronic
912764951 1:112400368-112400390 TTACACGAATAGGCCAGGTGCGG + Intronic
912828231 1:112925667-112925689 TAAGAAGAGAAGGCCAGGCACGG - Intronic
913060027 1:115196157-115196179 AAACAAAAGCAGGCCAGGCACGG - Intergenic
913298838 1:117349184-117349206 TAAGAAAAGCTGGCCAGGTGCGG + Intergenic
913717645 1:121553893-121553915 TGAAAAAACCAGGCCAGGTGCGG + Intergenic
913722037 1:121606275-121606297 TACCAAGAACTGGCCTGGTGTGG + Intergenic
913741821 1:121853856-121853878 TACCAAGAACTGGCCTGGTGTGG + Intergenic
913962508 1:143351281-143351303 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
914056863 1:144176858-144176880 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
914091090 1:144499641-144499663 TAAGAAAAACTGGCCAGGTGTGG + Intergenic
914122283 1:144789504-144789526 AAAAAAATGCAGGCCAGGTGTGG - Intergenic
914226540 1:145723866-145723888 AAACAGGTGAAGGCCAGGTGTGG - Intronic
914261175 1:146000438-146000460 TAACAATTGTAAGCCAGGTGTGG + Intergenic
914345041 1:146791787-146791809 AAATAAGAACAGGCCAGGTGTGG - Intergenic
914706635 1:150175519-150175541 TAACATCAGCAGGCCGGGCGCGG - Intergenic
914760032 1:150591244-150591266 AAAAAAAAACAGGCCAGGTGCGG - Intergenic
914887235 1:151595468-151595490 AAACATGAGCAGGCCGGGCGCGG - Intergenic
915198668 1:154209878-154209900 TAAAAAAATTAGGCCAGGTGTGG - Intronic
915380020 1:155431903-155431925 AAATAAAATCAGGCCAGGTGTGG - Intronic
915395313 1:155579015-155579037 ACCCAAGAGGAGGCCAGGTGTGG + Intergenic
915397082 1:155593202-155593224 TAAGAACAGTAGGCCAGGTGCGG - Intergenic
915400403 1:155617692-155617714 AAACAAAAAGAGGCCAGGTGTGG + Intergenic
915485505 1:156217433-156217455 TAACCATGTCAGGCCAGGTGTGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
915659961 1:157395864-157395886 TAACAGGATCAGGCCGGATGTGG + Intergenic
916071916 1:161175419-161175441 TAAGAAGAGAAGGCTAGGTAAGG - Intronic
916222147 1:162455468-162455490 TATCAAGTGAAGGCCAGGTGTGG + Intergenic
916242071 1:162650303-162650325 TAATAATAACAGGCCAGGTGTGG + Intronic
916943533 1:169700943-169700965 AATTAAGAGCAGGCCAGGCGTGG + Intronic
917390833 1:174534484-174534506 TAACTAGAGCAGGCCAGGCAAGG + Intronic
918116904 1:181505662-181505684 AAAAAAGAGAAGGCCAGGTGCGG - Intronic
918161480 1:181904775-181904797 TAACAATCAGAGGCCAGGTGTGG - Intergenic
918333722 1:183486697-183486719 AAAAAAGAAAAGGCCAGGTGTGG - Intronic
918362678 1:183774862-183774884 TAACAAATGTAGGCCAGGCGTGG - Intronic
918411963 1:184268597-184268619 AAACAAAAGAAGGCCAGGCGCGG - Intergenic
918585004 1:186176876-186176898 AGGAAAGAGCAGGCCAGGTGTGG + Intronic
918816596 1:189193585-189193607 TAAAAAGGGAAGGCCAGGCGCGG + Intergenic
919596397 1:199568752-199568774 TAGAAAAAGCAGGCCAGGTGTGG + Intergenic
919635369 1:199998600-199998622 AAAAAAAAGCTGGCCAGGTGCGG + Intergenic
919662189 1:200258232-200258254 TTTCAAGAACAGGCCAGGTACGG + Intergenic
919715422 1:200770702-200770724 TAGAAATAGTAGGCCAGGTGCGG - Intronic
919906812 1:202084177-202084199 TAACAGAATCAGGCCAGGTGTGG + Intergenic
920229037 1:204458278-204458300 TAATCAGAGCTGGACAGGTGAGG - Intronic
920277258 1:204815820-204815842 TAAGAAAATCTGGCCAGGTGCGG + Intergenic
920325630 1:205161062-205161084 TAACATGACCAGGCCAGGTGTGG - Intronic
920330787 1:205206567-205206589 AAAAAAGAACAGGCCAGGTGCGG - Intronic
921091612 1:211848812-211848834 AAGCAGGAGCAGGCAAGGTGGGG - Intergenic
921136006 1:212259724-212259746 GAACATCAGCAGGCCTGGTGTGG + Intergenic
922022944 1:221722471-221722493 TCTGAAGAGCAGGCCTGGTGTGG + Intronic
922165640 1:223113494-223113516 GAGCAAGAATAGGCCAGGTGTGG - Intronic
922289505 1:224198801-224198823 GTCCAAAAGCAGGCCAGGTGTGG + Intergenic
922350347 1:224730056-224730078 AAACAAGAGCAGGGCAGTTATGG + Intronic
922510812 1:226165459-226165481 TAAGAAAAATAGGCCAGGTGCGG - Intronic
922711383 1:227835945-227835967 TAAAAAGTGCTGTCCAGGTGTGG + Intronic
922713668 1:227853330-227853352 TAGACAGAGCAGGCCAGGTGTGG - Intergenic
922917087 1:229267614-229267636 AAATATGTGCAGGCCAGGTGCGG + Intergenic
922953670 1:229580688-229580710 GAATAAAACCAGGCCAGGTGCGG - Intergenic
923576584 1:235164035-235164057 AAACAAAAGGAGGCCGGGTGCGG + Intronic
923625345 1:235609121-235609143 TGAAAAAAGCTGGCCAGGTGCGG - Intronic
923653485 1:235895710-235895732 AAACAGCAACAGGCCAGGTGCGG + Intergenic
923742615 1:236669462-236669484 TAAAAAGACTCGGCCAGGTGTGG - Intergenic
924105893 1:240648870-240648892 ATACAAGGGCAGGCCGGGTGCGG + Intergenic
924117995 1:240766691-240766713 TTATAAAGGCAGGCCAGGTGTGG - Intergenic
924278446 1:242411523-242411545 TTAAAACAACAGGCCAGGTGTGG - Intronic
924355479 1:243170501-243170523 TAGTAAGTACAGGCCAGGTGTGG + Intronic
924475364 1:244378095-244378117 GAACCAGTGCAGGCCTGGTGTGG - Intronic
924743321 1:246810538-246810560 AAAGAAAAGCCGGCCAGGTGCGG - Intergenic
924751890 1:246901344-246901366 AAACAAAAACAGGCCAGGTGCGG + Intronic
1062794446 10:333191-333213 TAAAAAGAATAGGCCGGGTGCGG - Intronic
1062986727 10:1776123-1776145 TGACATGAGCAGGGCAGGAGAGG + Intergenic
1063001707 10:1930803-1930825 TAAAAAAATCAGGCCAGGTGTGG + Intergenic
1063149471 10:3323194-3323216 AAAAAAAAGGAGGCCAGGTGCGG + Intergenic
1063741721 10:8829590-8829612 GAAAAAGAACAGGCCAGGTGTGG - Intergenic
1063901811 10:10741220-10741242 TAAAAAAAACAGGCCGGGTGCGG + Intergenic
1064026776 10:11855181-11855203 AAAGAAGATAAGGCCAGGTGCGG + Intronic
1064073298 10:12248513-12248535 AAAAAAAAACAGGCCAGGTGCGG + Intronic
1064298115 10:14096842-14096864 CAAAAAAAGCAGGCCGGGTGCGG + Intronic
1065029757 10:21573852-21573874 TAAGAAGAATAGGCCAGTTGTGG - Intronic
1065070797 10:22021996-22022018 CAACAATAACAGGTCAGGTGAGG - Intergenic
1065108904 10:22420620-22420642 TAGCAAGAGTGGGCCAGGCGCGG - Intronic
1065287347 10:24198926-24198948 TTACATGAACAAGCCAGGTGTGG + Intronic
1065491207 10:26283610-26283632 TAAGCAGAGCATGGCAGGTGTGG - Intronic
1065513028 10:26498216-26498238 TTACAAAAGCAGGCCAGGCGTGG + Intronic
1065752763 10:28902815-28902837 TACCGCGTGCAGGCCAGGTGAGG + Intergenic
1065773837 10:29101529-29101551 GAAAAAGACAAGGCCAGGTGTGG + Intergenic
1065781102 10:29168541-29168563 TATCTAAATCAGGCCAGGTGTGG + Intergenic
1065886533 10:30082559-30082581 TAAAAAAATTAGGCCAGGTGTGG + Intronic
1066091342 10:32024471-32024493 CAACAATAGGAGGCCAGGTACGG + Intronic
1066118196 10:32258640-32258662 TTACAAGAGGAGGCCAGGCGCGG - Intergenic
1066382594 10:34913850-34913872 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1066591687 10:37001643-37001665 TAATAAGATGAGGCCAGGAGCGG - Intergenic
1067001617 10:42619921-42619943 TATAAAAATCAGGCCAGGTGTGG + Intronic
1067113163 10:43415000-43415022 AAAAAAGAGCTGGCCAGGTGTGG - Intergenic
1067124299 10:43502738-43502760 AAAAAAGGGCAGGCCAGGTGCGG + Intergenic
1067152272 10:43746591-43746613 TTACAAGTGTAGGCCAGGCGCGG + Intergenic
1068986475 10:63112100-63112122 AAAAAAAAACAGGCCAGGTGCGG + Intergenic
1069015225 10:63421797-63421819 ACACAAGAGAAGGCCATGTGAGG + Intronic
1069121943 10:64577748-64577770 TGCCAAGGGCAAGCCAGGTGTGG - Intergenic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069548623 10:69346654-69346676 AAATAAAAACAGGCCAGGTGAGG - Intronic
1069659690 10:70115474-70115496 AAATAAATGCAGGCCAGGTGTGG + Intronic
1069827872 10:71265406-71265428 TAGACAGGGCAGGCCAGGTGGGG - Intronic
1070188748 10:74092195-74092217 TAAAAATAATAGGCCAGGTGTGG - Intronic
1070227336 10:74523451-74523473 AAACAAGAGGAGGCCAAATGAGG - Intronic
1070846248 10:79524495-79524517 TAACAAAAACAGTCCGGGTGCGG + Intergenic
1070907750 10:80088886-80088908 CAACAAAAGTTGGCCAGGTGTGG - Intronic
1070927551 10:80235815-80235837 TAACAAAAACAGTCCGGGTGCGG - Intergenic
1071190940 10:83099872-83099894 AAACAAAAGCTGGCCGGGTGAGG + Intergenic
1072225188 10:93362236-93362258 AAACAAAAACAGGCCAGGTGTGG - Intronic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072550904 10:96476550-96476572 TAAAAATCACAGGCCAGGTGCGG - Intronic
1072586587 10:96788466-96788488 AAATATAAGCAGGCCAGGTGTGG + Intergenic
1072697887 10:97617572-97617594 TAACAACAGCTGACCAGGCGCGG + Intronic
1072968688 10:99997654-99997676 TTAAAAAAGGAGGCCAGGTGCGG + Intronic
1073017901 10:100416408-100416430 TAACAAATAGAGGCCAGGTGTGG - Intergenic
1073168299 10:101477938-101477960 TAGAAAAATCAGGCCAGGTGCGG - Intronic
1073170057 10:101498698-101498720 TAATAATAGCAGGCCAGCCGTGG + Intronic
1073264346 10:102215975-102215997 TAAAGAGAATAGGCCAGGTGCGG - Intergenic
1073322241 10:102622313-102622335 ATACAAGTGCTGGCCAGGTGCGG + Intronic
1073356607 10:102859852-102859874 AAATAAGAGAAGGCCAGGTGCGG - Intronic
1073381491 10:103081110-103081132 AAGCAAGAGCAGGCCAGGGAGGG + Exonic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1074281925 10:112060239-112060261 CAACATGTCCAGGCCAGGTGTGG + Intergenic
1074411067 10:113229106-113229128 AAGAAAGGGCAGGCCAGGTGCGG - Intergenic
1074576265 10:114672490-114672512 TAAAAAGAACTGGCCAGGCGTGG - Intronic
1074593404 10:114837192-114837214 AAACAAAAGAAGGCCAGGTGTGG - Intronic
1075045782 10:119145592-119145614 TAAGAAAATCAGGCCAGGCGCGG - Intronic
1075049617 10:119173317-119173339 TACCTTGAGTAGGCCAGGTGTGG + Intronic
1075292357 10:121241410-121241432 TAACAACTACTGGCCAGGTGCGG - Intergenic
1075305017 10:121360080-121360102 TAGGAAGAACGGGCCAGGTGTGG + Intergenic
1075582135 10:123627770-123627792 CAAAAAAAGCAGGCCAGGTGTGG - Intergenic
1075809548 10:125214997-125215019 AAAGAAAATCAGGCCAGGTGTGG + Intergenic
1076212269 10:128658238-128658260 TAAGAAGCACAGGCCAGGTCAGG + Intergenic
1076303804 10:129449168-129449190 AAAAAAAAGTAGGCCAGGTGTGG + Intergenic
1076829101 10:132985420-132985442 TGACCAGAGCAGGTCAGGCGTGG + Intergenic
1076848495 10:133081699-133081721 TCACAAGGGCAGCCCTGGTGAGG - Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077804147 11:5572965-5572987 TAGAAAGTGCTGGCCAGGTGCGG + Intronic
1077978185 11:7271864-7271886 GACCAAGCACAGGCCAGGTGCGG - Intronic
1078219455 11:9339481-9339503 AATAAACAGCAGGCCAGGTGCGG + Intergenic
1078311176 11:10244843-10244865 TAAAATGGGCAGGCCAGGGGCGG + Intronic
1078351223 11:10595213-10595235 TGAAAAAAACAGGCCAGGTGTGG - Intronic
1078544828 11:12239879-12239901 AAACAGGAGCAGGCCAGGTATGG + Intronic
1078738857 11:14047947-14047969 TAATAAGGGTGGGCCAGGTGTGG + Intronic
1078789936 11:14532312-14532334 TAAAAAAGGGAGGCCAGGTGCGG + Intronic
1078838066 11:15051300-15051322 TACCAAAAACTGGCCAGGTGTGG + Intronic
1079041715 11:17065574-17065596 TAAAAAAATTAGGCCAGGTGCGG - Intergenic
1079504841 11:21142052-21142074 TAAAAAGGAGAGGCCAGGTGTGG - Intronic
1080338072 11:31222351-31222373 AAACTAGAGGAGGCCAGGCGTGG - Intronic
1081144116 11:39540090-39540112 TAATAAGTACAGGCCAGTTGCGG - Intergenic
1081470023 11:43361029-43361051 TAACAATAAGAGGCCAGGGGAGG + Intronic
1081547994 11:44085446-44085468 AAAATAGAGCAGGCCAGGTGAGG - Intergenic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1082077970 11:47989171-47989193 TAACAAGATACGGCCAGGCGCGG - Intronic
1082681235 11:56173373-56173395 TAGCAAAAGAAGGCCAGGAGCGG - Intergenic
1082856489 11:57812227-57812249 AAAAAACATCAGGCCAGGTGTGG + Intronic
1082958396 11:58896143-58896165 AGAAAAGAGGAGGCCAGGTGCGG - Intronic
1083449804 11:62735945-62735967 TAAAATAGGCAGGCCAGGTGGGG + Intronic
1083484720 11:62976202-62976224 GGACAATAGCTGGCCAGGTGTGG - Intronic
1083892450 11:65602822-65602844 TAGCAAGAGCAAGCTGGGTGTGG + Intronic
1083980321 11:66162410-66162432 TAAGAACATCAGGCCAGGCGCGG - Intronic
1084079069 11:66807279-66807301 TCATAAAAGCAGGCCGGGTGTGG + Intronic
1084131590 11:67139992-67140014 ACACAGGAGTAGGCCAGGTGCGG - Intronic
1084134350 11:67164886-67164908 GTACAATAGCAGGCCAGGCGCGG - Intronic
1084297586 11:68222879-68222901 TAAAAATAACAGGCCAGGCGAGG + Intergenic
1084311407 11:68318333-68318355 AAAAAAAAGCAGGCCGGGTGTGG - Intronic
1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG + Intronic
1084381082 11:68813238-68813260 TGACCAAAGCAGGCCAGGTGCGG + Intronic
1084414627 11:69024321-69024343 TAACAGAAACAGGCCAGGCGCGG - Intergenic
1084444680 11:69196759-69196781 TAACAGGCACAGGCCAAGTGAGG + Intergenic
1084481340 11:69422353-69422375 TAAGAAAGGCAGGCCAGGCGTGG - Intergenic
1084491117 11:69478962-69478984 AAACAAGTGTGGGCCAGGTGCGG + Intergenic
1084500560 11:69532701-69532723 TTACAATAGAAGGCCAGGTGTGG + Intergenic
1084528791 11:69714457-69714479 AAACAAGTGCAGGCCAGGCGCGG + Intergenic
1084753468 11:71219931-71219953 AAACAAAAACAGGCCAGGTGTGG + Intronic
1084994421 11:72961544-72961566 AAACAATAGTAGGCCAGGTATGG - Intronic
1085078206 11:73610925-73610947 AAAAAATAGAAGGCCAGGTGAGG - Intergenic
1085094951 11:73752960-73752982 TAAAAAGTCCAAGCCAGGTGAGG + Intronic
1085098794 11:73782853-73782875 TAATAATAATAGGCCAGGTGTGG - Intergenic
1085179779 11:74523921-74523943 TAATAATTCCAGGCCAGGTGAGG + Intronic
1085275335 11:75294931-75294953 CAACACAAACAGGCCAGGTGTGG + Intronic
1085351339 11:75799906-75799928 TAAAAAGTGTAGGCCAGGAGTGG - Intronic
1085416067 11:76319779-76319801 AAACCAGTGCAGGCCAGGCGTGG + Intergenic
1085563965 11:77496304-77496326 TAAAAAATACAGGCCAGGTGTGG - Intergenic
1085604546 11:77885365-77885387 AAATAAGGGTAGGCCAGGTGTGG - Intronic
1085649776 11:78257210-78257232 TAACATGAGCAGGAAAGGGGTGG + Intronic
1085658790 11:78342696-78342718 CAAGAAGTGCAGGCCAGGCGCGG - Intronic
1086357942 11:86025109-86025131 AAAAAATAGCAGGCCGGGTGTGG + Intronic
1086360137 11:86049907-86049929 AAACTACATCAGGCCAGGTGAGG + Intronic
1086394750 11:86403142-86403164 AAATAAATGCAGGCCAGGTGTGG - Intronic
1086399300 11:86447553-86447575 TAGAGAGACCAGGCCAGGTGTGG + Intronic
1086433041 11:86754179-86754201 TAGCAAGAAAGGGCCAGGTGCGG - Intergenic
1086526871 11:87738156-87738178 AAATAAGAGCAGGCCAGGCGTGG + Intergenic
1086990269 11:93295202-93295224 AAACAAAAACAGGCCGGGTGTGG - Intergenic
