ID: 915504032

View in Genome Browser
Species Human (GRCh38)
Location 1:156340911-156340933
Sequence CACTTGAATCAAGGAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75732
Summary {0: 1, 1: 42, 2: 1459, 3: 16552, 4: 57678}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915504032_915504038 17 Left 915504032 1:156340911-156340933 CCTCTGTCTCCTTGATTCAAGTG 0: 1
1: 42
2: 1459
3: 16552
4: 57678
Right 915504038 1:156340951-156340973 ACCCAAGTAGCTGGGATTACAGG 0: 603
1: 51185
2: 147346
3: 249353
4: 527634
915504032_915504034 8 Left 915504032 1:156340911-156340933 CCTCTGTCTCCTTGATTCAAGTG 0: 1
1: 42
2: 1459
3: 16552
4: 57678
Right 915504034 1:156340942-156340964 GCCTCAGCCACCCAAGTAGCTGG 0: 779
1: 84172
2: 194756
3: 237153
4: 228716
915504032_915504036 9 Left 915504032 1:156340911-156340933 CCTCTGTCTCCTTGATTCAAGTG 0: 1
1: 42
2: 1459
3: 16552
4: 57678
Right 915504036 1:156340943-156340965 CCTCAGCCACCCAAGTAGCTGGG 0: 947
1: 96300
2: 207776
3: 248482
4: 261937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915504032 Original CRISPR CACTTGAATCAAGGAGACAG AGG (reversed) Intronic
Too many off-targets to display for this crispr