ID: 915505433

View in Genome Browser
Species Human (GRCh38)
Location 1:156352971-156352993
Sequence TACTGGGATGGTGGTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915505433_915505440 19 Left 915505433 1:156352971-156352993 CCAGCAAAACCACCATCCCAGTA 0: 1
1: 0
2: 3
3: 13
4: 213
Right 915505440 1:156353013-156353035 TCTACAATTTTTCCAAAGACAGG 0: 1
1: 0
2: 1
3: 37
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915505433 Original CRISPR TACTGGGATGGTGGTTTTGC TGG (reversed) Intronic
902081657 1:13825116-13825138 TTCTGTGTTGGTGGTTTTGGTGG + Intergenic
904386337 1:30144785-30144807 TACTTGGCTTGTGGTTCTGCAGG + Intergenic
904713578 1:32449670-32449692 TACTGGGTGAGTGGTTTGGCAGG + Intergenic
913185435 1:116366517-116366539 TAATGGGATGGTGGTGATGGAGG - Intergenic
913476637 1:119244573-119244595 TTCTGGGTTGGTGGATTTCCCGG + Intergenic
915505433 1:156352971-156352993 TACTGGGATGGTGGTTTTGCTGG - Intronic
918171816 1:182004568-182004590 TTCTCGAATGCTGGTTTTGCTGG - Intergenic
918440211 1:184559398-184559420 TAATGGGCTCATGGTTTTGCAGG - Intronic
922827049 1:228529145-228529167 TCCTTGGATGGTGGCATTGCAGG + Intergenic
1063160993 10:3418644-3418666 GGCTGGGATGGTGTTCTTGCAGG - Intergenic
1063209466 10:3865987-3866009 TCCTGGGATGGCAGTTTTGCTGG + Intergenic
1065902484 10:30221178-30221200 TACTGGGAACATGGTTTTGCCGG + Intergenic
1066643616 10:37581851-37581873 TAATGGAATGATGGTTTGGCAGG - Intergenic
1070572156 10:77648396-77648418 TACAGTGATGTTGGTTTTCCAGG - Intergenic
1073377954 10:103053097-103053119 TACTTGAAAGATGGTTTTGCAGG + Intronic
1074949336 10:118314041-118314063 TACTGTGATGCTAGTTGTGCTGG - Intronic
1075084474 10:119405256-119405278 TACTGGGAAGGCCGTTGTGCAGG + Intronic
1075119366 10:119652318-119652340 AGCTTGGATGGTGGTTTTGGGGG + Intronic
1075759621 10:124846162-124846184 TAAGGGAATGGTGGTTTTGTAGG + Intergenic
1076600201 10:131652475-131652497 TGCTGGGAAGGTGGTTTGGTGGG + Intergenic
1077744854 11:4891208-4891230 TAATTGGATCGTGGTTCTGCAGG + Intronic
1077768979 11:5193913-5193935 TGCTGGGTTCGTGGTCTTGCTGG + Intergenic
1079646126 11:22865626-22865648 TTTTGAGATGGTGGTTTTTCTGG - Intergenic
1080214235 11:29823026-29823048 TACTGGACTGGTGGTTTGCCTGG + Intergenic
1080526952 11:33131891-33131913 TAATGGTATTGTGGTTTTACAGG + Intronic
1080926410 11:36761190-36761212 TAATTGGATGATGGTTCTGCAGG - Intergenic
1083546283 11:63551321-63551343 TGGTGGGCTGGTGGTCTTGCTGG - Intergenic
1084576037 11:69988600-69988622 GAGTGGGCTTGTGGTTTTGCAGG - Intergenic
1084978246 11:72814839-72814861 TCCTCGGGTGTTGGTTTTGCAGG + Intronic
1086140573 11:83494371-83494393 TCCTGGGATGGTGGTGGAGCTGG - Intronic
1086544595 11:87952606-87952628 TACTGTGATGTTGGATTTGTGGG - Intergenic
1087010479 11:93509447-93509469 TACTGGGATTGTGGGGTTGCTGG - Intronic
1088511702 11:110582239-110582261 TGCTGGGATAGGGGTTTTCCTGG - Intronic
1088883387 11:113989011-113989033 AAATTGGATGGTGGATTTGCAGG + Intronic