1087118766 11:94551116-94551138 AAAGAATAGAAGGCCAGGTGCGG + Intronic
1087164230 11:94984563-94984585 TAAAAATAGCAGGCCAGGCATGG + Intronic
1087236458 11:95724123-95724145 AAACAAAAACTGGCCAGGTGCGG + Intergenic
1087296164 11:96376716-96376738 GAAGAAAAGCAGGCCAGGCGCGG - Intronic
1087752290 11:102020100-102020122 GAAGAAGAAGAGGCCAGGTGTGG + Intergenic
1087885736 11:103480152-103480174 TAAAAAATACAGGCCAGGTGTGG - Intergenic
1088131623 11:106498434-106498456 AAACAACAACAGGCCAGGCGTGG - Intergenic
1088488460 11:110364290-110364312 AAACAACCACAGGCCAGGTGTGG + Intergenic
1088602267 11:111491455-111491477 TAAAAAGAGAAGGCCAGGCATGG + Intronic
1089923770 11:122235735-122235757 CAACCAGAGCAAGCCAGGTTGGG + Intergenic
1090017063 11:123095558-123095580 TAACAAGTTTTGGCCAGGTGCGG - Intronic
1091346070 11:134855081-134855103 ACACAAGAGCACGCAAGGTGGGG + Intergenic
1091408846 12:225971-225993 GAACAAAACGAGGCCAGGTGCGG + Intronic
1091631027 12:2161108-2161130 TAACCAGAGCTAGCCGGGTGCGG - Intronic
1091934772 12:4426412-4426434 TAACAAGACCAGGCCGGGCATGG - Intergenic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1092806425 12:12227697-12227719 GAATAAGAAAAGGCCAGGTGTGG - Intronic
1092818095 12:12328544-12328566 TAACTAGCACAGGCCAGGCGCGG - Exonic
1092877725 12:12863340-12863362 CAACCAGATAAGGCCAGGTGTGG + Intergenic
1093728239 12:22540566-22540588 TAATAACAACAGGCCAGGCGCGG + Intronic
1093760678 12:22905892-22905914 TAAAAAAAACAGGCCAGGCGCGG + Intergenic
1094128556 12:27050179-27050201 AAAAATTAGCAGGCCAGGTGTGG - Intronic
1094213695 12:27919027-27919049 TAAAAATAGCCGGCCAGGTGCGG + Intergenic
1094215613 12:27939070-27939092 AAACAAAAGTAGGCCGGGTGTGG + Intergenic
1094558162 12:31523351-31523373 TTGCAAGAATAGGCCAGGTGTGG - Intronic
1094588406 12:31798801-31798823 TAAAAAGAGACGGCCAGGAGCGG + Intergenic
1095272620 12:40237609-40237631 GAACAGGAGTAGGCCAGGTTTGG + Intronic
1095753286 12:45734076-45734098 TAAAAATTGGAGGCCAGGTGCGG + Intronic
1095897999 12:47300168-47300190 GTACAAAATCAGGCCAGGTGTGG + Intergenic
1096061639 12:48705564-48705586 TAAGAAAATCAGGCCAGGTATGG - Intronic
1096267258 12:50133781-50133803 TAAAACAGGCAGGCCAGGTGCGG + Intronic
1096286807 12:50307486-50307508 TAATAATTACAGGCCAGGTGGGG - Intergenic
1096305261 12:50469312-50469334 TAAAAAATGTAGGCCAGGTGCGG + Intronic
1096370626 12:51066162-51066184 ATACAAAAGCTGGCCAGGTGCGG + Intronic
1096384512 12:51186196-51186218 AAACAACAACAGGCCGGGTGTGG - Intergenic
1096435430 12:51586838-51586860 AAACAAAAACAGGCCAGGCGCGG + Intergenic
1096493976 12:52028613-52028635 CAAAAAGACCAGGCCAGGCGCGG + Intronic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096664841 12:53157260-53157282 AAACAAGATGTGGCCAGGTGTGG - Intergenic
1096665972 12:53165368-53165390 TAACAAGCGTTGGCCAGGCGCGG + Intronic
1096768135 12:53911165-53911187 AATAATGAGCAGGCCAGGTGCGG - Intergenic
1096768329 12:53913242-53913264 AAGCAAAAGCAGGCCAGGCGCGG - Intergenic
1097001816 12:55883402-55883424 AAAAAAAAACAGGCCAGGTGTGG + Intergenic
1097028053 12:56072854-56072876 AAAAAAGAGAAGGCCAGGTGCGG - Intergenic
1097047496 12:56198099-56198121 AAACAACAACAGGCCAGGCGCGG - Intergenic
1097060556 12:56280123-56280145 TAAAAAGACAAGGCCAGGCGTGG + Intronic
1097115278 12:56692400-56692422 AAACAGAAACAGGCCAGGTGTGG + Intergenic
1097406234 12:59194050-59194072 AAACAATACCATGCCAGGTGTGG - Intergenic
1097835624 12:64270105-64270127 AAACAAAAATAGGCCAGGTGCGG + Intronic
1097883197 12:64704637-64704659 AAATAAAAACAGGCCAGGTGTGG - Intergenic
1097883255 12:64705130-64705152 TAACAATGGCAGGCCAGGCGCGG + Intergenic
1098355847 12:69611843-69611865 TTGCTGGAGCAGGCCAGGTGTGG + Intergenic
1098584303 12:72138084-72138106 AAACAAAAACAGGCCAGGAGTGG + Intronic
1098758704 12:74396195-74396217 TACCAAAAGTAGGCCAGGCGTGG - Intergenic
1098966982 12:76801174-76801196 AAACAAATGCTGGCCAGGTGCGG - Intronic
1099079769 12:78162571-78162593 TAATTAAAACAGGCCAGGTGTGG + Intronic
1099088063 12:78271587-78271609 TAACAAAAGGCGGCCAGGCGCGG - Intergenic
1099384892 12:82002437-82002459 TATCAACATCAGGCCAGGTGCGG + Intergenic
1099855756 12:88163905-88163927 CATCAAAATCAGGCCAGGTGTGG + Intronic
1099941910 12:89198841-89198863 AAAAAAAAGCCGGCCAGGTGCGG + Intergenic
1100157393 12:91816774-91816796 TAATAAGGACAGGCCTGGTGTGG - Intergenic
1100634950 12:96426593-96426615 TACCTAGAGTAGGCAAGGTGTGG - Intergenic
1100637647 12:96450193-96450215 CAACAACAACAGGCCAGGTGCGG + Intergenic
1100763477 12:97835539-97835561 TAACAAGGGCAGGCCAGGCACGG - Intergenic
1100920218 12:99476100-99476122 TAAAAATTGAAGGCCAGGTGCGG + Intronic
1100968591 12:100041723-100041745 TGACAATAGCAGGCCGGGCGCGG - Intronic
1101150055 12:101876245-101876267 TAACAAAATTAGGCCAGGCGTGG - Intergenic
1101333468 12:103776263-103776285 TGAAAAAAGCAGGCCAGGTGCGG + Exonic
1101385925 12:104257697-104257719 TTAAAAAAGCAGGCCGGGTGCGG - Intronic
1101467326 12:104961309-104961331 AAACCTGAGCAGGCCAGGTGTGG + Intergenic
1101493297 12:105230068-105230090 AAAAACAAGCAGGCCAGGTGCGG - Intronic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1101895282 12:108751855-108751877 TAAAAACAACAGGCCAGGTCTGG - Intergenic
1102020866 12:109681764-109681786 CAACATGACCTGGCCAGGTGTGG + Intergenic
1102041296 12:109802590-109802612 AAATAAAAGAAGGCCAGGTGCGG - Intronic
1102310230 12:111838990-111839012 TATCAAGAATTGGCCAGGTGTGG + Intergenic
1102406436 12:112677898-112677920 ATACAAGGGCAGGCCAGGCGTGG + Intronic
1102462538 12:113108988-113109010 AAACAAAAACTGGCCAGGTGTGG - Intronic
1102699330 12:114825531-114825553 AAACAAAAACAGGCCAGGCGCGG + Intergenic
1102875064 12:116442875-116442897 AAACAAAACAAGGCCAGGTGTGG - Intergenic
1103353570 12:120303011-120303033 TAACAATAGAGGGCCGGGTGCGG - Intronic
1103379388 12:120482002-120482024 TAACAAGAGAAGGCCAAGCGTGG - Intronic
1103394001 12:120593908-120593930 TAACAAGTGCTGGCTGGGTGCGG - Intergenic
1103481283 12:121251528-121251550 TAAAACGAGAAGGCCAGGCGTGG + Intronic
1103491228 12:121322152-121322174 AAAAAAAAACAGGCCAGGTGCGG - Intronic
1103498999 12:121386043-121386065 TATTAAAAGTAGGCCAGGTGCGG - Intronic
1103689641 12:122761119-122761141 TAAAAAAAATAGGCCAGGTGCGG + Intronic
1103699973 12:122844127-122844149 TAAAAATAATAGGCCAGGTGTGG - Intronic
1103750375 12:123154862-123154884 TACCAAGAATAGGCCGGGTGTGG + Exonic
1103836575 12:123825830-123825852 TTAGAAAAACAGGCCAGGTGTGG + Intronic
1103878843 12:124150377-124150399 TTGCAAGAGGAGGCCAGATGGGG + Intronic
1104061605 12:125273294-125273316 TAAGAAAAACAGGCCGGGTGTGG + Intronic
1104119201 12:125782715-125782737 TGTCAACAGCAGGCCAGGCGCGG - Intergenic
1104287835 12:127441373-127441395 TTACAACATCCGGCCAGGTGCGG + Intergenic
1104353606 12:128066279-128066301 TCAGAAAAGAAGGCCAGGTGAGG + Intergenic
1104687359 12:130796201-130796223 TAAAACGACCTGGCCAGGTGTGG + Intronic
1105018440 12:132800668-132800690 AAAAAATAACAGGCCAGGTGCGG + Intronic
1105220181 13:18318571-18318593 TAAGAAGTACTGGCCAGGTGTGG + Intergenic
1105297569 13:19102805-19102827 TAAAGACAGCAGGCCGGGTGTGG + Intergenic
1105985592 13:25563117-25563139 TTTCAAGAGGAGGCCAGGTGCGG + Intronic
1106488135 13:30190715-30190737 AAGCCAGAGCAGGCCAGGGGTGG + Intergenic
1106590680 13:31095921-31095943 TAACAATTTCAGGCCGGGTGCGG - Intergenic
1107279450 13:38716796-38716818 AAGAAAGAGCAGGCCAGGCGCGG - Intronic
1107377884 13:39823897-39823919 GAAAAAGAGTAGGGCAGGTGTGG - Intergenic
1107783079 13:43926051-43926073 AAACAAGATCAGGCCAGGCGCGG + Intergenic
1107859023 13:44643155-44643177 CAAAAAGATGAGGCCAGGTGTGG - Intergenic
1107907057 13:45071037-45071059 TAGCAAGAGCAGGCAAGGTGTGG + Intergenic
1107946451 13:45421086-45421108 TAACAAAAAAAGGCCAGGCGTGG + Intergenic
1108131018 13:47300513-47300535 TAAAAACATCTGGCCAGGTGCGG + Intergenic
1108542294 13:51455644-51455666 TGCCAAGTGCAAGCCAGGTGCGG + Intergenic
1108548808 13:51522711-51522733 TAATAAGTGAAGGCCGGGTGTGG - Intergenic
1108616596 13:52139606-52139628 AACAAAAAGCAGGCCAGGTGTGG + Intronic
1108912394 13:55571993-55572015 TATAAAGAGCAGGCCAGCTAAGG + Intergenic
1109049033 13:57454389-57454411 AAACAAGATCTGGCCAGCTGCGG + Intergenic
1109164537 13:59017439-59017461 TAACAGGTGAAGGCCAGGTAAGG - Intergenic
1109252102 13:60032013-60032035 TAATGACTGCAGGCCAGGTGCGG - Intronic
1109289416 13:60455775-60455797 TTACAAAAACAGGCCAGGTATGG + Intronic
1109425841 13:62165620-62165642 TCACACCAACAGGCCAGGTGTGG + Intergenic
1109426357 13:62169167-62169189 TGCCAAGGGCAAGCCAGGTGTGG - Intergenic
1109713953 13:66196048-66196070 TATGAACATCAGGCCAGGTGTGG - Intergenic
1109758824 13:66799107-66799129 AAAGAGTAGCAGGCCAGGTGTGG - Intronic
1110327435 13:74233171-74233193 AAATAAGATCAGGCCAGGCGCGG - Intergenic
1110352346 13:74523366-74523388 TAACAACAGCAGGAAAGGGGAGG - Intergenic
1110398322 13:75059273-75059295 TCAAAATACCAGGCCAGGTGTGG + Intergenic
1110440051 13:75517564-75517586 TAATAATAACAAGCCAGGTGTGG + Intergenic
1110461614 13:75751448-75751470 AAAAAAGAGCTGGTCAGGTGCGG - Intronic
1111714659 13:91865197-91865219 AGACAAAAACAGGCCAGGTGCGG - Intronic
1111851672 13:93583704-93583726 TAAAAAGAGGGGGCCAGGCGTGG - Intronic
1112315086 13:98353666-98353688 TACAAAAAGCAGGCCGGGTGTGG - Intronic
1112346773 13:98596698-98596720 AAACAAAAACAGGCCAGGTGTGG + Intergenic
1112784501 13:102937389-102937411 TAACATAAGTAGGCCAGGTGTGG - Intergenic
1113044449 13:106140464-106140486 TAACAATAATAGGCCGGGTGCGG - Intergenic
1113535130 13:111060224-111060246 TAGCAAGAACAGGCCAGGTGTGG + Intergenic
1113993421 14:16047090-16047112 TATCAAGAGAAGGCCAGGCAAGG - Intergenic
1114007464 14:18330631-18330653 TAACAAATGCAGGCCGGGTGCGG - Intergenic
1114416591 14:22548948-22548970 TAAGAAAAGCAGGCCGGGTGTGG - Intergenic
1114430411 14:22655972-22655994 GAAAAAGAACAGGCCGGGTGTGG - Intergenic
1114501670 14:23173929-23173951 TAAACAAAGCTGGCCAGGTGGGG - Intronic
1114816655 14:25966755-25966777 AAACAATAGCAGTCCAGTTGAGG + Intergenic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115544068 14:34449097-34449119 CAAAAAATGCAGGCCAGGTGTGG + Intronic
1115544860 14:34456605-34456627 AAACAAGATTAGGCCAGGCGCGG + Intronic
1115559541 14:34570709-34570731 AAAAAAGAGAAGGCCAGGTGCGG - Intronic
1115611078 14:35049180-35049202 TCACAACAGGAGGCCGGGTGCGG - Intronic
1116009580 14:39334856-39334878 TAAAAAGCCTAGGCCAGGTGTGG - Intronic
1116851209 14:49911190-49911212 AAATAAAAGCAGGCCAGGAGCGG + Intergenic
1116947192 14:50846864-50846886 TAAAAAGGGTAGGCCAGGTGCGG + Intergenic
1116982844 14:51189488-51189510 GAAAAAAAACAGGCCAGGTGTGG - Intergenic
1116987264 14:51234582-51234604 TAACAATAACATGCCAGTTGTGG + Intergenic
1117270625 14:54139777-54139799 TAACAAGGGCAGGGCAGGGTAGG + Intergenic
1117289895 14:54322146-54322168 TAAGAAGTTAAGGCCAGGTGTGG - Intergenic
1117302989 14:54446624-54446646 TGCCAAGGGCAGGGCAGGTGGGG + Intergenic
1117436489 14:55719506-55719528 TAACAGGAGCTGGCCAGGGTAGG - Intergenic
1117449051 14:55833131-55833153 TAACAAGAGCAGGCTCAGTCTGG - Intergenic
1117554072 14:56866886-56866908 TAAAAAAATCAGGCCAGGCGCGG - Intergenic
1117777235 14:59195431-59195453 TAACAAGATGAGGCCAGGCGCGG - Intronic
1117820236 14:59641255-59641277 AAAGAAGAACAGGCCAGGTATGG - Intronic
1117923663 14:60753053-60753075 TAACTAGTGCAAGCCAGGTGCGG - Intronic
1118170351 14:63382689-63382711 TTAGAAGGGCAGGCCAGGTGTGG - Intronic
1118237985 14:64028190-64028212 GAACAACAACAGGCCAGGTGTGG - Intronic
1118252996 14:64180792-64180814 TAACAAGAATAAGCCAGGTGTGG - Intronic
1118358228 14:65033565-65033587 TAAAAAAAGCAGGCCAGGTGCGG + Intronic
1118384817 14:65247066-65247088 AAAGAAAAACAGGCCAGGTGTGG + Intergenic
1118586132 14:67355100-67355122 TAAAAAATGCAGGCCAGGTGCGG - Intronic
1118985462 14:70750775-70750797 TAATGATAACAGGCCAGGTGTGG - Intronic
1119038685 14:71252909-71252931 AAAGAAGAACAGGCTAGGTGTGG + Intergenic
1119088832 14:71761269-71761291 TAAAACGTGCAGTCCAGGTGTGG - Intergenic
1119227881 14:72958011-72958033 TGAAAAGATCAGGCCAGGTGTGG + Intronic
1119243099 14:73079130-73079152 TAATAAAATAAGGCCAGGTGCGG + Intronic
1119307098 14:73616256-73616278 TAACATAATGAGGCCAGGTGTGG - Intronic
1119339699 14:73866425-73866447 AAAGAAAAACAGGCCAGGTGGGG - Intronic
1119538348 14:75421458-75421480 AAACAAAAACAAGCCAGGTGTGG - Intergenic
1119644504 14:76338653-76338675 AGAAAATAGCAGGCCAGGTGTGG + Intronic
1119721051 14:76890762-76890784 TTAAAACTGCAGGCCAGGTGTGG + Intergenic
1120639375 14:86991619-86991641 TAAAAAGACCAGGCTGGGTGCGG - Intergenic
1120896654 14:89538807-89538829 TAATAATAAAAGGCCAGGTGCGG - Intronic
1120955725 14:90080161-90080183 AAACAATTGAAGGCCAGGTGTGG + Intronic
1121358811 14:93236255-93236277 AAACAAAACAAGGCCAGGTGCGG - Intergenic
1122241532 14:100371460-100371482 AAAAAAAAGTAGGCCAGGTGTGG + Intronic
1122277826 14:100604264-100604286 TAACACGTGCAGGCGAGGTCTGG + Intergenic
1122537758 14:102478038-102478060 AAACAAAAACAGGCCGGGTGCGG - Intronic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1122774392 14:104110798-104110820 GGCCAGGAGCAGGCCAGGTGGGG - Intronic
1123058748 14:105584819-105584841 TTACAAGCGAGGGCCAGGTGAGG + Intergenic
1123083075 14:105705045-105705067 TTACAAGCGAGGGCCAGGTGAGG + Intergenic
1123144408 14:106115049-106115071 TAATAAAACTAGGCCAGGTGTGG + Intergenic
1123391386 15:19877283-19877305 TAAAAAATGCAGGCCGGGTGCGG - Intergenic
1123415563 15:20092447-20092469 TAAAAATTGCAGACCAGGTGTGG + Intergenic
1123524902 15:21099561-21099583 TAAAAATTGCAGACCAGGTGTGG + Intergenic
1123664971 15:22601171-22601193 AAACAAGATGTGGCCAGGTGTGG + Intergenic
1123902697 15:24892488-24892510 TAGCAAAATCAGGCCGGGTGTGG + Intronic
1124429182 15:29591601-29591623 TAAAAAGAGAAGGCTGGGTGCGG + Intergenic
1124514632 15:30356213-30356235 GACCAAAAGGAGGCCAGGTGTGG + Intergenic
