ID: 915504034

View in Genome Browser
Species Human (GRCh38)
Location 1:156340942-156340964
Sequence GCCTCAGCCACCCAAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745576
Summary {0: 779, 1: 84172, 2: 194756, 3: 237153, 4: 228716}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915504033_915504034 -1 Left 915504033 1:156340920-156340942 CCTTGATTCAAGTGATTCTTGTG 0: 1
1: 220
2: 3270
3: 18387
4: 93816
Right 915504034 1:156340942-156340964 GCCTCAGCCACCCAAGTAGCTGG 0: 779
1: 84172
2: 194756
3: 237153
4: 228716
915504031_915504034 11 Left 915504031 1:156340908-156340930 CCACCTCTGTCTCCTTGATTCAA 0: 1
1: 1
2: 43
3: 547
4: 1806
Right 915504034 1:156340942-156340964 GCCTCAGCCACCCAAGTAGCTGG 0: 779
1: 84172
2: 194756
3: 237153
4: 228716
915504032_915504034 8 Left 915504032 1:156340911-156340933 CCTCTGTCTCCTTGATTCAAGTG 0: 1
1: 42
2: 1459
3: 16552
4: 57678
Right 915504034 1:156340942-156340964 GCCTCAGCCACCCAAGTAGCTGG 0: 779
1: 84172
2: 194756
3: 237153
4: 228716
915504030_915504034 28 Left 915504030 1:156340891-156340913 CCTACTTAGGATCACTGCCACCT 0: 1
1: 0
2: 0
3: 16
4: 261
Right 915504034 1:156340942-156340964 GCCTCAGCCACCCAAGTAGCTGG 0: 779
1: 84172
2: 194756
3: 237153
4: 228716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915504034 Original CRISPR GCCTCAGCCACCCAAGTAGC TGG Intronic
Too many off-targets to display for this crispr