ID: 915504038

View in Genome Browser
Species Human (GRCh38)
Location 1:156340951-156340973
Sequence ACCCAAGTAGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976121
Summary {0: 603, 1: 51185, 2: 147346, 3: 249353, 4: 527634}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915504031_915504038 20 Left 915504031 1:156340908-156340930 CCACCTCTGTCTCCTTGATTCAA 0: 1
1: 1
2: 43
3: 547
4: 1806
Right 915504038 1:156340951-156340973 ACCCAAGTAGCTGGGATTACAGG 0: 603
1: 51185
2: 147346
3: 249353
4: 527634
915504032_915504038 17 Left 915504032 1:156340911-156340933 CCTCTGTCTCCTTGATTCAAGTG 0: 1
1: 42
2: 1459
3: 16552
4: 57678
Right 915504038 1:156340951-156340973 ACCCAAGTAGCTGGGATTACAGG 0: 603
1: 51185
2: 147346
3: 249353
4: 527634
915504033_915504038 8 Left 915504033 1:156340920-156340942 CCTTGATTCAAGTGATTCTTGTG 0: 1
1: 220
2: 3270
3: 18387
4: 93816
Right 915504038 1:156340951-156340973 ACCCAAGTAGCTGGGATTACAGG 0: 603
1: 51185
2: 147346
3: 249353
4: 527634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915504038 Original CRISPR ACCCAAGTAGCTGGGATTAC AGG Intronic
Too many off-targets to display for this crispr