1124728288 15:32174549-32174571 GACCAAAAGGAGGCCAGGTGTGG - Intergenic
1124829550 15:33134709-33134731 TAAAAATGGAAGGCCAGGTGCGG + Intronic
1124832970 15:33167179-33167201 TGTCATGGGCAGGCCAGGTGGGG + Intronic
1124842006 15:33250919-33250941 AATCAGGATCAGGCCAGGTGTGG - Intergenic
1124928552 15:34096695-34096717 TAAAAATGGCAGGCCAGGCGTGG + Intronic
1124990173 15:34665296-34665318 TAACACTTGCAAGCCAGGTGCGG - Intergenic
1125017384 15:34949664-34949686 AAACAAAATGAGGCCAGGTGTGG + Intronic
1125795075 15:42398055-42398077 AAAAAATAGAAGGCCAGGTGTGG - Intronic
1125823862 15:42658820-42658842 AAAGAAAAGCAGGCCAGGTGTGG + Intronic
1125862205 15:43009439-43009461 TGCCAAGGGCAAGCCAGGTGTGG - Intronic
1126059178 15:44762254-44762276 TAGCCAGAGATGGCCAGGTGCGG - Intronic
1126116010 15:45208216-45208238 AAGAAAGAGCAGGCCAGGTGAGG - Intergenic
1126546587 15:49880820-49880842 AAAAAAAAGCCGGCCAGGTGTGG + Intronic
1126615705 15:50577257-50577279 TAGAAAAATCAGGCCAGGTGCGG + Intronic
1126647563 15:50890234-50890256 AAAGAAGAGCAGTCCAGGCGCGG + Intergenic
1126763876 15:51994248-51994270 AACCAAGAGCTGGCCAGGCGCGG - Intronic
1127368277 15:58311274-58311296 AAAAAAGGGAAGGCCAGGTGCGG + Intronic
1127561780 15:60145794-60145816 GAACAAAATCAGGCCAGGTGCGG - Intergenic
1127711970 15:61607918-61607940 AAACAAGAGCAGGCCGGATTTGG + Intergenic
1127784270 15:62342305-62342327 TAAGAAAAGCAGGCCGGGCGCGG + Intergenic
1128030689 15:64477428-64477450 TAAGTAAAGCAGGCCAGGCGTGG - Intronic
1128101663 15:65005896-65005918 TTACAAGAACAGGCCAGGCGCGG - Intronic
1128485272 15:68079767-68079789 TAAAAAGTTTAGGCCAGGTGTGG - Intronic
1128726641 15:69992748-69992770 TCACTAGAGAAGGCCAGGGGAGG - Intergenic
1128997642 15:72308515-72308537 CAACAAAAACCGGCCAGGTGCGG - Intronic
1129084249 15:73071804-73071826 AAACAAAAGTGGGCCAGGTGTGG - Intronic
1129218814 15:74118945-74118967 TAATAAAAGCAGGCCAGGTGCGG - Intronic
1129349540 15:74947139-74947161 AAACAAAAACAAGCCAGGTGTGG - Intergenic
1129354634 15:74981647-74981669 AAACAAAAACAGGCCGGGTGCGG + Intronic
1129500005 15:76026830-76026852 TAAAAACAAGAGGCCAGGTGTGG + Intronic
1129535809 15:76312804-76312826 TAACAAGAGAAGGCCATTTCAGG - Intergenic
1129783481 15:78291076-78291098 GAAAAAGAAGAGGCCAGGTGTGG - Intronic
1129836560 15:78711305-78711327 AAACAATTGCAGGCCAGGTGCGG - Intronic
1130308308 15:82730355-82730377 TAAAAACAGCTGGCCGGGTGCGG + Intergenic
1130341647 15:83004036-83004058 TAAGAAGTCCAGGCCGGGTGTGG - Intronic
1130359812 15:83172545-83172567 TAAGAAAATCAGCCCAGGTGTGG + Intronic
1130523271 15:84681337-84681359 AAACAAGAGACGGCCAGGCGCGG + Intronic
1130638404 15:85647106-85647128 TTACAAGAATAGGCCGGGTGTGG + Intronic
1131119933 15:89815643-89815665 TGAGAGGCGCAGGCCAGGTGTGG - Intergenic
1131238849 15:90720872-90720894 TGAAAAAAGCAGGCCAGGTGCGG - Intronic
1131540930 15:93274735-93274757 TAACAAGGAGAGGCCGGGTGTGG + Intergenic
1131573591 15:93564221-93564243 TAAAAATAACAAGCCAGGTGTGG - Intergenic
1132015234 15:98309464-98309486 AAAGAAGAGGAGGCCGGGTGAGG - Intergenic
1132103379 15:99044457-99044479 TGACAAAATTAGGCCAGGTGCGG + Intergenic
1132323940 15:100950811-100950833 AAAAAAGAGCAGGCCGGGCGCGG + Intronic
1132487094 16:199479-199501 GATCAAGACCAGGCCAGGCGCGG + Intronic
1132601871 16:776410-776432 GGCCAAAAGCAGGCCAGGTGTGG + Intronic
1132772198 16:1569938-1569960 TAAATAAAGCAGGCCAGATGCGG - Intronic
1132817946 16:1843406-1843428 AAACAAGAGTAGGCCGGATGTGG + Intronic
1132869576 16:2109830-2109852 GACCAAGTGCAGGCCGGGTGTGG + Exonic
1133067201 16:3216920-3216942 AAACAAATGCTGGCCAGGTGCGG - Intergenic
1133285516 16:4688842-4688864 CACCAAGTGGAGGCCAGGTGGGG - Exonic
1133436172 16:5781913-5781935 GAACAGGAACAGGCCAGGCGTGG + Intergenic
1133544396 16:6791195-6791217 AGACAAGAACAGGCCGGGTGTGG - Intronic
1133927293 16:10203523-10203545 ATACAAAAGCAAGCCAGGTGTGG + Intergenic
1133935288 16:10264441-10264463 TAAAAGGAGGAGGCCGGGTGCGG + Intergenic
1133975866 16:10599513-10599535 TCCCAAGGGCAGGCAAGGTGGGG + Intergenic
1134175332 16:12001401-12001423 TAATAACAGCAGGCTAGGCGCGG - Intronic
1134361649 16:13536285-13536307 AAACAAACGCAGGCCAGGTACGG - Intergenic
1134413742 16:14025470-14025492 TAACAAGATCTTACCAGGTGTGG - Intergenic
1134456477 16:14399064-14399086 TTACAAAATCAGGCCGGGTGCGG - Intergenic
1134595882 16:15495654-15495676 TAATAAAAGTAGGCCAGGCGCGG - Intronic
1134682974 16:16139319-16139341 AATCAGAAGCAGGCCAGGTGCGG + Intronic
1134717841 16:16365769-16365791 GACCAAGTGCAGGCCGGGTGTGG - Intergenic
1134816884 16:17213193-17213215 GAACAAGAGCAAGACAGGGGAGG - Intronic
1134867412 16:17620605-17620627 AAACAAAAGCTGGCCAGGCGTGG - Intergenic
1134904044 16:17964062-17964084 AAACAAATGCTGGCCAGGTGAGG - Intergenic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1134956909 16:18386390-18386412 GACCAAGTGCAGGCCGGGTGTGG + Intergenic
1135018356 16:18943131-18943153 AAATAAAAGAAGGCCAGGTGTGG - Intergenic
1135019000 16:18947948-18947970 ACACAAAAACAGGCCAGGTGGGG - Intergenic
1135025322 16:18995108-18995130 TAATAAGAGCTGGGCAGGTGGGG + Intronic
1135031684 16:19043860-19043882 AAACAAAAGCAGGCCGGGCGCGG - Intronic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135110010 16:19683211-19683233 TAAGAAGGGAAGGCCAGGTGTGG - Intronic
1135112322 16:19699805-19699827 AAAGCAGAGCTGGCCAGGTGTGG + Intronic
1135250108 16:20893974-20893996 ATAAAGGAGCAGGCCAGGTGTGG + Intronic
1135606629 16:23831503-23831525 AAACAAGAAAAGGCTAGGTGTGG - Intergenic
1135815467 16:25628489-25628511 TAAAAAGACCAGGCCAGGCATGG - Intergenic
1136243322 16:28958157-28958179 TAAGAAGATGTGGCCAGGTGCGG + Intronic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136407793 16:30058770-30058792 GAAGCAGAGCAGGCCAGGCGTGG - Intronic
1136461163 16:30411026-30411048 AAACAAAAACAGGCCAGGCGTGG + Intronic
1136479286 16:30531854-30531876 AAAAAAGAAAAGGCCAGGTGAGG + Intronic
1136532584 16:30879563-30879585 TAAAACAATCAGGCCAGGTGTGG + Intronic
1136926297 16:34377766-34377788 CAAGCAGATCAGGCCAGGTGTGG - Intergenic
1136978277 16:35034041-35034063 CAAGCAGATCAGGCCAGGTGTGG + Intergenic
1137285162 16:47009738-47009760 AAATAAAAGTAGGCCAGGTGTGG - Intergenic
1137549553 16:49427921-49427943 CACCAAAAGCAGGCTAGGTGGGG - Intergenic
1137577782 16:49614973-49614995 AAACAAAAACTGGCCAGGTGTGG + Intronic
1137612176 16:49825918-49825940 TGAAAAGGGCTGGCCAGGTGTGG + Intronic
1137647367 16:50087834-50087856 TTAAAAGATCAGGCCAGGCGCGG + Intronic
1138079846 16:54080094-54080116 TAAGAAGAGTAGGCCAGGCATGG + Intronic
1138281346 16:55774207-55774229 TGACAAGAGCAGTGAAGGTGAGG + Intergenic
1138375728 16:56562859-56562881 TATCAAAACCAGGCCAGATGTGG - Intergenic
1138575905 16:57907206-57907228 TAAGCAGAGCAGGGCAGGGGTGG - Intronic
1138892963 16:61167557-61167579 AAATAACTGCAGGCCAGGTGCGG + Intergenic
1138969977 16:62132363-62132385 TAACAATTCCAGGCCGGGTGCGG - Intergenic
1139235769 16:65337329-65337351 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1139469924 16:67172801-67172823 TAGCAAGACCAGGACAGGCGCGG + Intronic
1139532764 16:67551084-67551106 AAGCAATTGCAGGCCAGGTGCGG - Intergenic
1139740279 16:69029815-69029837 TAAGAAGAACAGGCCGGGTGTGG + Intronic
1139762010 16:69191929-69191951 AAACAAAACAAGGCCAGGTGCGG - Intronic
1139806732 16:69572050-69572072 ACCCAAGCGCAGGCCAGGTGCGG - Intronic
1139929679 16:70515957-70515979 AAACCACAGCTGGCCAGGTGTGG - Intronic
1139938493 16:70588193-70588215 TAACAAGTAGAGGCCGGGTGCGG + Intronic
1139988953 16:70923510-70923532 AAATAAGAACAGGCCAGGTGTGG + Intronic
1140210425 16:72965167-72965189 AAAGAAAAACAGGCCAGGTGCGG - Intronic
1140226249 16:73079627-73079649 TAAAGATAGGAGGCCAGGTGTGG - Intergenic
1140334306 16:74090213-74090235 TTACTACTGCAGGCCAGGTGTGG + Intergenic
1140441950 16:74994777-74994799 TAAAAAAACAAGGCCAGGTGTGG + Intronic
1140853062 16:78952672-78952694 ACACAAAAACAGGCCAGGTGTGG - Intronic
1141091008 16:81130350-81130372 TAAGAAAACCAGGCCAAGTGTGG - Intergenic
1141154727 16:81589385-81589407 AAGCAAGACAAGGCCAGGTGTGG - Intronic
1141305792 16:82862710-82862732 TAACAAGAGCAGGCTAGGCTAGG + Intronic
1141603732 16:85141501-85141523 TAGCCAGACAAGGCCAGGTGCGG - Intergenic
1141690534 16:85593979-85594001 AAAGAAGCGCAGGCCAGGCGCGG - Intergenic
1141711228 16:85700270-85700292 AAACAAAACAAGGCCAGGTGCGG + Intronic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1141924458 16:87158716-87158738 GAACAAGAGCTGGCCGGGTGTGG + Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142543151 17:677827-677849 AAAAAAAACCAGGCCAGGTGTGG + Intronic
1142702321 17:1670775-1670797 TGATGAGAGCAGGCCAGGCGCGG - Intronic
1142722357 17:1785130-1785152 AACCAATAGAAGGCCAGGTGCGG + Intronic
1142748582 17:1973746-1973768 TAAAAAGAGCTGGCCGGGTGTGG + Intronic
1142829715 17:2539578-2539600 AAACAACAACAGACCAGGTGCGG - Intergenic
1142861429 17:2764430-2764452 TAAAAATAGAAGGCCAGGCGCGG + Intergenic
1142873025 17:2833425-2833447 TACCAAGAACAGGCCAGGCGCGG - Intronic
1142923220 17:3209330-3209352 TAAATATTGCAGGCCAGGTGTGG + Intergenic
1142950417 17:3473784-3473806 AAACAAAAGGATGCCAGGTGTGG - Intronic
1142990671 17:3728661-3728683 CAAAAAGAGAAGGCCAGGTGCGG - Intronic
1143069569 17:4279617-4279639 TAAGAACCTCAGGCCAGGTGCGG + Intronic
1143075920 17:4343299-4343321 TAACAAGTCCAGGCCAGGCGCGG + Intronic
1143103619 17:4517365-4517387 TTAATAGAGCAGGCCAGGCGCGG + Intronic
1143210171 17:5180358-5180380 TAATGAGTGTAGGCCAGGTGCGG - Exonic
1143222510 17:5274492-5274514 GAATAAGAACAGGCCAGGCGCGG + Intergenic
1143263563 17:5618877-5618899 TCACAAAAGCAAGCCAGGGGAGG + Intronic
1143281993 17:5761682-5761704 TAATAAGAAAAGGCCTGGTGCGG + Intergenic
1143501001 17:7338835-7338857 TAAAAAATTCAGGCCAGGTGTGG - Intronic
1143799872 17:9369922-9369944 GAAAAAAAGCAAGCCAGGTGCGG + Intronic
1144090147 17:11849124-11849146 TACAAAGAGGTGGCCAGGTGCGG - Intronic
1144518298 17:15936172-15936194 GTACAATAACAGGCCAGGTGTGG - Intergenic
1144700948 17:17339015-17339037 TACCAATGACAGGCCAGGTGCGG - Intronic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1144771991 17:17764878-17764900 AAAGAAGAGGAGGCCAGGCGCGG - Intronic
1144965440 17:19074612-19074634 TAAAATGAATAGGCCAGGTGCGG - Intergenic
1144982527 17:19177571-19177593 TAAAATGAATAGGCCAGGTGCGG + Intergenic
1144985696 17:19200668-19200690 TAAAATGAATAGGCCAGGTGCGG - Intergenic
1145025941 17:19467824-19467846 AAAAAAAAGTAGGCCAGGTGCGG - Intergenic
1145057824 17:19714810-19714832 AAACAAGAGCTTGTCAGGTGAGG + Intronic
1145106841 17:20124888-20124910 TAAAAATTGCAGGCCAGGCGCGG + Intronic
1145718589 17:27047130-27047152 TTTAAAGAGCTGGCCAGGTGCGG + Intergenic
1145867879 17:28252384-28252406 TAGAAAGTGCAGGCCAGGTGTGG - Intergenic
1146069723 17:29668956-29668978 TGAGTAGAGCAGGCCGGGTGTGG + Intronic
1146114481 17:30122692-30122714 AAATAAAACCAGGCCAGGTGTGG - Intronic
1146186183 17:30725839-30725861 TAATAATAGCAGGCCAGGTGTGG + Intergenic
1146272322 17:31492479-31492501 TAACATGTGCTGGCCAGGAGAGG - Intronic
1146357566 17:32147031-32147053 AAAAAAGAGCAGGCCAGGCATGG - Intronic
1146367449 17:32240001-32240023 AATCAAGTGCAGGCCAGGCGCGG + Intronic
1146378722 17:32312806-32312828 CAAAAACAACAGGCCAGGTGTGG - Intronic
1146444993 17:32926677-32926699 TGACAAGAACAGGCCGGGTGCGG + Intergenic
1146857932 17:36270594-36270616 TTGGAAGATCAGGCCAGGTGCGG + Intronic
1147076726 17:37995130-37995152 TTGGAAGATCAGGCCAGGTGCGG + Intronic
1147077077 17:37997929-37997951 TTGGAAGATCAGGCCAGGTGCGG - Intronic
1147088252 17:38074676-38074698 TTGGAAGATCAGGCCAGGTGCGG + Intergenic
1147108958 17:38245841-38245863 TTGGAAGATCAGGCCAGGTGCGG - Intergenic
1147113564 17:38281601-38281623 AAAAAAAAACAGGCCAGGTGTGG + Intergenic
1147261425 17:39211574-39211596 ACCCAAGAGCTGGCCAGGTGTGG - Exonic
1147472881 17:40680263-40680285 AAAAAAAATCAGGCCAGGTGTGG - Intergenic
1147589495 17:41672706-41672728 TTTAAAGAGCTGGCCAGGTGAGG - Intergenic
1147615948 17:41827775-41827797 TTACAAAAGCAGGCCAAGTCTGG - Intronic
1147633381 17:41947176-41947198 TAATAAGCGCAGGCCAGGCCGGG + Intronic
1147633425 17:41947504-41947526 AAATAAGCACAGGCCAGGTGTGG + Intronic
1147661357 17:42118742-42118764 GAACAAGAGATGGCAAGGTGGGG - Intronic
1147747991 17:42707547-42707569 TAAAAAAATTAGGCCAGGTGTGG - Intronic
1147901339 17:43787255-43787277 TTAAAAAATCAGGCCAGGTGTGG - Exonic
1147918642 17:43902993-43903015 AATTAAGAACAGGCCAGGTGTGG + Intronic
1147924238 17:43936847-43936869 TAGAAAGTGCAGGCCAGGTGTGG + Intergenic
1148056561 17:44800983-44801005 TTTTAAGAGCAGGCCAGGCGCGG + Exonic
1148119732 17:45201407-45201429 TACCAGGACCAGGCCGGGTGTGG - Intergenic
1148146181 17:45366478-45366500 CACCCAGAGCAGGCCAGGGGTGG - Intergenic
1148256186 17:46134547-46134569 AAAGACGAGGAGGCCAGGTGTGG + Intronic
1148416051 17:47507583-47507605 AAAAAAAAACAGGCCAGGTGTGG - Intergenic
1148420494 17:47542254-47542276 TTGGAAGATCAGGCCAGGTGCGG + Intronic
1148672848 17:49425011-49425033 CAGCAAGAGCAGGCCAGGCATGG - Intronic
1148801070 17:50226252-50226274 TAACAAGAGTTGGCCAGGTGTGG + Intergenic
1148831642 17:50436417-50436439 TAACAACAACAGGCCGGGCGTGG - Intronic
1148878843 17:50709490-50709512 AAACAAAAACAGGCCAGGCGCGG - Intergenic
1149151510 17:53570235-53570257 TAAACAGAGGAGGCCGGGTGCGG + Intergenic
1149256742 17:54836170-54836192 TGCCAAGGGCAAGCCAGGTGTGG + Intergenic
1149546928 17:57510716-57510738 AACCAAGAGGAGGCCGGGTGTGG - Intronic
1149731484 17:58951066-58951088 AAAAAAGAACCGGCCAGGTGTGG - Intronic
1149766514 17:59283316-59283338 AAACAAATGCAGGCCAGGTGCGG - Intergenic
1149882922 17:60310743-60310765 TAAATCAAGCAGGCCAGGTGTGG + Intronic
1149942084 17:60881262-60881284 TGAAAAGACCAGGCCAGGTGCGG - Intronic
1150281743 17:63932894-63932916 GAGCAAGAGCAGGTCAAGTGTGG + Intergenic
1150286565 17:63957711-63957733 AAACAAGTCCAGGCCAGGCGCGG + Intronic
