ID: 915497343

View in Genome Browser
Species Human (GRCh38)
Location 1:156291558-156291580
Sequence CCCGCTCGGCCTCCGACTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915497331_915497343 29 Left 915497331 1:156291506-156291528 CCGGAGCGCATGCTCACTGCCAC 0: 1
1: 0
2: 2
3: 14
4: 186
Right 915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG 0: 1
1: 0
2: 0
3: 6
4: 94
915497337_915497343 -3 Left 915497337 1:156291538-156291560 CCTGGACTACCCGGACCACGCCC 0: 1
1: 0
2: 1
3: 2
4: 79
Right 915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG 0: 1
1: 0
2: 0
3: 6
4: 94
915497334_915497343 7 Left 915497334 1:156291528-156291550 CCGAGAGCCGCCTGGACTACCCG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG 0: 1
1: 0
2: 0
3: 6
4: 94
915497336_915497343 0 Left 915497336 1:156291535-156291557 CCGCCTGGACTACCCGGACCACG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG 0: 1
1: 0
2: 0
3: 6
4: 94
915497333_915497343 10 Left 915497333 1:156291525-156291547 CCACCGAGAGCCGCCTGGACTAC 0: 1
1: 0
2: 0
3: 2
4: 86
Right 915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915497343 Original CRISPR CCCGCTCGGCCTCCGACTAC AGG Exonic
900155881 1:1203116-1203138 CCCGCCCAGCCTCCCACTCCAGG - Intergenic
901361319 1:8703264-8703286 CCCGCGCGGCCACCGCCTCCCGG - Intronic
901606177 1:10461155-10461177 CCCCCTCGGCCTCCCAGTGCTGG + Exonic
902835274 1:19043285-19043307 CCCTCTCGGCTTCCGACTGGGGG - Intergenic
910777916 1:90893966-90893988 CCCGCCCGGCCGCCGCCAACAGG + Intergenic
913301454 1:117374182-117374204 CCACCTCAGCCTCCGACTACAGG - Intronic
915106645 1:153538759-153538781 CCAGCTCAGCCTCCCACTAGCGG + Intronic
915497343 1:156291558-156291580 CCCGCTCGGCCTCCGACTACAGG + Exonic
916069035 1:161159491-161159513 CCCGCCCGGCCACCGGCCACCGG - Exonic
921498508 1:215870540-215870562 CCACCTCGGCCTCCCACTGCTGG + Intronic
922821347 1:228487686-228487708 CCCGCTCAGCCGCCGCCTTCTGG + Exonic
1064598523 10:16970325-16970347 CCGCCTCGGCCTCTGATTACAGG - Intronic
1068783140 10:60943593-60943615 CCCGCCCGGCCTCCCCATACTGG + Intronic
1075119343 10:119652248-119652270 CCCGCTCGGCCTCCGGGCCCGGG + Intronic
1077413668 11:2414757-2414779 CCGCCTCGGCCTCCGTCTCCAGG + Exonic
1077499472 11:2902661-2902683 CCCGCCCGGCCTCCAACTGGTGG - Exonic
1080540165 11:33257553-33257575 GCCGGTCGGCCTCCGGCTACTGG - Intronic
1083648134 11:64185090-64185112 CCTGCCCTGCCTCCGACTTCTGG + Intergenic
1084622875 11:70285432-70285454 CCATCTCGGCCTCCCATTACAGG - Intronic
1086453154 11:86936776-86936798 CCAGCTCAGCCTCCTACTACAGG - Intronic
1090327110 11:125898425-125898447 CCGCCTCGGCCTCCCATTACAGG - Intronic
1090972052 11:131652617-131652639 CCCGCTCTGCCTCTGTCCACAGG - Intronic
1100531484 12:95465728-95465750 CCACCTCGGCCTCCAAGTACTGG - Intergenic
1103563557 12:121804503-121804525 CCCGCTCGGCCACCGTCTCGGGG - Intronic
1106498733 13:30307243-30307265 CCCTCTCGGCCTCCCACTGCCGG - Intronic
1108396703 13:49997083-49997105 ACCGCCCGTCCTCCAACTACAGG - Exonic
1113369330 13:109708201-109708223 CCCGCTGGGCCTCAGGCTCCCGG - Intergenic
1113609925 13:111637179-111637201 CCCGCTCATCCTCCCACTAACGG + Intronic
1113783731 13:112991020-112991042 CCTGCTCGGCCTCCGCCACCTGG + Intronic
1114429998 14:22652713-22652735 CCGCCTCGGCCTCCCATTACAGG - Intergenic
1119106769 14:71932374-71932396 TCCGCTCGGCATCCGACAGCGGG + Intergenic
1127988807 15:64096073-64096095 CCCCCTCGGACTCCGGCTCCAGG - Exonic
1132163618 15:99565288-99565310 CCCGCCCGGCCCCGGACTCCGGG + Intergenic
1132920339 16:2386292-2386314 CCTGCTCGACCTGGGACTACAGG + Intergenic
1136395941 16:29992589-29992611 CCCTCTAGGCCTCTGGCTACAGG - Exonic
1137457552 16:48629700-48629722 CCGCCTCGGCCTCCCATTACAGG - Intergenic
1137658462 16:50182017-50182039 CCACCTCGGCCTCCTACTAAAGG - Intronic
1137785625 16:51135035-51135057 CCTGCTCGGCCTCCGGGTCCGGG - Intergenic
1140262247 16:73390476-73390498 CCCGCTAGGCCTCCAGCCACCGG - Intergenic
1142118065 16:88370727-88370749 ACAGCTCGGCCTCAGACTTCTGG - Intergenic
1142382100 16:89738743-89738765 CCCACTAGGCCTCAGACCACAGG + Intronic
1144579788 17:16451992-16452014 CCGCCTCGGCCTCCCATTACAGG + Intronic
1147720408 17:42536350-42536372 CCCGCACGGCCGCCGCCTCCCGG - Exonic
