ID: 915504036

View in Genome Browser
Species Human (GRCh38)
Location 1:156340943-156340965
Sequence CCTCAGCCACCCAAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815442
Summary {0: 947, 1: 96300, 2: 207776, 3: 248482, 4: 261937}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915504032_915504036 9 Left 915504032 1:156340911-156340933 CCTCTGTCTCCTTGATTCAAGTG 0: 1
1: 42
2: 1459
3: 16552
4: 57678
Right 915504036 1:156340943-156340965 CCTCAGCCACCCAAGTAGCTGGG 0: 947
1: 96300
2: 207776
3: 248482
4: 261937
915504030_915504036 29 Left 915504030 1:156340891-156340913 CCTACTTAGGATCACTGCCACCT 0: 1
1: 0
2: 0
3: 16
4: 261
Right 915504036 1:156340943-156340965 CCTCAGCCACCCAAGTAGCTGGG 0: 947
1: 96300
2: 207776
3: 248482
4: 261937
915504031_915504036 12 Left 915504031 1:156340908-156340930 CCACCTCTGTCTCCTTGATTCAA 0: 1
1: 1
2: 43
3: 547
4: 1806
Right 915504036 1:156340943-156340965 CCTCAGCCACCCAAGTAGCTGGG 0: 947
1: 96300
2: 207776
3: 248482
4: 261937
915504033_915504036 0 Left 915504033 1:156340920-156340942 CCTTGATTCAAGTGATTCTTGTG 0: 1
1: 220
2: 3270
3: 18387
4: 93816
Right 915504036 1:156340943-156340965 CCTCAGCCACCCAAGTAGCTGGG 0: 947
1: 96300
2: 207776
3: 248482
4: 261937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915504036 Original CRISPR CCTCAGCCACCCAAGTAGCT GGG Intronic
Too many off-targets to display for this crispr