1150334377 17:64319967-64319989 AAACATGAGCAGGACAGGTGAGG - Exonic
1150551451 17:66214347-66214369 AAACCAGATGAGGCCAGGTGCGG - Intronic
1150733263 17:67714150-67714172 CAAAAAAAACAGGCCAGGTGCGG + Intergenic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151330829 17:73406538-73406560 AAACAAGTACAGGCCAGGCGCGG - Intronic
1151709826 17:75797523-75797545 CAACAAGTATAGGCCAGGTGTGG - Intronic
1151727406 17:75892876-75892898 CAACAAGAGAAGGCCAGGATTGG + Intronic
1151883262 17:76907339-76907361 TTACAAAAGCAGGCTGGGTGCGG - Intronic
1152129835 17:78469457-78469479 TAAGAAACACAGGCCAGGTGCGG + Intronic
1152513794 17:80809128-80809150 TAACAACAGCGTGCCAGTTGTGG + Intronic
1152587317 17:81194834-81194856 TCCCATGAGCCGGCCAGGTGTGG - Intronic
1152692869 17:81728428-81728450 CAGCTAGAGCTGGCCAGGTGCGG - Intergenic
1152826724 17:82470870-82470892 TAAAAAAATCAGGCCGGGTGTGG + Intronic
1152914707 17:83027821-83027843 TAAGATAAACAGGCCAGGTGTGG + Intronic
1153102236 18:1486793-1486815 TAGGAAGAGCAGCTCAGGTGTGG + Intergenic
1153126887 18:1803856-1803878 TATAAACTGCAGGCCAGGTGTGG - Intergenic
1153234078 18:2969023-2969045 TAAAAAGAGTAGACCTGGTGGGG + Intronic
1153307548 18:3646103-3646125 TTAAAAAAGGAGGCCAGGTGTGG + Intronic
1153473270 18:5469524-5469546 TGTCAAGGGCAAGCCAGGTGTGG - Intronic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153655060 18:7274824-7274846 GAAAAAATGCAGGCCAGGTGTGG - Intergenic
1153725489 18:7950247-7950269 TAAAAAAAGCTAGCCAGGTGTGG + Intronic
1153761043 18:8332703-8332725 CAACCAGAGAGGGCCAGGTGAGG + Intronic
1153841537 18:9012273-9012295 AAACCAGAACAGGCCAGGTGCGG - Intergenic
1153956201 18:10098463-10098485 TAAAGAGAGTAGGCCAGATGTGG - Intergenic
1154439487 18:14374930-14374952 CAAAAAGAGCAGGCCGGGCGCGG - Intergenic
1154935425 18:21051155-21051177 AAGAAAGAACAGGCCAGGTGTGG + Intronic
1154970813 18:21407162-21407184 TGTTAAGAGAAGGCCAGGTGCGG - Intronic
1154973198 18:21430884-21430906 TAAAAAAAAGAGGCCAGGTGCGG - Intronic
1155060280 18:22222515-22222537 TAATAGTAACAGGCCAGGTGTGG + Intergenic
1155194707 18:23462429-23462451 AAACAAGAACAGGCCAGGCGCGG - Intronic
1155289639 18:24327697-24327719 TAAAAAAATCAGGCCAGGAGTGG - Intronic
1156537844 18:37880907-37880929 TAGGAGGAGCAGGCCGGGTGCGG - Intergenic
1157226470 18:45869723-45869745 TGACAAGAGCAGCACAGATGGGG + Intronic
1157775502 18:50392657-50392679 AAACAAGAATAGGTCAGGTGTGG - Exonic
1157895273 18:51460563-51460585 TTAAAATAACAGGCCAGGTGTGG - Intergenic
1158005860 18:52671368-52671390 TAAAAAGAGCCAGCAAGGTGAGG - Intronic
1158516424 18:58134289-58134311 TAAGAATATTAGGCCAGGTGCGG - Intronic
1159038664 18:63302031-63302053 AAAAGAGAGGAGGCCAGGTGTGG + Intronic
1159266773 18:66090460-66090482 AAACAAAATAAGGCCAGGTGTGG - Intergenic
1159594025 18:70365371-70365393 GAACAAAAACAGGCCAGATGGGG - Intergenic
1159880318 18:73852838-73852860 AAAAAAGAGCCGGCCAGGCGCGG - Intergenic
1160108944 18:76006811-76006833 TCACCTGGGCAGGCCAGGTGCGG + Intergenic
1160125842 18:76170588-76170610 CAACAAGATAAGGCCAGGTATGG + Intergenic
1160593569 18:79958949-79958971 AAAACAGAGCGGGCCAGGTGCGG + Intergenic
1160951901 19:1671865-1671887 GAAGAAGAGCAGGCCGGGTACGG - Intergenic
1160962159 19:1727094-1727116 TAATAATAATAGGCCAGGTGTGG + Intergenic
1160967077 19:1751412-1751434 CAAGAAGCGCAGACCAGGTGGGG - Intergenic
1160996853 19:1886043-1886065 TAAAAAAAAGAGGCCAGGTGCGG - Intergenic
1161133707 19:2607225-2607247 AAAAAAAAGAAGGCCAGGTGTGG + Intronic
1161207481 19:3048803-3048825 AAACAAAAGCAGGCCGGGCGCGG - Intergenic
1161379344 19:3956455-3956477 TACACATAGCAGGCCAGGTGCGG + Intergenic
1161387487 19:4003880-4003902 AAACAAAACCTGGCCAGGTGTGG + Intergenic
1161433802 19:4249995-4250017 TAGAAGGAGAAGGCCAGGTGCGG - Intronic
1161440089 19:4286180-4286202 AAGAAAGAGCGGGCCAGGTGCGG - Intronic
1161636577 19:5393045-5393067 GAGCAAGAGGAGGCCAGGTCAGG - Intergenic
1161678596 19:5667434-5667456 TCACAAGAGGTGGCAAGGTGAGG + Exonic
1161742154 19:6028050-6028072 AAACAAAAGCAGGCAGGGTGTGG - Intronic
1161836466 19:6650653-6650675 AAACAAAAATAGGCCAGGTGTGG - Intergenic
1162096179 19:8311247-8311269 AAATAAAATCAGGCCAGGTGTGG + Intronic
1162153577 19:8662047-8662069 TAAAAAAAACTGGCCAGGTGTGG + Intergenic
1162177630 19:8843036-8843058 TCTGAAGAGCAGGCAAGGTGGGG - Exonic
1162285414 19:9735234-9735256 AAACAGGCGCTGGCCAGGTGCGG - Intergenic
1162338640 19:10077906-10077928 TAATAAGGACAGGCCAGGTGTGG - Intergenic
1162399785 19:10438399-10438421 TAAAAAGTCCTGGCCAGGTGTGG - Intronic
1162539749 19:11287619-11287641 AAAAAAAAGGAGGCCAGGTGTGG - Intergenic
1162690344 19:12424830-12424852 AAAGAAAAACAGGCCAGGTGCGG + Intronic
1162759391 19:12879811-12879833 TACAAAAAGTAGGCCAGGTGTGG + Intronic
1162929527 19:13950458-13950480 ATACATGACCAGGCCAGGTGCGG - Intronic
1162972649 19:14190213-14190235 TAATAATAGCAGGCCAGGTGTGG - Intronic
1163011811 19:14431364-14431386 AAAAAAGAGGGGGCCAGGTGTGG - Intergenic
1163064712 19:14784636-14784658 TAACTATATGAGGCCAGGTGCGG - Intergenic
1163084598 19:14970359-14970381 TAAGAAAATCAGGCCAGGTGAGG - Intronic
1163119901 19:15211181-15211203 GAAAGAGAGCAGGCCAGGCGTGG - Intergenic
1163247196 19:16103941-16103963 AGACTAGAGGAGGCCAGGTGCGG + Intergenic
1163253147 19:16138744-16138766 TAGCAAGGGCAGGCTGGGTGCGG - Intronic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163600692 19:18247584-18247606 TACCCAGAGCTGGCCAGGCGCGG - Intronic
1163624182 19:18379186-18379208 TATAAAGATTAGGCCAGGTGTGG + Intronic
1163671323 19:18630514-18630536 AAACAAAATCAGGCCAGTTGCGG - Intergenic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1163707986 19:18827666-18827688 GAAAAATAGGAGGCCAGGTGCGG - Intergenic
1163724463 19:18914629-18914651 TAAAAAAGACAGGCCAGGTGTGG + Intronic
1163763509 19:19149787-19149809 GAAAATGAGCAGGCCAGGTGCGG + Intronic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1163962273 19:20707950-20707972 TCACATGAGCTAGCCAGGTGCGG - Intronic
1164080028 19:21854242-21854264 TAAAAAAAGGAGACCAGGTGCGG - Intergenic
1164177609 19:22789962-22789984 CAACAGAAGCAGGCCGGGTGCGG - Intergenic
1164230089 19:23279598-23279620 GAAAAAAAGTAGGCCAGGTGTGG - Intergenic
1164467436 19:28499798-28499820 GAAAAAAATCAGGCCAGGTGTGG - Intergenic
1164991005 19:32683908-32683930 AAAAAAGAAGAGGCCAGGTGTGG - Intergenic
1165005261 19:32800022-32800044 TAAAAGGAAAAGGCCAGGTGTGG - Intronic
1165342258 19:35221398-35221420 ATACAAGAGTTGGCCAGGTGTGG - Intergenic
1165360526 19:35333838-35333860 TCAGAAGATCAGGCCGGGTGCGG - Intronic
1165493285 19:36137864-36137886 GTACAAAAACAGGCCAGGTGTGG - Intergenic
1165567062 19:36739698-36739720 GAACATGATAAGGCCAGGTGTGG + Intronic
1165637870 19:37358423-37358445 AAACAAAAACCGGCCAGGTGTGG - Intronic
1165643974 19:37417537-37417559 TAACAGGAATTGGCCAGGTGTGG - Intronic
1165690577 19:37859961-37859983 ATCCAAAAGCAGGCCAGGTGTGG + Intergenic
1166134512 19:40767635-40767657 TAAATACAGTAGGCCAGGTGCGG + Intergenic
1166200182 19:41232329-41232351 AACCAAAACCAGGCCAGGTGTGG + Intronic
1166286498 19:41833204-41833226 TAACAACAGCTGGCCCGGGGTGG - Intergenic
1166349282 19:42187469-42187491 AAAAAAAAACAGGCCAGGTGAGG + Intronic
1166411228 19:42556518-42556540 AAAGAAGAAAAGGCCAGGTGCGG - Intronic
1166520523 19:43477228-43477250 TAACAGTGACAGGCCAGGTGCGG + Intronic
1166528702 19:43529442-43529464 TAAAAAAAAAAGGCCAGGTGCGG + Intronic
1166533910 19:43559923-43559945 TAACAAAAGCTAGCCAGGAGTGG + Intronic
1166812977 19:45525271-45525293 TTACCTGAGAAGGCCAGGTGCGG + Intronic
1166834961 19:45661731-45661753 TAACCAGAAAAGGCCTGGTGCGG - Intergenic
1166889156 19:45979778-45979800 TTAAAATTGCAGGCCAGGTGTGG - Intergenic
1167100145 19:47399526-47399548 AAACAATATCAGGCCAGGTGCGG + Intergenic
1167139695 19:47641208-47641230 TAAAAAAAACTGGCCAGGTGCGG - Intronic
1167155418 19:47735610-47735632 AAAAAAAAGCAGGCCAGGCGCGG + Intronic
1167176277 19:47866609-47866631 GAAAAAAATCAGGCCAGGTGCGG - Intergenic
1167378256 19:49123730-49123752 TAAGAACATGAGGCCAGGTGCGG - Intronic
1167832036 19:52031705-52031727 TAGCAAGAGGAGGCCAGGCGTGG + Exonic
1167832374 19:52035821-52035843 TAAAAACACCTGGCCAGGTGTGG - Intronic
1167897759 19:52594801-52594823 AAACCAGAACGGGCCAGGTGCGG - Intronic
1167897988 19:52597549-52597571 TAAGAAGATTGGGCCAGGTGGGG + Intronic
1167943672 19:52968791-52968813 TAAGAGGATTAGGCCAGGTGCGG - Intergenic
1167950877 19:53026719-53026741 AAAAAAGTGTAGGCCAGGTGTGG + Intergenic
1168135205 19:54346383-54346405 AAACAAGAATAGGCCGGGTGCGG + Intergenic
1168217076 19:54934229-54934251 TACCAAAAACAGGCCGGGTGCGG - Intronic
1168276578 19:55282047-55282069 TTACAGAACCAGGCCAGGTGTGG + Intergenic
1168427164 19:56247978-56248000 TTGAAAGAACAGGCCAGGTGCGG - Intronic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
1168519357 19:57036241-57036263 TAAAAAGAATAGGCCACGTGTGG - Intergenic
1168550201 19:57286669-57286691 TAAGAAGTCCAGGCCAGGAGTGG + Intronic
1168640324 19:58027048-58027070 TAACATCAGTAGGCCGGGTGCGG + Intergenic
1202696347 1_KI270712v1_random:129543-129565 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
925234625 2:2267057-2267079 GAACCAGAGCAAGCCAGGTGGGG + Intronic
925371836 2:3351289-3351311 AAATAAGAAGAGGCCAGGTGTGG - Intronic
925429950 2:3782767-3782789 GAACTGGAGAAGGCCAGGTGCGG - Intronic
925439232 2:3869460-3869482 TAGCAAGACTAGGCCAGGTGTGG + Intergenic
925483820 2:4305618-4305640 TAACTAGAGCAGTCCTGGTAAGG + Intergenic
925833457 2:7919151-7919173 CAACAACAGCAGTCCAGGTGAGG - Intergenic
925988882 2:9237708-9237730 CAACCAGAGCAGGCCAGGCACGG - Intronic
926041019 2:9673267-9673289 TTTGAAGAGCAGACCAGGTGTGG + Intergenic
926172842 2:10564029-10564051 AAGAAAAAGCAGGCCAGGTGCGG + Intergenic
926664043 2:15500643-15500665 TAAAAAAAAAAGGCCAGGTGCGG + Intronic
927229520 2:20808369-20808391 TAACAAGACAAGGCCGGGCGCGG + Intronic
927604089 2:24470706-24470728 AAAGAAGAAGAGGCCAGGTGTGG + Intergenic
927625496 2:24712937-24712959 TTACACAAACAGGCCAGGTGCGG + Intronic
927721169 2:25383507-25383529 AAGCAAGACCAGGCCAGGTGCGG - Intronic
927756586 2:25713352-25713374 GAGCAACACCAGGCCAGGTGCGG + Intergenic
927769322 2:25844925-25844947 TTACAATAGCAGGCCAGGCATGG - Intronic
927806486 2:26151275-26151297 TAAAAAAAACTGGCCAGGTGCGG + Intergenic
927815992 2:26218017-26218039 AAACATTAGCCGGCCAGGTGTGG + Intronic
927933006 2:27057783-27057805 TAGAAAGAGCTGGCCAGGTGCGG + Intronic
928142660 2:28744121-28744143 GAAGAAGATCAAGCCAGGTGTGG + Intergenic
928305862 2:30169913-30169935 CAACAACAGAAGGCCGGGTGTGG - Intergenic
928566420 2:32555678-32555700 TTAGAGTAGCAGGCCAGGTGTGG + Intronic
928638011 2:33267250-33267272 TGCCAAGGGCAAGCCAGGTGTGG - Intronic
928641432 2:33303638-33303660 TAACCAATGCAGGCCAGGTGCGG - Intronic
929186459 2:39100623-39100645 ACAAAAGAGCAGGCCAGGCGTGG + Intronic
929220231 2:39456392-39456414 TGGCAAGAAGAGGCCAGGTGTGG + Intergenic
929222794 2:39482463-39482485 AAATGAGTGCAGGCCAGGTGTGG - Intergenic
929311997 2:40436058-40436080 TAATAAGAGCTGGCCAGACGTGG - Intronic
929320970 2:40542850-40542872 TAAAAAGTTTAGGCCAGGTGCGG - Intronic
929477684 2:42268726-42268748 TAAAAAATGTAGGCCAGGTGCGG - Intronic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
929948800 2:46390349-46390371 TAACAAGAGCAGGTTTGGTGGGG + Intergenic
930024608 2:47022495-47022517 TGGCAAGAGAAGGCCAGGTGTGG - Intronic
930053067 2:47231631-47231653 GAACTAGGACAGGCCAGGTGTGG + Intergenic
930059928 2:47279754-47279776 AAACAAAAACAGGCCAGGTGTGG + Intergenic
930623337 2:53667715-53667737 AAAAAAGAGCAGGCCGGGCGTGG + Intronic
930704123 2:54486835-54486857 ACACAGGAGGAGGCCAGGTGTGG + Intronic
931250793 2:60529127-60529149 AGAGAAGAGCAGGGCAGGTGGGG - Intronic
931330277 2:61274097-61274119 GAAAATAAGCAGGCCAGGTGAGG + Intronic
932023783 2:68113845-68113867 AAACAAAACAAGGCCAGGTGCGG + Intergenic
932176748 2:69609757-69609779 TAACAAAATTGGGCCAGGTGCGG + Intronic
932333393 2:70914155-70914177 AAATAAAATCAGGCCAGGTGCGG + Intronic
932424870 2:71623778-71623800 AATCAAAAGCAAGCCAGGTGTGG + Intronic
932531236 2:72535580-72535602 ATACAAAATCAGGCCAGGTGTGG + Intronic
932816104 2:74863513-74863535 TAAAAAGAGGCTGCCAGGTGTGG + Intronic
934149313 2:89130259-89130281 TAAGAATAACTGGCCAGGTGTGG - Intergenic
934217980 2:90051775-90051797 TAAGAATAACTGGCCAGGTGTGG + Intergenic
934277508 2:91586572-91586594 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
934785443 2:97001932-97001954 AAAAAAGGGCAGGCCGGGTGCGG - Intronic
935004287 2:99055911-99055933 TAACAATAGTCGGCCAGGCGCGG + Intronic
935055571 2:99563518-99563540 AAAAAAGAGCTAGCCAGGTGCGG + Intronic
935164761 2:100560947-100560969 AAACAAAACAAGGCCAGGTGCGG + Intergenic
935232447 2:101110684-101110706 GAACCAGAACAGGCCAGGCGCGG + Intronic
935261520 2:101359648-101359670 AGACATGAGCAGGCCAGGAGAGG - Intronic
935345432 2:102103702-102103724 TAAAAGAGGCAGGCCAGGTGCGG + Intronic
935794653 2:106629369-106629391 TAAAAAAAGGGGGCCAGGTGTGG - Intergenic
936165044 2:110114047-110114069 TGGCAGGAGCAGGGCAGGTGCGG + Intronic
936456694 2:112680628-112680650 AAATTAAAGCAGGCCAGGTGAGG - Intergenic
936552295 2:113456006-113456028 TAACAAGTTCAGGCCGGGCGTGG - Intronic
936611995 2:114010653-114010675 TAAAAAGATTAGGCCAGGCGTGG + Intergenic
936613991 2:114030705-114030727 AAAGAAGAGAAGGCCAGGAGCGG + Intergenic
936629814 2:114190075-114190097 TTAAAAGCGCAGGCCAGGCGCGG + Intergenic
936953911 2:118005471-118005493 TAAGAAGCATAGGCCAGGTGCGG + Intronic
937191969 2:120110930-120110952 TAACAACAGGGGGCCAGGAGCGG - Intronic
937921378 2:127133988-127134010 CAAGAAAAGCATGCCAGGTGTGG - Intergenic
937933272 2:127221741-127221763 AAAAAAGAGCAGGCCGGGCGCGG + Intergenic
937936671 2:127250996-127251018 CAAAAACAGCAGGCCAGATGCGG - Intergenic