1150280714 17:63928416-63928438 CCCACTCTGCCTCCACCTACAGG - Intergenic
1160217393 18:76944531-76944553 CCGCCTCGGCCTGCGATTACAGG - Intronic
1160557465 18:79735508-79735530 CCCGCTCGGCCGATGACTAGCGG - Intronic
1165319446 19:35076320-35076342 CCCGCCCGGCCTCTGATTCCTGG - Intergenic
932313920 2:70767475-70767497 CCCGCTCGGCCGCCGCCCTCCGG - Intronic
932635719 2:73386156-73386178 TCCGCTCGCCCTCCGAGTAGCGG - Exonic
941761235 2:169246352-169246374 CTGTCTCGGCCTCCGATTACAGG + Intronic
942002347 2:171661095-171661117 CCGCCTCGGTCTCCCACTACAGG + Intergenic
942238363 2:173935119-173935141 CCGCCTCGGCCTCCAATTACAGG - Intronic
1168800656 20:642065-642087 CCCGCTGGGCCTCCCCCCACAGG - Intergenic
1171013589 20:21521804-21521826 CCCGCTCCGCCTTCTACTCCCGG + Intergenic
1172011060 20:31845751-31845773 GCTGCTCGGCTTCCCACTACTGG - Intergenic
1173205749 20:40991737-40991759 CCCTGTCTGCCTCCAACTACAGG + Intergenic
1182176240 22:28292433-28292455 CCACCTCGGCCTCCAACTCCTGG + Intronic
1183739602 22:39662499-39662521 CCCGCTCGGGCCCCGCCTCCTGG - Intronic
1184457983 22:44622153-44622175 CCCACTCGGCCACCCACTTCTGG - Intergenic
954383870 3:50234304-50234326 CCGCCTCGGCCTCCCAGTACTGG + Intronic
954387544 3:50252203-50252225 CCTGCACTGCCCCCGACTACAGG + Intronic
954661909 3:52230914-52230936 CCCGCTGGGCCTCAGGCTGCAGG + Exonic
955059276 3:55482302-55482324 CTCGCTCCGCCGCCGCCTACAGG - Intronic
961820978 3:129575511-129575533 CCCGCTCAGCCTCCAACTAAAGG - Exonic
967054809 3:185823294-185823316 CACGCTCGGGCTCCGCCTTCGGG + Intronic
968922951 4:3532114-3532136 CCCCCTCCGCCTCCGACCCCTGG + Intronic
978801326 4:112758147-112758169 CCGCCTCGGCCTCCGAGTGCTGG + Intergenic
987919607 5:24262635-24262657 CCCTCTCGGCCTGGGATTACAGG - Intergenic
989272163 5:39546232-39546254 CCATCTCGGCCTCCCAGTACTGG - Intergenic
991060902 5:62374680-62374702 CCACCTCGGCCTCGGATTACAGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1002046810 5:176546075-176546097 CCCGCTCTGCCTCAGACCATGGG - Intronic
1002417004 5:179125965-179125987 CCAGCTCGGGCTCCCACTAGAGG - Intronic
1002824554 6:761227-761249 CCCGGGTGGCCTCCGACCACAGG - Intergenic
1006369148 6:33633640-33633662 CCCGGCCTGCCTCCGACTGCCGG - Intronic
1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG + Intronic
1010795896 6:80115881-80115903 CCCCCTCGGCCTCCCAATGCTGG + Intronic
1013220843 6:108075569-108075591 CCCGCTCAACCTAGGACTACAGG - Intronic
1014755894 6:125301810-125301832 CCCGCTCGGCCGCGGCCTCCCGG + Intronic
1018729737 6:166639715-166639737 CCCGCTCTGCCTCTGCCCACTGG + Intronic
1018798117 6:167202843-167202865 CTCACTCGGCCTCCAAGTACAGG - Intergenic
1018814595 6:167321333-167321355 CTCACTCGGCCTCCAAGTACAGG + Intergenic
1020160601 7:5768318-5768340 CTGCCTCGGCCTCCCACTACTGG - Intronic
1033273123 7:139950681-139950703 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273132 7:139950705-139950727 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273141 7:139950729-139950751 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273150 7:139950753-139950775 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273159 7:139950777-139950799 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273176 7:139950825-139950847 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273185 7:139950849-139950871 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273193 7:139950873-139950895 CCCCCTCGCCCTCCATCTACAGG + Intronic
1033406418 7:141074161-141074183 CCCCCTCGGCCCCCGCCTACCGG - Intergenic
1039843444 8:41309334-41309356 CCCGCGCCGCCTCCGACCGCAGG - Exonic
1060543969 9:124449939-124449961 CCGGCTCTGCCTCCGGCCACTGG + Intergenic
1060559733 9:124533140-124533162 CCAGTTCGGCCTGGGACTACAGG - Intronic
1061976821 9:134072607-134072629 CCAGATTGGCCTCCAACTACTGG - Intergenic
1062718649 9:138023512-138023534 CCCGCTCGGCCGCCTCCTCCGGG - Exonic
1189960153 X:46316693-46316715 CCAGGTTGGCCTCAGACTACTGG + Intergenic
1190322617 X:49187572-49187594 CCTGCTCACCCTCCCACTACTGG - Intergenic
1192624582 X:72714234-72714256 CCCGCCCGGCCGCCGCCAACAGG + Intronic
1197199020 X:123732865-123732887 CCCCCTCAACCTCCCACTACAGG + Intronic