937982696 2:127624563-127624585 TAAACAGAGCAGGAGAGGTGAGG - Intronic
938112221 2:128576351-128576373 AAACTAGATCTGGCCAGGTGCGG - Intergenic
938210075 2:129459766-129459788 TGTGAGGAGCAGGCCAGGTGAGG + Intergenic
938289330 2:130141152-130141174 GTACAAGGGCAGGCCAGGTAAGG - Exonic
938298375 2:130192803-130192825 TGACAACATCAGGCCAGGTGTGG + Intronic
938458387 2:131481854-131481876 TGACAACATCAGGCCAGGTGTGG - Intronic
938467197 2:131531786-131531808 GTACAAGGGCAGGCCAGGTAAGG + Exonic
938538259 2:132263772-132263794 TATCAAGAGAAGGCCAGGCACGG + Intergenic
939152726 2:138492671-138492693 TAAAAAGAAAAGGCCAGGTATGG - Intergenic
939380126 2:141424400-141424422 TAAGAAGATGAGGCCGGGTGCGG - Intronic
939394661 2:141613096-141613118 AAACAAAAACAGGCCAGGTGCGG - Intronic
939504454 2:143028553-143028575 TAACAATATGAGGCCAGGCGTGG + Intronic
939802028 2:146721688-146721710 TGCCAAGGGCAAGCCAGGTGCGG - Intergenic
939827870 2:147036990-147037012 TAAAAAAAGTTGGCCAGGTGTGG - Intergenic
940070921 2:149686944-149686966 TAACAAAAACAGGCCCAGTGAGG + Intergenic
940558939 2:155269272-155269294 AAGCAAGAAGAGGCCAGGTGCGG + Intergenic
940564239 2:155340020-155340042 TAGCAAGAGGTGGCCAGGTGCGG - Intergenic
940772069 2:157850097-157850119 TAAAATGAGAAGGCCGGGTGCGG + Intronic
940987075 2:160061469-160061491 TGAAAACATCAGGCCAGGTGAGG - Intronic
941667325 2:168255403-168255425 TAGCGAGAGTGGGCCAGGTGAGG + Intergenic
941743763 2:169064501-169064523 TAACATGACCGGGCCAGGCGCGG - Intergenic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941869656 2:170370926-170370948 GAAAAAGAACAGGCCAGGTGCGG + Intronic
941938105 2:171002562-171002584 TAGAAAAAGCAGGCCAGGCGCGG - Intronic
942128369 2:172850325-172850347 TAAAAATATCAGGCCAGGCGTGG + Intronic
942181180 2:173382765-173382787 TAACAAAAATGGGCCAGGTGTGG + Intergenic
942297602 2:174532900-174532922 TAACTTAAGCAGGCCAGGCGCGG - Intergenic
942345660 2:175000426-175000448 AAAAAAAATCAGGCCAGGTGTGG - Intronic
942375418 2:175331594-175331616 TAAAAAGATCCGGCCAGGTGTGG + Intergenic
942384372 2:175425827-175425849 TTAAAAGAGCAGGCCAGGTGTGG + Intergenic
942395375 2:175541503-175541525 AATCAAGATCAGGCCAGGTGCGG - Intergenic
942477260 2:176340445-176340467 TATCACAACCAGGCCAGGTGTGG - Intergenic
942557978 2:177191022-177191044 AAATAAAAGGAGGCCAGGTGTGG + Intergenic
942618101 2:177815918-177815940 TCTACAGAGCAGGCCAGGTGTGG + Intronic
942711985 2:178847237-178847259 AAAGCAAAGCAGGCCAGGTGCGG + Intronic
943027904 2:182651295-182651317 TAAAAATACAAGGCCAGGTGTGG - Intergenic
943537449 2:189170005-189170027 TAATAATAACAGGCCAGGTGTGG - Intronic
944158532 2:196634742-196634764 AATAAAGACCAGGCCAGGTGCGG + Intergenic
944224471 2:197336139-197336161 TAAAAAGAGCCGGCTGGGTGAGG - Intergenic
944712792 2:202350345-202350367 AAACCAAAACAGGCCAGGTGCGG + Intergenic
944737800 2:202583735-202583757 AAAAAACAACAGGCCAGGTGTGG - Intergenic
944763092 2:202837559-202837581 TGAAAAGAGAAGGCCGGGTGCGG - Intronic
944830487 2:203529262-203529284 TCAGTAGAGCAGGCCAGGTGCGG - Intronic
945081665 2:206092064-206092086 AAACAAAACCAGGCCAGGCGCGG - Intergenic
945104720 2:206299378-206299400 TAACCACAGAGGGCCAGGTGCGG + Intronic
945334633 2:208578202-208578224 TAAAAAGTCCAGGCCAGGCGCGG + Intronic
945448301 2:209964496-209964518 TAACAAGATAAGGCCGGGCGCGG + Intronic
946323210 2:218966153-218966175 AAACGTAAGCAGGCCAGGTGTGG + Intergenic
946388926 2:219404048-219404070 AAGCATGAGCAGGCCAGGCGCGG + Intergenic
946723185 2:222633390-222633412 AAAGAAGAGAACGCCAGGTGTGG + Intronic
947327121 2:228991581-228991603 TCACAAGGGCGAGCCAGGTGTGG + Intronic
947508382 2:230727946-230727968 AAACTAGCCCAGGCCAGGTGTGG + Intronic
947535424 2:230937501-230937523 TCACAAGAGCACACCAAGTGGGG - Intronic
947638169 2:231690948-231690970 TCTCAAAAGAAGGCCAGGTGTGG - Intergenic
947676714 2:231988131-231988153 TAAGAAAAATAGGCCAGGTGCGG - Intronic
947838936 2:233195084-233195106 TAAAATAAACAGGCCAGGTGTGG - Intronic
947993909 2:234511203-234511225 AAAAAAGGACAGGCCAGGTGTGG - Intergenic
948261853 2:236610116-236610138 AAACAAAAACAGGCCAGGCGTGG - Intergenic
948902530 2:240963757-240963779 GAACAGGAGAAGGCCAGGTATGG + Intronic
948960036 2:241327758-241327780 TAGCCAGATCAGGCCTGGTGTGG + Intronic
1168737397 20:153513-153535 TTACAATATCAGGCCAGGCGTGG + Intergenic
1168815408 20:733471-733493 TAACAACCACAGGCCAGGTGCGG - Intergenic
1169098980 20:2929240-2929262 AAAAAACAGCAGGCCAGGTGTGG - Intronic
1170106602 20:12758665-12758687 AAACAAGAGCAGGGCATGTATGG - Intergenic
1170166109 20:13361724-13361746 AAACAAGAGCAGGGCATGTATGG - Intergenic
1170277461 20:14607960-14607982 TACCAGGAAAAGGCCAGGTGTGG + Intronic
1171498501 20:25575156-25575178 TTAAAAGAATAGGCCAGGTGCGG + Intronic
1171498550 20:25575460-25575482 AAAAAAGAATAGGCCAGGTGTGG + Intronic
1171506101 20:25634972-25634994 TAAGAAACTCAGGCCAGGTGTGG - Intergenic
1171880384 20:30614191-30614213 GAACAAGAGCAGACCAGGGAGGG - Intergenic
1172251838 20:33485121-33485143 TAAGAATATTAGGCCAGGTGCGG - Intergenic
1172291084 20:33777342-33777364 AAAAAAAATCAGGCCAGGTGCGG + Intronic
1172396642 20:34611354-34611376 GAAAAAAAACAGGCCAGGTGCGG + Intronic
1172470809 20:35193462-35193484 GAAACAGGGCAGGCCAGGTGCGG - Intergenic
1172488235 20:35313084-35313106 TAAAAAGATGAGGCCAGGCGTGG + Intronic
1172489051 20:35319574-35319596 AAACACGAGCAGGCCAGGGACGG + Intronic
1172944683 20:38678025-38678047 TATCCAGAGCAGGTCATGTGGGG - Intergenic
1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG + Intronic
1173986362 20:47264742-47264764 AAACAAGAATATGCCAGGTGCGG + Intronic
1174000910 20:47374013-47374035 TAATAATAATAGGCCAGGTGTGG - Intergenic
1174248011 20:49196494-49196516 TAGCAACATGAGGCCAGGTGTGG + Intergenic
1174269578 20:49357896-49357918 TAACAAGATCGGGCCAGGCCTGG - Intergenic
1174504527 20:51008621-51008643 TCATAAGATCAGGCCAGGTGTGG - Intronic
1174618166 20:51852443-51852465 TCACAAGAGCAAGCTGGGTGTGG - Intergenic
1174634380 20:51986462-51986484 TAAAAAAAACAGGCCAGGCGTGG + Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1174788135 20:53452307-53452329 GAACTAGAGCAGGCCAAGCGTGG + Intronic
1175006325 20:55687301-55687323 TAAGAAGAGTAGGCCAGGCGTGG + Intergenic
1175124291 20:56739965-56739987 TATCAAGAACAAGACAGGTGGGG - Intergenic
1175730710 20:61352005-61352027 TAACTAAAGGAGGCCGGGTGCGG - Intronic
1176903771 21:14475843-14475865 AAAAAAGAACAGGTCAGGTGTGG + Intergenic
1177034394 21:16024005-16024027 AAGCAAGAACAGGCCAGGCGTGG + Intergenic
1178479481 21:32967254-32967276 AGACATGAGCAGGCCAGGAGGGG + Intergenic
1178535731 21:33408886-33408908 AAAGAAGAAAAGGCCAGGTGTGG + Intronic
1178543282 21:33473160-33473182 AAAAAAAATCAGGCCAGGTGTGG + Intronic
1179137392 21:38692292-38692314 CAAAAAGAGCAGGCCAGGTGCGG + Intergenic
1179191160 21:39122803-39122825 GAACAAGGCTAGGCCAGGTGCGG + Intergenic
1179338481 21:40481197-40481219 CCACAAGAACAGGCCGGGTGCGG + Intronic
1179603187 21:42494988-42495010 TAAAAAAATCAGGCCAGGCGCGG - Intronic
1179839448 21:44061555-44061577 TAAAAAATACAGGCCAGGTGCGG - Intronic
1180313847 22:11260423-11260445 TATCAAGAGAAGGCCAGGCAAGG + Intergenic
1180341502 22:11623134-11623156 TATCAAGAGAAGGCCAGGCACGG - Intergenic
1180431971 22:15261439-15261461 TAACAAATGCAGGCCGGGTGTGG - Intergenic
1180625019 22:17188587-17188609 GACCAGGAGCAGGCCAGGCGTGG + Intronic
1180627569 22:17204324-17204346 TAAGAAGAGGAGGCCAGGCGTGG + Intronic
1180795557 22:18602965-18602987 TTAAAAAAGTAGGCCAGGTGCGG - Intergenic
1181136360 22:20769377-20769399 TATCAAGGTCAGGCCAGGTGTGG + Intronic
1181226172 22:21392307-21392329 TTAAAAAAGTAGGCCAGGTGCGG + Intergenic
1181252465 22:21542509-21542531 TTAAAAAAGTAGGCCAGGTGCGG - Intergenic
1181285598 22:21749906-21749928 AAACAAAACAAGGCCAGGTGCGG - Intergenic
1181537619 22:23554645-23554667 TAACCAGTACTGGCCAGGTGCGG + Intergenic
1181722952 22:24790097-24790119 TAAAAACAAAAGGCCAGGTGTGG + Intergenic
1181724180 22:24799914-24799936 TAAGAAAAATAGGCCAGGTGTGG - Intergenic
1181809380 22:25394122-25394144 AAAAAACACCAGGCCAGGTGTGG + Intronic
1181916131 22:26281666-26281688 AAAGAAAAGAAGGCCAGGTGCGG - Intronic
1182139506 22:27941137-27941159 TACAAAAAGAAGGCCAGGTGTGG - Intergenic
1182231906 22:28844510-28844532 GAAGAAGAACAGGCCATGTGAGG + Intergenic
1182250611 22:28997161-28997183 TGACCAGAGAAGGCCTGGTGAGG - Intronic
1182272870 22:29166646-29166668 GACCAAGATCAGGCCAGGCGCGG + Intronic
1182326881 22:29519922-29519944 TAGAAAGGCCAGGCCAGGTGCGG - Intronic
1182388220 22:29965405-29965427 AAATTAGAGTAGGCCAGGTGTGG + Intronic
1182423663 22:30260608-30260630 AAGGAAGAGCAGGGCAGGTGGGG - Intergenic
1182536502 22:31007756-31007778 TAAGAAGAGGAGGCCGGGTGTGG + Intergenic
1182539633 22:31031429-31031451 TAAGAAAATCAGGCCAGGTGTGG - Intergenic
1182544523 22:31067044-31067066 TTAAAATTGCAGGCCAGGTGTGG - Intronic
1182581124 22:31312298-31312320 TACAAAAATCAGGCCAGGTGCGG + Intergenic
1182943170 22:34297673-34297695 AAAGGAGAGCAGGCCAGGGGAGG - Intergenic
1183151496 22:36041407-36041429 GAACAAGAACAGGCCAGGCGCGG + Intergenic
1183159838 22:36105179-36105201 CAGCAAGAGCAGGCTGGGTGTGG - Intergenic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183173559 22:36205403-36205425 CAACAAGAGCAGGCCTGGTGCGG - Intergenic
1183179801 22:36252429-36252451 CAACAAGAGCAGGCCTGGTGCGG + Intergenic
1183195081 22:36348216-36348238 TCAAAAAAACAGGCCAGGTGCGG + Intronic
1183475185 22:38032291-38032313 GGATAAAAGCAGGCCAGGTGTGG - Intronic
1183757144 22:39779026-39779048 TTATAAAAACAGGCCAGGTGTGG + Intronic
1183798223 22:40138554-40138576 TAACAGTAACAGGCCAGGCGTGG - Intronic
1183822524 22:40358066-40358088 AAACAAGATTAGGCCAGGCGCGG - Intronic
1183861756 22:40675324-40675346 TAAAATGAGTAGGCCAGGTGTGG + Intergenic
1183906399 22:41044149-41044171 TATCAAAAATAGGCCAGGTGTGG - Intergenic
1183935092 22:41257404-41257426 TACCAAGTGCAGGCCACATGGGG - Intronic
1184605491 22:45571838-45571860 AAACAAAAACAGGCCAGGCGCGG + Intronic
1184623796 22:45705722-45705744 TAACAAGTGGAGGCCGGGCGCGG - Intronic
1184888323 22:47362110-47362132 TAGCAAGATTGGGCCAGGTGTGG - Intergenic
1185180628 22:49358821-49358843 TAATAAAAACAGGCCAGGTGCGG - Intergenic
1185356719 22:50377161-50377183 TCACAAATTCAGGCCAGGTGAGG + Intronic
949552690 3:5124157-5124179 TTACAATAGGAGGCCAGGCGCGG - Intronic
949553903 3:5135745-5135767 TAATAATAATAGGCCAGGTGCGG - Intronic
949602032 3:5610563-5610585 TAACATGGGCAGGCCAGGTGTGG - Intergenic
949704735 3:6803370-6803392 TAAGAAAAGTGGGCCAGGTGCGG - Intronic
949987008 3:9549403-9549425 TAACAGGAACAGGCCAGGCATGG + Intronic
950010514 3:9719701-9719723 TATACAAAGCAGGCCAGGTGTGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950293303 3:11805425-11805447 TAACAAAAATAGGCCAGATGCGG - Intronic
950491536 3:13308085-13308107 TAATATGCACAGGCCAGGTGCGG + Intergenic
950515646 3:13463288-13463310 TAATAGGAGGAGGCCAGGTGGGG + Intergenic
950774705 3:15339419-15339441 TAAAAAGAAGAGCCCAGGTGCGG + Intronic
951216154 3:20027166-20027188 CAACAAGAGTTGGCCAGGCGCGG - Intergenic
951535594 3:23737886-23737908 TAAGAAAAGCAGGCCAGGTGTGG + Intergenic
951710810 3:25583643-25583665 GAGCAAGGGCAGGACAGGTGAGG - Intronic
951763704 3:26173141-26173163 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
951892303 3:27578775-27578797 AAAGAAAAGCAGGCCAGGTGCGG + Intergenic
951897625 3:27625485-27625507 TAAAGAGGGTAGGCCAGGTGCGG + Intergenic
952265318 3:31780000-31780022 GAACAATAATAGGCCAGGTGTGG + Intronic
952633371 3:35497269-35497291 TAAGAAAAATAGGCCAGGTGTGG + Intergenic
952812208 3:37414211-37414233 TAGCTAGAAAAGGCCAGGTGTGG - Intronic
952972357 3:38659573-38659595 TATCTAGAGCATCCCAGGTGGGG - Intergenic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953739362 3:45523801-45523823 AAACTACAGCAAGCCAGGTGTGG - Intronic
953900978 3:46843893-46843915 TAACAAGAGGCGGCCAGATGTGG + Intergenic
953934814 3:47032219-47032241 GAAGTAAAGCAGGCCAGGTGTGG + Intronic
953963566 3:47284625-47284647 TAAGAAGAGCAGGCTGGGCGCGG - Intronic
954165906 3:48757763-48757785 ATACAAAAACAGGCCAGGTGTGG + Intronic
954252128 3:49376129-49376151 TAGCAAGAACAGGCCAGGCGTGG - Intronic
954255794 3:49404955-49404977 TAAAAAAAGTAGGCCAGGCGCGG + Intronic
954266719 3:49475392-49475414 AAAAAAAAGCTGGCCAGGTGAGG - Intronic
954300161 3:49696934-49696956 TAACCAGTCCAGGCCGGGTGTGG - Intronic
954413080 3:50379665-50379687 TCACAGGAGCAGGGCAGATGGGG + Intronic
954667250 3:52262836-52262858 CACAATGAGCAGGCCAGGTGCGG + Intronic
955140725 3:56266603-56266625 AAACAAGAGGTAGCCAGGTGAGG + Intronic
955182417 3:56683972-56683994 GAACAAATGGAGGCCAGGTGCGG - Intergenic
955285660 3:57638810-57638832 GAAAAATAACAGGCCAGGTGTGG + Intronic
955323914 3:57995043-57995065 CAAAAAAACCAGGCCAGGTGAGG + Intergenic
955382891 3:58454933-58454955 AAAGAAGAGCAGACCAGGTGTGG - Intergenic
955698795 3:61662991-61663013 TGAAAAGAGCAGGCCAGGTATGG + Intronic
956102547 3:65783830-65783852 AAAAAAGTGCAGGCCAGGTGTGG + Intronic
956170367 3:66428990-66429012 AAACAAGAGCAGCCCAGTGGCGG + Intronic
956346441 3:68284635-68284657 AAAAAAGAGCAGGCCAGGCATGG + Intronic
956368433 3:68531828-68531850 TGACATGAGCAGGGCAGGAGAGG - Intronic
956426038 3:69136479-69136501 AATCAAGAGCAGGCAAAGTGAGG + Intergenic
956834784 3:73087920-73087942 GAATAAGATCTGGCCAGGTGCGG - Intergenic
957187987 3:76967495-76967517 AAAAAAGAGCTGGCCAGGTGCGG - Intronic
957586720 3:82141990-82142012 AAACAACATCAGGCCAGGCGTGG + Intergenic
957680031 3:83421783-83421805 TAACTAAAGCAGGCCAGGCACGG - Intergenic
957899733 3:86473839-86473861 TAACTAGAATAGGCCGGGTGCGG - Intergenic
958931532 3:100212804-100212826 TAATAATTTCAGGCCAGGTGCGG - Intergenic
959295027 3:104524190-104524212 TAAAAATATCTGGCCAGGTGCGG + Intergenic
959667176 3:108935101-108935123 GAGCAAGAACAGGCCAGGTGTGG - Intronic
959694988 3:109239736-109239758 TGCCAAAAGCAGGCCGGGTGTGG + Intergenic
959776314 3:110168155-110168177 TAATGAGATTAGGCCAGGTGCGG - Intergenic
960334595 3:116400765-116400787 AAACAAGATCAGGCCGGGAGTGG - Intronic
960399383 3:117177571-117177593 AAAAAATAGCAGGCCGGGTGCGG - Intergenic
960444643 3:117732985-117733007 TAATAATAATAGGCCAGGTGCGG - Intergenic
961732299 3:128974829-128974851 AAAGAAGAGAAGGCCAGGCGTGG + Intronic
961757174 3:129135473-129135495 AAACAAAACCAGGCCGGGTGCGG + Intronic
961783112 3:129333098-129333120 AAAAAAAAGCAGGCCGGGTGTGG + Intergenic
961853269 3:129843054-129843076 AAACAGAAGGAGGCCAGGTGTGG + Intronic
962078121 3:132106441-132106463 TAGAAACAGAAGGCCAGGTGTGG - Intronic
962329584 3:134465618-134465640 TTATAATACCAGGCCAGGTGTGG + Intergenic
963458855 3:145579814-145579836 TACCATGAGCAGGGCAGGAGAGG - Intergenic
963504500 3:146166573-146166595 TAAGAAGAGCATGCCAGGATAGG + Intergenic
963707214 3:148702265-148702287 GTACAAAATCAGGCCAGGTGAGG - Intronic
963869623 3:150401144-150401166 TAAAAAAAGAAGGCCAGATGCGG - Intergenic
964700758 3:159563536-159563558 TTACTAAAGGAGGCCAGGTGTGG + Intronic
964921392 3:161900583-161900605 AAACAAAAGCAGGCTGGGTGTGG + Intergenic
965476973 3:169168323-169168345 AAAAAAAAGCAGGCCAAGTGTGG - Intronic
965808787 3:172570862-172570884 TAACACAAAAAGGCCAGGTGCGG - Intergenic
965866574 3:173212167-173212189 TAACAATAATAGGCCAGGTATGG - Intergenic
966181077 3:177189225-177189247 TAACAATTTCAGGCCAGGTGTGG + Intronic
966393976 3:179482184-179482206 TAAAAGAAGCAGGCCAGGTGTGG - Intergenic
966502380 3:180657947-180657969 TATTAATAGCAGGCCAGGTGCGG + Intronic
966717321 3:183026419-183026441 TTAAAAATGCAGGCCAGGTGCGG + Intronic
966844887 3:184120863-184120885 AAAAAACAGCAGGCCAGGTTGGG + Intergenic
967098736 3:186198351-186198373 TAACAAGAGTAGGGCACATGGGG + Intronic
967216536 3:187215435-187215457 TAAGAAGAGTAGGCCAGGCACGG - Intergenic
967765252 3:193272151-193272173 CCACAATAACAGGCCAGGTGCGG + Intronic
967788191 3:193519933-193519955 TAGAAATTGCAGGCCAGGTGCGG - Intronic
968036133 3:195549623-195549645 TGAAAAGAGGAGGCCAGGCGTGG - Intergenic
968206809 3:196809590-196809612 GTAACAGAGCAGGCCAGGTGTGG - Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968427075 4:531289-531311 TCAGGAGAGCAGGCCAGATGGGG + Intronic
968813469 4:2810281-2810303 GGAGAGGAGCAGGCCAGGTGAGG - Intronic
968816973 4:2827357-2827379 GGCCAAGAGGAGGCCAGGTGGGG - Intronic
968864070 4:3196444-3196466 TATCCATTGCAGGCCAGGTGTGG + Intronic
969033240 4:4229776-4229798 AAAAAAATGCAGGCCAGGTGGGG - Intergenic
969210303 4:5682198-5682220 TAGCAATAGCAGGCCGGGGGCGG + Intronic
969385021 4:6838836-6838858 TAAATAAAGCTGGCCAGGTGAGG + Intronic
969572542 4:8018170-8018192 TAACATGTGCAGGACAGGAGGGG - Intronic
969888407 4:10237195-10237217 TATCAAGGGCAGGCAAGATGAGG - Intergenic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970480407 4:16467251-16467273 TAACCAGAGCAGGGCAGTTCAGG + Intergenic
970990803 4:22210698-22210720 TAAATTGTGCAGGCCAGGTGTGG - Intergenic
971290125 4:25329822-25329844 TAAAAACATCCGGCCAGGTGCGG - Intronic
971322414 4:25616161-25616183 TAAAAAGAAAAGGCCAGGTTTGG - Intergenic
971404904 4:26313375-26313397 TACAAAGAAAAGGCCAGGTGTGG + Intronic
971609492 4:28704247-28704269 TAAAAAAAAGAGGCCAGGTGTGG + Intergenic
971872485 4:32261610-32261632 TAACAAAATTAGGCCAGGTGTGG - Intergenic
971888492 4:32484281-32484303 TAACTAGAGTGGGCCAGGTGTGG - Intergenic
972388870 4:38593702-38593724 TAAGAGTAGTAGGCCAGGTGTGG - Intergenic
972541183 4:40040773-40040795 TATCTCAAGCAGGCCAGGTGTGG - Intergenic
972550599 4:40129515-40129537 AAACAAGAAAAGGCCAGGTGTGG - Intronic
973047769 4:45555892-45555914 GGACAAAAGCAGGCCAAGTGTGG - Intergenic
973198754 4:47476290-47476312 AAATAAAAACAGGCCAGGTGTGG - Intergenic
973653075 4:53016816-53016838 GATCAAGATCTGGCCAGGTGCGG + Intronic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
973821416 4:54664876-54664898 AAAAAAAAACAGGCCAGGTGTGG - Intronic
974921337 4:68243949-68243971 TGACAAGAGAAAGCCATGTGAGG - Intronic
974953118 4:68605112-68605134 TCATCAGATCAGGCCAGGTGTGG - Intronic
975303610 4:72821526-72821548 TAAAAACAACAGGCCAGGTGTGG + Intergenic
975587831 4:75968739-75968761 AAAGCAGAACAGGCCAGGTGCGG + Intronic
975814540 4:78203856-78203878 AAACAAGAGGAGGCCAGGTGTGG - Intronic
975852981 4:78592175-78592197 TAAAAAGAGAAAGCAAGGTGTGG - Intronic
976190976 4:82486592-82486614 TAAACAGATGAGGCCAGGTGGGG + Intronic
976402398 4:84622296-84622318 AAACAACTGCGGGCCAGGTGCGG + Intronic
976415524 4:84769710-84769732 TAATAAAAGCAGGCCGGGCGCGG - Intronic
976427442 4:84921943-84921965 AAATGAAAGCAGGCCAGGTGCGG - Intronic
976650971 4:87434332-87434354 AAACAAGTGTAGGCCAGGTGTGG - Intronic
976730758 4:88258792-88258814 TACAAAGATCTGGCCAGGTGCGG + Exonic
976904425 4:90218728-90218750 GAAAAAGATTAGGCCAGGTGTGG + Intronic
977436432 4:97001624-97001646 AAAAAAGATCAGGCCAGGTGCGG - Intergenic
977554492 4:98474968-98474990 AAATAAAACCAGGCCAGGTGTGG - Intronic
977602755 4:98951654-98951676 TAAAAAAAGTAGGCCAGGCGTGG - Intergenic
978271766 4:106899587-106899609 TAAGAAGAAAAGGCCAGGTGCGG - Intergenic
978572561 4:110154543-110154565 TAATAAAAATAGGCCAGGTGTGG - Intronic
978600057 4:110418643-110418665 TAAGAAGATTAGGCCGGGTGGGG + Intronic
978615021 4:110585697-110585719 TAGCAAGGACGGGCCAGGTGTGG - Intergenic
978851481 4:113342408-113342430 TTACCCAAGCAGGCCAGGTGTGG + Intronic
979292307 4:118991436-118991458 AAACAAAAACAGGCCGGGTGCGG - Intronic
979499463 4:121422590-121422612 TCACGAGAGGAGGCCGGGTGCGG - Intergenic
979551304 4:121994064-121994086 AATAAAAAGCAGGCCAGGTGCGG - Intergenic
979793458 4:124815127-124815149 AGACAAGAGCAGGGCAGGAGAGG + Intergenic
980140532 4:128910971-128910993 TAGTAACAACAGGCCAGGTGCGG + Intronic
980622952 4:135333376-135333398 TATATAGTGCAGGCCAGGTGTGG + Intergenic
980777789 4:137459089-137459111 TAACAATAGCAGGCCTGGCGCGG - Intergenic
980902782 4:138920930-138920952 AAACAGGGTCAGGCCAGGTGTGG + Intergenic
981085896 4:140683166-140683188 TTCAATGAGCAGGCCAGGTGCGG - Intronic
981311107 4:143298990-143299012 AAAGAAAGGCAGGCCAGGTGTGG + Intergenic
981727099 4:147860150-147860172 TAACAGGAGAAGGCCGGGCGTGG + Intronic
981779934 4:148417065-148417087 AAACAAATACAGGCCAGGTGCGG - Intronic
981990735 4:150917634-150917656 TAAAAAGAACAGGCCAGATACGG + Intronic
982003760 4:151045545-151045567 TTATAATACCAGGCCAGGTGAGG + Intergenic
982254803 4:153441463-153441485 TTACTAGAGCAGGCCGGGTGCGG + Intergenic
982552365 4:156818790-156818812 TAGAAAGAGTGGGCCAGGTGCGG - Intronic
982611184 4:157575579-157575601 TGCCAAGGGCGGGCCAGGTGCGG - Intergenic
982967762 4:161935889-161935911 AAACAAAAGCAGGCTAGGTGAGG + Intronic
983641984 4:169951693-169951715 AAAAAAAAACAGGCCAGGTGTGG - Intergenic
983921251 4:173347764-173347786 GACTATGAGCAGGCCAGGTGTGG + Intergenic
984103457 4:175515435-175515457 TAACAACAGCTGTCCAGGTGTGG + Intergenic
984270519 4:177543442-177543464 TATAAAGGCCAGGCCAGGTGTGG + Intergenic
984672407 4:182505744-182505766 AAAGAAAAGCAGGCCGGGTGTGG - Intronic
984894601 4:184526884-184526906 TAACAACAGCAGGCTGGGTGCGG + Intergenic
985710598 5:1426246-1426268 TAAATAGATCTGGCCAGGTGTGG + Intronic
985743680 5:1634535-1634557 AAAAAAAAGCAGGCCGGGTGCGG + Intergenic
985973852 5:3399232-3399254 AAACAGAGGCAGGCCAGGTGTGG - Intergenic
986055340 5:4130818-4130840 TTTAAAGAGCAGGCCAGGTTTGG - Intergenic
986425860 5:7630941-7630963 TAACAAAAGTTAGCCAGGTGTGG - Intronic
986428045 5:7654271-7654293 TAACAAGAGGAGCTCTGGTGGGG + Intronic
986884439 5:12216297-12216319 AAACAGAACCAGGCCAGGTGCGG + Intergenic
986930077 5:12806653-12806675 AAACAAAAGTAGGCCAGGCGCGG - Intergenic
987194990 5:15517457-15517479 GAATAAGAGCTTGCCAGGTGTGG + Intronic
987283155 5:16430536-16430558 TAACAACTGCAGGGCAGGTCAGG - Intergenic
987359099 5:17090753-17090775 TAGAATGAACAGGCCAGGTGTGG + Intronic
987376003 5:17235550-17235572 CATAAAGAGCAGGCCAGGCGTGG - Intronic
988081039 5:26416057-26416079 TTCCAAGGGCAAGCCAGGTGTGG + Intergenic
988461364 5:31441128-31441150 AAAAAAGGGCAGGCCAGGTGTGG + Intronic
988490015 5:31698303-31698325 GAAAAAGAGAAGGCCGGGTGCGG + Intronic
988569771 5:32352755-32352777 CAAAAAAATCAGGCCAGGTGTGG + Intergenic
988827083 5:34948574-34948596 TAGTGAGAGCTGGCCAGGTGCGG + Intronic
988960446 5:36365523-36365545 AACCTAAAGCAGGCCAGGTGTGG - Intergenic
989365105 5:40647228-40647250 TAGTAATAACAGGCCAGGTGCGG + Intergenic
989622730 5:43400792-43400814 TAAGAAGGGCAGGCTGGGTGTGG + Intronic
989960922 5:50413852-50413874 TGAAAAAACCAGGCCAGGTGCGG - Intronic
990082647 5:51935823-51935845 TAATAAGACCTGGCCAGGCGTGG - Intergenic
990389095 5:55300381-55300403 TAATAATAATAGGCCAGGTGTGG + Intronic
990463639 5:56052220-56052242 TTACAACACGAGGCCAGGTGTGG + Intergenic
990563481 5:57006323-57006345 TTACAAAACCAGGCCAGGTGTGG + Intergenic
990593766 5:57293117-57293139 TAAAAACAACTGGCCAGGTGTGG + Intergenic
991163900 5:63539419-63539441 TTAAAAAAGCAGGCCAGGCGCGG + Intergenic
991252661 5:64580921-64580943 TAAAAACTGGAGGCCAGGTGTGG + Intronic
991384329 5:66068189-66068211 TAACAACAACTAGCCAGGTGTGG + Intronic
991394239 5:66186971-66186993 TAACAACATGAGGCCAGGCGGGG + Intergenic
991444525 5:66684969-66684991 AAAGAATAGCTGGCCAGGTGGGG + Intronic
992164039 5:74031090-74031112 CAACAAAAGCAGCCCCGGTGGGG - Intergenic
992400542 5:76407255-76407277 TCACAGTATCAGGCCAGGTGTGG - Intronic
992433733 5:76735181-76735203 TTAAAAGAGCAGGCCAGGCGCGG + Exonic
992642975 5:78785086-78785108 CAATAAAATCAGGCCAGGTGCGG - Intronic
992678783 5:79132490-79132512 AAACAAAAATAGGCCAGGTGTGG + Intronic
992680515 5:79148315-79148337 TAAGAGCAGCAGACCAGGTGCGG - Intronic
992715145 5:79503240-79503262 TAAGAAAAGCAGGCCAGGCATGG + Intronic
992953737 5:81886992-81887014 TAAGAAAAGCAGGCCGGGCGCGG - Intergenic
993205098 5:84868540-84868562 AAACCAGAGAAGGACAGGTGCGG - Intergenic
993276119 5:85860922-85860944 AAACAAGGACAGGCCAGGCGCGG - Intergenic
993336426 5:86665407-86665429 TAGCAAGAAAAGGCCAGGTGCGG + Intergenic
993646063 5:90464281-90464303 CAACAACATCAGGCCTGGTGCGG + Intronic
993716249 5:91278438-91278460 AAAAAAGAGCCGGCCAGGTATGG + Intergenic
994508697 5:100675371-100675393 TAAGAAAAACAGGCCAGGTGGGG - Intergenic
994581546 5:101648823-101648845 TAATAAGAACAGGCCGGGCGCGG + Intergenic
995524581 5:113040260-113040282 TGACAAGGGCTGGCCAGGTAAGG + Intronic
995757737 5:115527710-115527732 TAGCAAAAGCTGGCCAGGCGCGG + Intronic
995825562 5:116295083-116295105 TAAAAAAACAAGGCCAGGTGTGG + Intronic
995873865 5:116770045-116770067 TAATGAGAGTAGGCCAGGAGCGG + Intergenic
995948478 5:117680349-117680371 AAAAGAAAGCAGGCCAGGTGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997534835 5:134611428-134611450 AAAAATGAACAGGCCAGGTGTGG + Intronic
997597509 5:135116918-135116940 TAAACAGAGCCGGCCAGGCGCGG - Intronic
997991269 5:138546048-138546070 AAGGAAGAGGAGGCCAGGTGTGG - Intergenic
998014767 5:138723362-138723384 TAAAAAGAGAAGGGCAGGTCGGG - Intronic
998123241 5:139596754-139596776 TAATAATAATAGGCCAGGTGCGG + Intronic
998297436 5:140985225-140985247 TAAGAAGATTAGGCCAGGCGCGG - Intronic
998350683 5:141498639-141498661 GAAGAAGACCTGGCCAGGTGTGG + Intronic
999103296 5:149045933-149045955 TAAAAAAACCAGGCCGGGTGCGG - Intronic
999447604 5:151652589-151652611 CAACAAAAACAAGCCAGGTGTGG - Intergenic
999461925 5:151764355-151764377 TACCAACAACTGGCCAGGTGCGG - Intronic
999669607 5:153947386-153947408 AAAGAAAAACAGGCCAGGTGAGG + Intergenic
999735431 5:154509543-154509565 AAAGAGGAGAAGGCCAGGTGTGG + Intergenic
999778248 5:154828137-154828159 TAAATAAAACAGGCCAGGTGTGG - Intronic
1000787162 5:165559372-165559394 TAACAAAATGAGGCCAGGTGTGG - Intergenic
1000922222 5:167151805-167151827 GAAGAAAAGCAGGCCAGGCGCGG - Intergenic
1001403816 5:171461915-171461937 GAGCAAGAGCTGGCCAAGTGCGG - Intergenic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001810290 5:174622451-174622473 AAAGAAGGGCAGGCCAGGAGGGG + Intergenic
1002146308 5:177184825-177184847 AAACAAGAAAAGGCCAGGCGTGG - Intronic
1002255665 5:177956844-177956866 TGTCAGGAGGAGGCCAGGTGCGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002386724 5:178873076-178873098 TAAGAAACACAGGCCAGGTGTGG - Intronic
1002487374 5:179548840-179548862 AAACAAGACCAGGCCGGGCGTGG + Intergenic
1002522571 5:179799804-179799826 CAATGAGAACAGGCCAGGTGGGG + Intronic
1002539728 5:179898441-179898463 TAAAAAAAAAAGGCCAGGTGCGG - Intronic
1002602047 5:180359450-180359472 TAAGAAAAGCAGGCCAGGCTGGG + Intergenic
1003162497 6:3648152-3648174 AAATAATATCAGGCCAGGTGCGG - Intergenic
1003302552 6:4897624-4897646 TCAGGAGACCAGGCCAGGTGTGG + Intronic
1003539909 6:7009604-7009626 AAACAAAGTCAGGCCAGGTGTGG + Intergenic
1003841540 6:10125543-10125565 TAAAAGAAGGAGGCCAGGTGCGG - Intronic
1003856310 6:10279777-10279799 GAAAAAGAACAGGCCGGGTGTGG + Intergenic
1003887282 6:10533014-10533036 TAACTAGTCCAGGCCAGGTGTGG + Intronic
1003943740 6:11054241-11054263 TAATAAGTGTAGGCCAGGTGCGG + Intergenic
1004062614 6:12212763-12212785 GAAGAAAAACAGGCCAGGTGTGG + Intergenic
1004213455 6:13677825-13677847 CAACAACTGCAGGCCAGGTGTGG + Intronic
1004606733 6:17201795-17201817 AAACAGAAGTAGGCCAGGTGTGG - Intergenic
1004640369 6:17509385-17509407 TATAAAAAGCAGACCAGGTGTGG + Intronic
1004754136 6:18593376-18593398 AACAAAGAACAGGCCAGGTGTGG - Intergenic
1004763387 6:18696472-18696494 AGACCAGAGGAGGCCAGGTGCGG - Intergenic
1004905774 6:20235737-20235759 TAAAAAGAACAGGCCAGGCGTGG + Intergenic
1004937065 6:20518267-20518289 TAAGAAAAGTAGGCCAGGCGTGG + Intergenic
1005050874 6:21683002-21683024 TAACAAGAAGAGGCTGGGTGTGG - Intergenic
1005133140 6:22535216-22535238 AAGCAAGAGCAGGACAGTTGTGG - Intergenic
1005133289 6:22537486-22537508 TAACTGGAAGAGGCCAGGTGCGG + Intergenic
1005150211 6:22740459-22740481 TAACAAGTCAAGGCAAGGTGAGG - Intergenic
1005179682 6:23090577-23090599 AAACAAAAGTAAGCCAGGTGTGG - Intergenic
1005426748 6:25710768-25710790 TAAAAAGAAAAGGCCAGGTGCGG + Intergenic
1005684351 6:28238176-28238198 TCAATAGATCAGGCCAGGTGGGG - Intergenic
1005698669 6:28377419-28377441 TTGCAAAAGCAGGCCGGGTGTGG + Intergenic
1005751521 6:28887121-28887143 TAAAAGAAGCAGGCCAGGCGCGG + Intergenic
1005951117 6:30632016-30632038 AAATAAGATCAGGCCAGGGGTGG + Intronic
1006073285 6:31512355-31512377 AAAAGAGAACAGGCCAGGTGCGG - Intergenic
1006193958 6:32226174-32226196 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
1006210705 6:32392209-32392231 TAAACTGATCAGGCCAGGTGTGG + Intergenic
1006235923 6:32632046-32632068 TAATATGAGGAGGCCAGGCGCGG - Intronic
1006323204 6:33333180-33333202 GAACAAGATCAGGCCAGGCGCGG + Intergenic
1006531619 6:34660007-34660029 TAAGAAAACCAGGCCAGGTGTGG + Intronic
1006534944 6:34691502-34691524 TAACAAATAGAGGCCAGGTGCGG + Intronic
1006547189 6:34790031-34790053 AGACAAAAGGAGGCCAGGTGTGG - Intergenic
1006674580 6:35753124-35753146 TATCAAAAGTAAGCCAGGTGCGG - Intergenic
1006754061 6:36399435-36399457 AAGCAAGAGGGGGCCAGGTGCGG - Intronic
1006847429 6:37072313-37072335 TGCCATCAGCAGGCCAGGTGCGG + Intergenic
1006866098 6:37210118-37210140 TGACAAGAGCAGTCCCAGTGGGG + Intergenic
1007100462 6:39242717-39242739 TAAAAAAAGCAAGCCAGGTGCGG + Intergenic
1007287943 6:40761701-40761723 TAACAAGGATAGGGCAGGTGAGG + Intergenic
1007435707 6:41809199-41809221 TAAAGAGACTAGGCCAGGTGTGG - Intronic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1007702756 6:43774142-43774164 TAACCATAGCAGTCCAGGAGTGG + Intronic
1007882456 6:45182550-45182572 AAAGAAAGGCAGGCCAGGTGCGG - Intronic
1007898327 6:45385607-45385629 TCTTAAAAGCAGGCCAGGTGTGG + Intronic
1008299915 6:49823604-49823626 AAACAAGTGCTGGCCAGGTCTGG + Intergenic
1008367304 6:50697485-50697507 AAAGAAGATCAGGCCAGGCGTGG + Intergenic
1009350215 6:62666441-62666463 GAACAAGAGAAGGCCTGGTGCGG + Intergenic
1009416084 6:63418270-63418292 TAAAACAAACAGGCCAGGTGCGG + Intergenic
1009575694 6:65456160-65456182 TAAAAAGAACAGGCCGGGCGAGG + Intronic
1009830183 6:68920225-68920247 TAAAAAGCGGGGGCCAGGTGCGG + Intronic
1009887532 6:69641475-69641497 TCACAAGACCAGGTCAGCTGAGG + Intergenic
1009953039 6:70418610-70418632 TAAAATGACCAGGCCAGGTCAGG - Intronic
1009968579 6:70603369-70603391 AACAAATAGCAGGCCAGGTGCGG - Intergenic
1010170200 6:72966266-72966288 AAAGAAAAGCAGGCTAGGTGTGG + Intronic
1010208022 6:73340533-73340555 AAACAAGACCTGGGCAGGTGCGG + Intergenic
1010223031 6:73464029-73464051 TATAAACAACAGGCCAGGTGTGG - Intronic
1010519830 6:76818724-76818746 TGCCAAGGGCAAGCCAGGTGCGG - Intergenic
1010591045 6:77712679-77712701 CAACAAAAGGAGGCCGGGTGCGG + Intronic
1010976758 6:82324406-82324428 TATCAATATCAGGCCAGGTGCGG + Intergenic
1011054517 6:83191974-83191996 AAAAAAAAACAGGCCAGGTGAGG + Intronic
1011448726 6:87471110-87471132 AAGCTAGTGCAGGCCAGGTGTGG + Intronic
1012090551 6:94889015-94889037 TAACAAAAACAGGCCGGCTGTGG - Intergenic
1012282222 6:97342004-97342026 AAATAACTGCAGGCCAGGTGTGG + Intergenic
1012892532 6:104912884-104912906 TAAAAAGAAGAGGCCAGGTGTGG + Intergenic
1013082520 6:106824825-106824847 TTAAAAGAACAGGCCAGGTGTGG - Intergenic
1013085859 6:106857161-106857183 AAAAATGAGCTGGCCAGGTGCGG + Intergenic
1013229035 6:108144711-108144733 TAAAAATTCCAGGCCAGGTGCGG - Intronic
1013252018 6:108343988-108344010 AAACAAAAACAGGCCAGGTATGG + Intronic
1013389023 6:109664742-109664764 AAAGAAGATCAGGCCAGGTGCGG + Intronic
1013560915 6:111304008-111304030 TAAAAATATCTGGCCAGGTGTGG - Intronic
1013683894 6:112556181-112556203 TAATAATAGTAGGCCAGGCGTGG - Intergenic
1013764067 6:113553658-113553680 TAATATATGCAGGCCAGGTGCGG - Intergenic
1013800504 6:113936699-113936721 TAACAATAGCAAGCCAGGCGCGG + Exonic
1013802859 6:113967417-113967439 TATCAAGATTAGGCCAGGTGTGG - Intronic
1014095890 6:117461035-117461057 TAAAAACAGAAGGCCAGGCGTGG + Intronic
1014106853 6:117574788-117574810 AAAAAAGAGTAGGCCAGGTGCGG + Intronic
1014113124 6:117643606-117643628 TTAAAACATCAGGCCAGGTGCGG + Intergenic
1014214324 6:118738250-118738272 TAAGAACAGCTGTCCAGGTGTGG + Intergenic
1014245092 6:119059268-119059290 AAACAACAACTGGCCAGGTGTGG - Intronic
1014852395 6:126357895-126357917 TAAGAAGAACTGGCCAGGCGTGG - Intergenic
1015139934 6:129919578-129919600 TAAAATGAACAGGCCAGGTGTGG + Intergenic
1015206999 6:130651272-130651294 TAAAAACCACAGGCCAGGTGCGG + Intergenic
1015293374 6:131562996-131563018 TAAAATGAGTAGGCCGGGTGTGG + Intergenic
1015926549 6:138315559-138315581 TCACAAGTTCAGGCCAGGCGCGG + Intronic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016146188 6:140676888-140676910 AAAGTACAGCAGGCCAGGTGCGG - Intergenic
1016414864 6:143821701-143821723 AAGAAAGAGTAGGCCAGGTGTGG + Intronic
1016824393 6:148374985-148375007 AAACAAAAAAAGGCCAGGTGTGG - Intronic
1016882274 6:148922761-148922783 TAATAAAAGAAGGCCAGGTATGG - Intronic
1017114196 6:150961382-150961404 TAACTGGAAAAGGCCAGGTGTGG - Intronic
1017120155 6:151016609-151016631 GAACAAGCAGAGGCCAGGTGTGG - Intronic
1017162516 6:151379348-151379370 TAATAAAACCAGGCCAGGTGTGG + Intronic
1017334449 6:153238994-153239016 TAAGAAGTTCAGGCCAGGTGTGG + Intergenic
1017401739 6:154072139-154072161 TAACAAGAGCTGGGAAGGTATGG + Intronic
1017680687 6:156861308-156861330 AAACTAGACCAGGCCAGGCGTGG + Intronic
1017796558 6:157850082-157850104 AAACCAGAGGAGGGCAGGTGTGG + Intronic
1017898380 6:158700904-158700926 TAAATACAACAGGCCAGGTGCGG - Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1017953101 6:159154110-159154132 TAAAAAGAAAAGGCCAGGCGTGG - Intergenic
1017973411 6:159332772-159332794 CAACAACAACGGGCCAGGTGCGG + Intergenic
1018050169 6:160002098-160002120 TAAGAAAATCAGGCCGGGTGTGG + Intronic
1018627781 6:165796374-165796396 AAAGATGTGCAGGCCAGGTGCGG - Intronic
1018638854 6:165888572-165888594 GAAAAAAAGCAGGCCAGGTGCGG - Intronic
1018682981 6:166280261-166280283 GTACAAGAGCTGGCCGGGTGCGG - Intergenic
1018919723 6:168163133-168163155 AAAAACAAGCAGGCCAGGTGTGG - Intergenic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019394870 7:812428-812450 AAAAAAAAGAAGGCCAGGTGAGG + Intergenic
1019764042 7:2836631-2836653 TAACAAGAGAAGGCCAGGTGCGG + Intronic
1019939219 7:4276098-4276120 GAACAAAAGGAGGCCAGGCGCGG + Intergenic
1019979536 7:4611127-4611149 AATTAACAGCAGGCCAGGTGTGG + Intergenic
1020034028 7:4952965-4952987 AAACAAAAAAAGGCCAGGTGTGG - Intronic
1020037285 7:4972321-4972343 AAACAAAAACAGGCCAGGTGCGG + Intergenic
1020063495 7:5169959-5169981 GGTCAAGAGCAGGCCAGGTATGG + Intergenic
1020065979 7:5189016-5189038 TATAAATAGAAGGCCAGGTGTGG - Intergenic
1020078158 7:5272329-5272351 TAACAATGGCTGGCCAGGCGCGG + Intergenic
1020108933 7:5437075-5437097 CAACAGGTGCAGGCCAGGCGTGG + Intronic
1020207772 7:6132212-6132234 GAAAAAGAACGGGCCAGGTGTGG - Intronic
1020210698 7:6156029-6156051 ATACAAAAACAGGCCAGGTGAGG - Intronic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020244479 7:6420149-6420171 AAACAAAAACAGTCCAGGTGCGG + Intronic
1020258868 7:6519465-6519487 AAACCAAACCAGGCCAGGTGCGG + Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1020832431 7:13109363-13109385 TGCCAAGGGCAAGCCAGGTGTGG + Intergenic
1020895689 7:13936340-13936362 AAATAAAAGCAAGCCAGGTGTGG - Intronic
1021203465 7:17752660-17752682 TCAGAGGAGCAGGCCGGGTGCGG + Intergenic
1021228442 7:18056464-18056486 TAAAAAAAATAGGCCAGGTGTGG - Intergenic
1021449043 7:20764582-20764604 TTACATGTGTAGGCCAGGTGTGG - Intronic
1021543640 7:21788996-21789018 GAAAAATAACAGGCCAGGTGTGG + Intronic
1021941202 7:25680437-25680459 TCATAAGAGAAGCCCAGGTGTGG - Intergenic
1022011829 7:26314707-26314729 AAAAAAGAACAGGCCAGGCGTGG + Intronic
1022076783 7:26979147-26979169 TAACAAAAGCAGGCTGGGCGTGG - Intronic
1022398063 7:30008684-30008706 AAAAAAAAGCCGGCCAGGTGCGG + Intergenic
1022416722 7:30184699-30184721 TAACCAAAGCAGGCCAGATTTGG - Intergenic
1022513389 7:30958551-30958573 TTATCAGAGCAGGCCAGGCGCGG + Intronic
1022707132 7:32812625-32812647 TAACAAAAGCAGGCTTGGTGTGG + Intergenic
1022736373 7:33079953-33079975 AGACAAGAGCAGGGCAGGAGAGG - Intergenic
1022759487 7:33332387-33332409 TAAAAACAAGAGGCCAGGTGTGG + Intronic
1022915739 7:34950008-34950030 TAACAAAAGCAGGCTTGGTGTGG - Intronic
1023041856 7:36179568-36179590 TAAAAAAAAGAGGCCAGGTGTGG + Intronic
1023380339 7:39600685-39600707 TAAAAACAGCAGGCCAGGGGCGG - Intronic
1023438789 7:40165823-40165845 TAACAATTGCAGGCCAGGTGTGG + Intronic
1023533558 7:41183734-41183756 AAAGCAGAGCTGGCCAGGTGTGG - Intergenic
1023780597 7:43651704-43651726 AAAAAAAAACAGGCCAGGTGCGG + Intronic
1024277140 7:47687065-47687087 TTAAAAAACCAGGCCAGGTGTGG - Intergenic
1025066022 7:55856780-55856802 AAACAAGTGCAGGCCAGGTGTGG + Intronic
1025200737 7:56959843-56959865 TAACAATGGCTGGCCAGGCGCGG - Intergenic
1025203042 7:56973905-56973927 TACAAAAATCAGGCCAGGTGCGG - Intergenic
1025668902 7:63603021-63603043 TACAAAAATCAGGCCAGGTGCGG + Intergenic
1025671206 7:63617089-63617111 TAACAATGGCTGGCCAGGCGCGG + Intergenic
1025748910 7:64273980-64274002 TAGCAAGAATTGGCCAGGTGCGG + Intergenic
1025900823 7:65743310-65743332 TAAAAATAAAAGGCCAGGTGCGG + Intergenic
1026053975 7:66969132-66969154 AAAAAAGAAGAGGCCAGGTGTGG - Intergenic
1026092958 7:67316541-67316563 AAACAAAACCCGGCCAGGTGCGG + Intergenic
1026216810 7:68356838-68356860 TAAAAAGTGGAGGCCAGGAGCGG + Intergenic
1026240916 7:68574560-68574582 AAGCAAGAAAAGGCCAGGTGTGG - Intergenic
1026630556 7:72034061-72034083 TAGGAACAACAGGCCAGGTGCGG + Intronic
1026635250 7:72076306-72076328 AAAAAAAAGCAGGCCAGGTGCGG + Intronic
1026686586 7:72515320-72515342 TAAAACAAGCAGGCCGGGTGCGG - Intergenic
1026741027 7:72978635-72978657 AAACAATAACAGGCCGGGTGCGG - Intergenic
1026773735 7:73218305-73218327 AAGCAGGAACAGGCCAGGTGTGG + Intergenic
1026781041 7:73267673-73267695 AATCAAGCACAGGCCAGGTGTGG - Intergenic
1026800857 7:73398952-73398974 AAACAACAACAGGCCGGGTGCGG - Intergenic
1027014594 7:74771699-74771721 AAGCAGGAACAGGCCAGGTGCGG + Intergenic
1027021895 7:74821115-74821137 AATCAAGCACAGGCCAGGTGTGG - Intronic
1027066126 7:75124802-75124824 AATCAAGCACAGGCCAGGTGTGG + Intronic
1027073439 7:75174258-75174280 AAGCAGGAACAGGCCAGGTGTGG - Intergenic
1027102706 7:75386439-75386461 AAACAATAACAGGCCGGGTGCGG + Intergenic
1027175148 7:75898761-75898783 TAATAAGAATAGGCCTGGTGTGG - Intergenic
1027196911 7:76037072-76037094 TAAGAAGAGCTGGCCGGGTGCGG - Intronic
1027209121 7:76130100-76130122 TAACAAACACAGGCCGGGTGCGG + Intergenic
1027353838 7:77337858-77337880 AATCAAGGGCAGGCCAGGTGTGG + Intronic
1027383630 7:77638246-77638268 CAACAAGGTCAGGCCAGGCGCGG - Intronic
1027768163 7:82372892-82372914 ACACAATATCAGGCCAGGTGTGG + Intronic
1028035012 7:85971682-85971704 TGACAAGGGCAAGCCAGGTGTGG + Intergenic
1028397421 7:90386537-90386559 TAGCAAGTGCAGGCCAGGCATGG + Exonic
1028794823 7:94891255-94891277 TACCAAGACTAGGCCAGGCGCGG + Intergenic
1029130331 7:98325385-98325407 TAATAATTGGAGGCCAGGTGTGG + Intronic
1029281033 7:99435663-99435685 GAAAAAGAACAGGCCAGGGGCGG + Intronic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1029620276 7:101686098-101686120 TAATAAGAAAAAGCCAGGTGTGG - Intergenic
1029819996 7:103137658-103137680 TGAAAAGGTCAGGCCAGGTGTGG + Intronic
1029843130 7:103386915-103386937 TTACAAAAGCGAGCCAGGTGTGG - Intronic
1030001796 7:105072160-105072182 AAACAAGAGTTAGCCAGGTGTGG + Intronic
1030089409 7:105844073-105844095 TAAGAAGTGCAGGCCATTTGGGG - Intronic
1030288521 7:107849416-107849438 AAATAAAAGCAGGCCAGGTGCGG - Intergenic
1030424149 7:109351462-109351484 TAAAAAGTTTAGGCCAGGTGCGG + Intergenic
1031248768 7:119351480-119351502 TAACTAGTGTGGGCCAGGTGTGG - Intergenic
1031489132 7:122366312-122366334 TAATACGAGGCGGCCAGGTGTGG + Intronic
1031504077 7:122559478-122559500 TAAGAAGAGAGGGCCAGGTGCGG + Intronic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1032661845 7:133992571-133992593 TACAAAAATCAGGCCAGGTGCGG - Intronic
1033056814 7:138062754-138062776 TAAAGAAAGCAGACCAGGTGGGG - Intronic
1033100229 7:138463178-138463200 AAATAAGAACAGGCCAGGTGCGG - Intronic
1033332430 7:140427740-140427762 TAATAAAAAAAGGCCAGGTGCGG - Intergenic
1033709866 7:143931531-143931553 AAAAAAAAGAAGGCCAGGTGCGG - Intergenic
1034096080 7:148409110-148409132 GAACTAGAGCAGGCCAGCTCAGG + Intronic
1034121416 7:148631454-148631476 AAAGAAGAGGGGGCCAGGTGTGG + Intergenic
1034132635 7:148734532-148734554 CAAGAAAAACAGGCCAGGTGCGG - Intronic
1034179083 7:149124135-149124157 TAGCAAGGCCAGGCCAGGCGTGG - Intronic
1034327328 7:150248370-150248392 AAAAAAGAGTAGGCCGGGTGCGG + Intronic
1034463692 7:151213052-151213074 TTAAAAATGCAGGCCAGGTGCGG - Intronic
1034527394 7:151674131-151674153 TAAGAATACAAGGCCAGGTGCGG - Intronic
1034626792 7:152499609-152499631 TACCACAATCAGGCCAGGTGTGG - Intergenic
1034635911 7:152566974-152566996 TAACAACTGTAGGCCAGGCGAGG - Intergenic
1034765881 7:153721079-153721101 AAAAAAGAGTAGGCCGGGTGCGG - Intergenic
1035548324 8:500914-500936 GAACATGAGCAGGCCGGGCGCGG + Intronic
1035764541 8:2095580-2095602 GAATAAAAACAGGCCAGGTGCGG - Intronic
1035994410 8:4530201-4530223 TAACAATGGCAGGCCTGGCGCGG - Intronic
1036044109 8:5120406-5120428 TATCAAGAGCAAGCCACGGGAGG + Intergenic
1036147063 8:6263879-6263901 TAAAAAAAACTGGCCAGGTGCGG + Intergenic
1036556964 8:9868657-9868679 TAAATAGACCTGGCCAGGTGTGG + Intergenic
1036612569 8:10362865-10362887 GAACAAGAGCAGGAGAGCTGGGG - Intronic
1036755968 8:11471361-11471383 TCAGAAGAGCTGGGCAGGTGAGG + Intronic
1036762615 8:11520319-11520341 TTACAAGAACTAGCCAGGTGTGG + Intronic
1036970857 8:13353563-13353585 AAACAACAACAGGCCAGGCGCGG + Intronic
1036974097 8:13390695-13390717 TAAGAAAAACAGGCCAGGTGTGG + Intronic
1037093764 8:14956326-14956348 AAATAAAAGTAGGCCAGGTGTGG - Intronic
1037149261 8:15616285-15616307 TCAGAATATCAGGCCAGGTGTGG + Intronic
1037218570 8:16488250-16488272 TAAAAAACGCAGGCCAGGCGTGG + Intronic
1037314678 8:17589939-17589961 TAACAATTGCAGGCCGGGTGCGG + Intronic
1037591762 8:20318308-20318330 TGACAGGAAGAGGCCAGGTGTGG - Intergenic
1037964732 8:23125268-23125290 AAACAAGAGCCGGCCGGGCGCGG - Intergenic
1038290595 8:26246557-26246579 AATGAAGAGCTGGCCAGGTGTGG + Intergenic
1038423903 8:27452278-27452300 TGAGAATAGAAGGCCAGGTGTGG + Intronic
1038517737 8:28201721-28201743 AAATAAGAGGAGGCCAGGCGTGG - Intergenic
1038549034 8:28449611-28449633 CAAGAAGATCAGGCCAGGTGTGG - Intronic
1038765308 8:30422558-30422580 AAATAACAGCAGGCCAGGTGAGG - Intronic
1038993254 8:32892768-32892790 CAAAAACAGCAGGCCAGATGTGG - Intergenic
1038995336 8:32916683-32916705 AAACAACATAAGGCCAGGTGCGG - Intergenic
1039047037 8:33459903-33459925 TACCAAAATGAGGCCAGGTGTGG + Intronic
1039533254 8:38283811-38283833 TTAGAAAAACAGGCCAGGTGTGG + Intronic
1039559295 8:38499867-38499889 AAACAAAATCAGGCCAGGCGCGG - Intergenic
1039782877 8:40804548-40804570 TATTAAGACCAGGCCAGGAGCGG + Intronic
1039916286 8:41862717-41862739 AAACCACTGCAGGCCAGGTGCGG + Intronic
1039951609 8:42177244-42177266 AAACAAGAGTTGGTCAGGTGCGG - Intronic
1039956864 8:42214504-42214526 TAACAACACCAGGCCAGGTGAGG + Intergenic
1040492165 8:47934245-47934267 TAAAAAGCTAAGGCCAGGTGCGG + Intronic
1040889467 8:52301932-52301954 ACACGAGTGCAGGCCAGGTGAGG + Intronic
1041059849 8:54024729-54024751 TAGCTAAAACAGGCCAGGTGAGG - Intergenic
1041923889 8:63215599-63215621 TACCAGGATAAGGCCAGGTGTGG - Intergenic
1041965364 8:63669480-63669502 TGCCAAGTGCAAGCCAGGTGTGG + Intergenic
1042248963 8:66737117-66737139 TAAGAATATCGGGCCAGGTGTGG - Intronic
1042415797 8:68516928-68516950 TAAGAAAAGCAGGCAGGGTGTGG - Intronic
1042563256 8:70089535-70089557 TAAGATGAGCTGGCCGGGTGTGG - Intergenic
1042745896 8:72105173-72105195 TAAAAATTGTAGGCCAGGTGTGG - Intronic
1042768038 8:72347987-72348009 TAACAAAAAGAGGCCAGGTGTGG - Intergenic
1042911113 8:73827502-73827524 TACCATGCACAGGCCAGGTGCGG - Intronic
1043063858 8:75542008-75542030 TAAAAAGCTAAGGCCAGGTGTGG + Intronic
1043195676 8:77288517-77288539 TATCAAGGGCAAGCCAGGTGTGG - Intergenic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1043538487 8:81232469-81232491 AAATAAGATCTGGCCAGGTGCGG + Intergenic
1043663673 8:82780955-82780977 TAAAAAGCACAGGCCGGGTGTGG + Intergenic
1043707933 8:83377401-83377423 TGCCAAGCGCAAGCCAGGTGTGG + Intergenic
1043840589 8:85099034-85099056 GGACAGGATCAGGCCAGGTGTGG + Intergenic
1043967716 8:86497803-86497825 TACAAAAACCAGGCCAGGTGCGG + Intronic
1044544408 8:93443799-93443821 CAAGAAGTACAGGCCAGGTGCGG + Intergenic
1044657537 8:94564335-94564357 TAATAATAATAGGCCAGGTGTGG + Intergenic
1044979158 8:97697673-97697695 AAAAAAAATCAGGCCAGGTGCGG - Intronic
1045292763 8:100847997-100848019 TAAGAAGTCCTGGCCAGGTGCGG + Intergenic
1045400345 8:101809833-101809855 AAAAGAGAGCAGGCCAAGTGCGG - Intronic
1045499275 8:102732456-102732478 TTAAAAAAGTAGGCCAGGTGTGG + Intergenic
1046068293 8:109221758-109221780 GAACAAGACAGGGCCAGGTGCGG + Intergenic
1046081949 8:109379989-109380011 TAACAAGAGCAAGGCAGTTAGGG + Intronic
1046140515 8:110084114-110084136 TCCCAAGGGCAAGCCAGGTGTGG - Intergenic
1046493462 8:114983655-114983677 TAACAAGAGTAAATCAGGTGAGG + Intergenic
1046719492 8:117603227-117603249 TAAAAACAGCAGGCCAGTTTGGG + Intergenic
1046843558 8:118888834-118888856 AAAAAAGAATAGGCCAGGTGTGG + Intergenic
1046909501 8:119610610-119610632 AAAAAAAATCAGGCCAGGTGTGG + Intronic
1047323063 8:123807343-123807365 TAATAAGACCAGGCCAGGCATGG + Intronic
1047362931 8:124185395-124185417 TATCAAGGGGAGGACAGGTGGGG + Intergenic
1047482372 8:125296684-125296706 TTACCACAGCAGGCCGGGTGCGG - Intronic
1047725076 8:127677181-127677203 AAAACAGAGCAGGCCAGGTGCGG - Intergenic
1047897331 8:129381524-129381546 TAATCAGATTAGGCCAGGTGTGG + Intergenic
1048593691 8:135844807-135844829 TACAAAGAGCAGGACAGATGTGG + Intergenic
1048913833 8:139163309-139163331 TAAAAATACCATGCCAGGTGTGG - Intergenic
1049053688 8:140218667-140218689 TAACAGTGGGAGGCCAGGTGTGG + Intronic
1049888793 9:47857-47879 TAATAACAGGAGGCCGGGTGCGG + Intergenic
1049900709 9:161176-161198 TAACAAGTTCAGGCCGGGCGTGG + Intronic
1050097165 9:2078652-2078674 TTAAAAAAGGAGGCCAGGTGCGG + Intronic
1050182461 9:2935181-2935203 TGCCAAGGGCAAGCCAGGTGCGG - Intergenic
1050458283 9:5854815-5854837 TAATAAGACCAGGCCGGGTGTGG - Intergenic
1050488030 9:6155723-6155745 TAAGAAGAACAGGCTGGGTGTGG + Intergenic
1051154218 9:14122956-14122978 TAAGAAAAGCAGGCCAGGCATGG + Intronic
1051172417 9:14332040-14332062 AACCAAGAGGAAGCCAGGTGGGG + Intronic
1051465994 9:17378467-17378489 GAACAAAAGAAGGCCGGGTGCGG - Intronic
1051520539 9:17982322-17982344 GAATAAAACCAGGCCAGGTGTGG + Intergenic
1052500233 9:29279766-29279788 TAATAAGAGCAGTCTGGGTGTGG - Intergenic
1052906343 9:33837708-33837730 AAACAAGAACAGGCCAGGTGTGG - Intronic
1052936674 9:34099058-34099080 AAAAAAAAGCAGACCAGGTGTGG - Intronic
1053124404 9:35567980-35568002 TAAAAAATCCAGGCCAGGTGCGG - Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053205466 9:36182634-36182656 TAGAATGAGTAGGCCAGGTGTGG + Intergenic
1053248676 9:36556485-36556507 TAATAATAATAGGCCAGGTGTGG - Intergenic
1053347698 9:37389966-37389988 TAACAAGATTTGGCCGGGTGCGG + Intergenic
1053394427 9:37760033-37760055 TAAAAATAATAGGCCAGGTGCGG + Intronic
1053720614 9:40943278-40943300 GAGCAAAAGCAGGCCGGGTGTGG + Intergenic
1053743746 9:41171459-41171481 TAACAAGTTCAGGCCGGGCGTGG + Intronic
1054349023 9:64001276-64001298 TAACAAGTTCAGGCCGGGCGTGG + Intergenic
1054483524 9:65693845-65693867 TAACAAGTTCAGGCCGGGCGTGG - Intronic
1054894215 9:70289326-70289348 TCACTAAATCAGGCCAGGTGCGG - Intronic
1055529320 9:77168063-77168085 TAAGAAGACTAGGCCAGGTGTGG - Intergenic
1055789501 9:79907938-79907960 TAAAAAGACCAGGCCAGGTAAGG + Intergenic
1055816658 9:80213858-80213880 TGCCAAGGGCAAGCCAGGTGTGG - Intergenic
1056175090 9:84026709-84026731 TAATAAGACATGGCCAGGTGCGG - Intergenic
1056206923 9:84328344-84328366 AAACATGATCTGGCCAGGTGTGG + Intronic
1056249189 9:84730838-84730860 TAACAACAGCAGGTCAAGTTTGG + Intronic
1056300076 9:85231618-85231640 TAAGAAAAAGAGGCCAGGTGCGG + Intergenic
1056416039 9:86377033-86377055 TATCAAGGCCGGGCCAGGTGTGG - Intergenic
1056812317 9:89774388-89774410 TAACCAGAGCAGTCCATGTTAGG - Intergenic
1056984092 9:91345541-91345563 TACCCAGAGAAGGCCAGGCGTGG + Intronic
1057103742 9:92390972-92390994 CAGCAAAATCAGGCCAGGTGTGG + Intronic
1057117243 9:92537164-92537186 TAAGAATTTCAGGCCAGGTGCGG - Intronic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1057990992 9:99769454-99769476 AAACACTAGCTGGCCAGGTGTGG + Intergenic
1058060641 9:100492172-100492194 AAGAAAGAGGAGGCCAGGTGCGG - Intronic
1058555234 9:106159826-106159848 TAAGAAGACCAGGCCTGGCGCGG + Intergenic
1058678910 9:107424793-107424815 TAATAAAATCAGGCCGGGTGTGG - Intergenic
1058689305 9:107506003-107506025 TAAAATAAACAGGCCAGGTGCGG - Intergenic
1058715687 9:107720201-107720223 TCAGAATAGCAGGCCGGGTGCGG - Intergenic
1058770924 9:108230975-108230997 AAACAAGAACAGGCCAGGCACGG + Intergenic
1059279801 9:113122992-113123014 TAAGAAAAGCCGGCCAGGCGTGG + Intergenic
1059285837 9:113170847-113170869 TATCAAGGGCAGGCAAGCTGTGG + Intronic
1059309439 9:113377901-113377923 AAACAAAAAGAGGCCAGGTGCGG - Intergenic
1059807385 9:117817292-117817314 TAAAAACAGCAGGCCAGATTTGG - Intergenic
1060301600 9:122377480-122377502 TAGCAAGAGCAGGCCGGGGCGGG - Intronic
1060382361 9:123188348-123188370 TCTCAAGACTAGGCCAGGTGCGG + Intronic
1060569837 9:124628316-124628338 AATCAAAGGCAGGCCAGGTGCGG - Intronic
1060632761 9:125174617-125174639 TAACAAAAACAGGCCAGCCGTGG + Intronic
1060757022 9:126221412-126221434 TAAAAAGACAAAGCCAGGTGTGG - Intergenic
1060974560 9:127756920-127756942 AAACAAGAACAGGCCAGGCGTGG - Intronic
1061066577 9:128281782-128281804 AAACATCAGGAGGCCAGGTGCGG + Intronic
1061070594 9:128307904-128307926 AAACAAAAACAGGCCGGGTGTGG + Intergenic
1061122603 9:128653246-128653268 TACCAAGAGTAGCCCAGGTGAGG + Intronic
1061437254 9:130572346-130572368 TAACAAAATGAAGCCAGGTGTGG + Intergenic
1061476409 9:130870101-130870123 TAACAACAGCTGGCCGAGTGTGG - Intronic
1061482066 9:130902288-130902310 TGGCTGGAGCAGGCCAGGTGCGG - Intergenic
1061563343 9:131420771-131420793 AAGCAAGGGTAGGCCAGGTGTGG - Intronic
1061827057 9:133265044-133265066 TAAAAATAGAGGGCCAGGTGAGG - Intronic
1061857484 9:133450140-133450162 AAACAAGACGGGGCCAGGTGTGG + Intronic
1061863661 9:133480571-133480593 AAAAAAGAGAAGGCCGGGTGCGG - Intergenic
1062413494 9:136436402-136436424 TAGTAACAGCAGGCCAGGGGCGG + Intronic
1062575235 9:137203642-137203664 AAGCAAAAGCAGGCCAGGCGTGG - Intronic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1185635728 X:1550414-1550436 TAAAACCAGCAGGCCGGGTGCGG + Intergenic
1185781014 X:2846587-2846609 TAAAAAGAGTTAGCCAGGTGTGG + Intronic
1185861966 X:3588339-3588361 TAACCAATGAAGGCCAGGTGCGG + Intergenic
1186091752 X:6056183-6056205 AAACAAAAACAGGCCAGGGGTGG + Intronic
1186097106 X:6114108-6114130 TAACAGAAGTAGGCCGGGTGCGG - Intronic
1186100281 X:6148802-6148824 GAACCAGTGCAGGCCAGGCGCGG - Intronic
1186179729 X:6961107-6961129 CACCAAAAGTAGGCCAGGTGTGG + Intergenic
1186195197 X:7104117-7104139 TCACAAGAACAGCCAAGGTGTGG + Intronic
1186746381 X:12574288-12574310 TAACAATAATAGGCCAGGTGTGG - Intronic
1187018374 X:15353447-15353469 TTAAAGGAGCGGGCCAGGTGCGG + Intronic
1187019174 X:15362156-15362178 AAAGAAAATCAGGCCAGGTGTGG - Intronic
1187164310 X:16790490-16790512 TAAAAAGATCAGGCCAGGTGTGG - Intronic
1187347907 X:18483708-18483730 TAAGATGATGAGGCCAGGTGAGG - Intronic
1187415388 X:19088758-19088780 ATACAATATCAGGCCAGGTGTGG - Intronic
1187503655 X:19861084-19861106 TAAAAACAGCAGGCCAGGCGCGG + Intronic
1187656800 X:21484891-21484913 AAACAATAGCTGGCCAGGCGTGG + Intronic
1187949958 X:24462108-24462130 AAAAAAGATTAGGCCAGGTGCGG - Intergenic
1187985995 X:24811575-24811597 AAACAAGAGGGGGCCAGGCGCGG - Intronic
1188001301 X:24984948-24984970 TAAAAAGTGCAGGCCGGGTGCGG - Intronic
1188414249 X:29913149-29913171 TTCTGAGAGCAGGCCAGGTGAGG - Intronic
1188475674 X:30589023-30589045 TAACAAGTGCTGGCGAGGTGTGG - Intergenic
1188623400 X:32254330-32254352 AAAAAAGAATAGGCCAGGTGTGG - Intronic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1189129364 X:38482153-38482175 TATGAAGAGCATTCCAGGTGAGG + Intronic
1189393803 X:40602358-40602380 AAAGAAGAGGAGGCCGGGTGCGG + Intronic
1189441800 X:41043276-41043298 TAGAAAGAAGAGGCCAGGTGCGG + Intergenic
1190022342 X:46890655-46890677 AAACAAAAACAGGCCAGGTGTGG + Intronic
1190177888 X:48166750-48166772 TAAAAACTGAAGGCCAGGTGTGG - Intergenic
1190197014 X:48328537-48328559 TAAAAACTGAAGGCCAGGTGCGG - Intergenic
1190225738 X:48543523-48543545 TTCAAAAAGCAGGCCAGGTGCGG - Intronic
1190516702 X:51231319-51231341 TAACAATTGCAGGCCGGGTGTGG + Intergenic
1190658534 X:52634348-52634370 TAAAAACTGGAGGCCAGGTGCGG - Intergenic
1190663748 X:52678916-52678938 TAAAAACTGGAGGCCAGGTGCGG - Intronic
1190675675 X:52779506-52779528 TAAAAACTGGAGGCCAGGTGCGG + Intronic
1190710567 X:53065807-53065829 TAACAAATGCAGGCCAGGTGCGG + Intronic
1190823771 X:53998161-53998183 AAAGAAAGGCAGGCCAGGTGTGG + Intronic
1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG + Intergenic
1191881642 X:65848621-65848643 TAAGAAGAGCAGGGAGGGTGTGG + Intergenic
1192327067 X:70142040-70142062 AGAGAAGAGTAGGCCAGGTGTGG + Intronic
1192365038 X:70464663-70464685 TTAAAAAAGCAGGCCGGGTGTGG + Intronic
1192415160 X:70973176-70973198 TAAGAAGAGGAGGCCAGGCAGGG + Intergenic
1192443185 X:71190205-71190227 AAACAAAAACAGGCCAGGTGCGG - Intergenic
1192734088 X:73832042-73832064 TAACAACAGCTGGCCAGGCGTGG + Intergenic
1192745684 X:73936187-73936209 AAACAAAAGCTGGCCAGCTGCGG + Intergenic
1193074713 X:77343428-77343450 TAGCAACAACTGGCCAGGTGCGG - Intergenic
1193152014 X:78135241-78135263 TAAAATGAGTTGGCCAGGTGCGG - Intronic
1193235669 X:79104000-79104022 AAAAAAGCCCAGGCCAGGTGCGG - Intergenic
1193671222 X:84389274-84389296 TAACAAAAGAAAGCCAGGCGTGG - Intronic
1194277786 X:91908511-91908533 TAAAAAGTCAAGGCCAGGTGTGG + Intronic
1194751829 X:97693842-97693864 TAAGAAGAAAAGGCCAGGTGTGG - Intergenic
1195255988 X:103091693-103091715 TAAGAAGATTAGGCCAGGCGCGG + Intronic
1195640740 X:107172031-107172053 TAAAAAGATGAGGCCAGGTGTGG + Intronic
1195652877 X:107304129-107304151 AAAAAAGAGCAGGGTAGGTGGGG + Intergenic
1195778292 X:108432543-108432565 AAACAAGAGGAGGCCGGGTGCGG + Intronic
1196229439 X:113203954-113203976 TATAAAAAGCAGGCTAGGTGTGG - Intergenic
1196436310 X:115677807-115677829 AAACAAGAACAGGCCAGGCGCGG + Intergenic
1196651835 X:118175802-118175824 TAAGAAAAATAGGCCAGGTGTGG - Intergenic
1196853096 X:119957355-119957377 ATACAAAAACAGGCCAGGTGTGG - Intergenic
1197001831 X:121448913-121448935 TTAAAAGGGCAGGCCGGGTGCGG - Intergenic
1197427792 X:126319757-126319779 TAAGGAGGGCTGGCCAGGTGTGG + Intergenic
1198453894 X:136796018-136796040 AAGCAAGTGCAGGCCAGGTGTGG - Intergenic
1198498813 X:137222100-137222122 CAACAACAGCAAGCAAGGTGGGG + Intergenic
1199233785 X:145468258-145468280 AGACAAGCGCGGGCCAGGTGCGG + Intergenic
1199776986 X:151021037-151021059 GAAAAAAAGAAGGCCAGGTGAGG + Intergenic
1200764362 Y:7068009-7068031 AAACTAGAGCAGGCCAGGCGCGG + Intronic
1201255385 Y:12103228-12103250 TAATAGCAACAGGCCAGGTGCGG + Intergenic
1201381008 Y:13378982-13379004 TATTAAGACCAGGCCTGGTGGGG - Intronic