1088907219 11:114163803-114163825 AATTGGGATGGGGGATTTGCGGG - Intronic
1090600399 11:128363946-128363968 TACTGGGATGCTGGTATTTCAGG + Intergenic
1095103081 12:38202986-38203008 TACTGAGAGGGTGGCATTGCAGG - Intergenic
1097051342 12:56224943-56224965 TACTGGGGTGGCGGGTTCGCGGG + Intronic
1098255647 12:68612165-68612187 TAATTGGATTTTGGTTTTGCAGG + Intronic
1099208637 12:79758024-79758046 TAATTGGATGGTGGAATTGCAGG - Intergenic
1100218872 12:92482367-92482389 TGCTGTGATGGTGGTCTTGCTGG - Intergenic
1101899432 12:108780277-108780299 TACAGTGGAGGTGGTTTTGCTGG - Intergenic
1102001036 12:109558320-109558342 TTCTGGGAGGGGGGTTTCGCCGG - Intronic
1102844834 12:116169204-116169226 TACTGGAATGGTGGTAATACAGG + Intronic
1103929478 12:124441855-124441877 GACTGGGATGGTGGGTTTTGGGG - Intronic
1105470962 13:20694331-20694353 AACTGGGATGGAGGTTTTAAGGG + Intergenic
1106718157 13:32412733-32412755 TAATGGTATTGTGGTTATGCAGG - Intronic
1107115153 13:36739041-36739063 TACTGGGATGCTTGTTTAGAAGG + Intergenic
1107161893 13:37239989-37240011 TATTTGGATCATGGTTTTGCAGG + Intergenic
1108864334 13:54904800-54904822 TACTAGGCTGATGGTTTTCCAGG - Intergenic
1110060185 13:71030604-71030626 TAGTGGAATCATGGTTTTGCAGG - Intergenic
1110369031 13:74719403-74719425 CAGTGGGCTCGTGGTTTTGCTGG - Intergenic
1110571761 13:77012093-77012115 GGCTGGGATGGAGGTTTTGGGGG + Intronic
1111627684 13:90810528-90810550 TATTGGGATGGTGGTAGTGGTGG - Intergenic
1111714800 13:91866640-91866662 TATTTGGCTGATGGTTTTGCAGG - Intronic
1113100614 13:106713584-106713606 TAGTGTGATAGTGGTTTTACTGG + Intergenic
1113143641 13:107183157-107183179 GACTGGAATTGTGGATTTGCTGG + Intronic
1114678099 14:24459019-24459041 GAGTGGGATGGGGGATTTGCTGG + Intergenic
1114724433 14:24920620-24920642 TACTGGGGTGGAGGCCTTGCTGG - Intronic
1115491757 14:33964898-33964920 TGCTGGGAGGGTGGTGTTCCTGG - Intronic
1116029038 14:39549006-39549028 TACATGGAAGGTGGTATTGCAGG - Intergenic
1116307806 14:43281156-43281178 TTCTGGGAAGGTGTGTTTGCTGG + Intergenic
1116961294 14:50970772-50970794 TAGTGGCATGGAGGTTTGGCTGG + Intergenic
1117197825 14:53359091-53359113 TGCTGGGATGATGGTTTTCATGG + Intergenic
1118658592 14:67981876-67981898 AACTGTGATGATAGTTTTGCAGG + Intronic
1119027918 14:71168423-71168445 TGGTGGGTTCGTGGTTTTGCTGG - Intergenic
1122886866 14:104714088-104714110 TTCTGGGGAGGAGGTTTTGCAGG + Intronic
1123945023 15:25234804-25234826 TACTGGGATGATGGTGGTCCAGG + Intergenic
1124898477 15:33799498-33799520 TACTGGGAAGGTGGTGTGCCTGG + Intronic
1127720896 15:61698264-61698286 TACTGGGCTGGAGGTCCTGCAGG - Intergenic
1128801883 15:70502242-70502264 TGGTGGAGTGGTGGTTTTGCAGG - Intergenic
1129550894 15:76447968-76447990 TGCTGGGATGGTGGTGATGTTGG + Intronic
1131647919 15:94365760-94365782 CTTTGGGATGGTGGTTTTGTTGG - Intronic
1132251004 15:100335318-100335340 TTGTGGGGTGGTGGTTTTACGGG - Intronic
1134126610 16:11620495-11620517 TACTGGGCTCATGGTTCTGCAGG - Intronic
1135618733 16:23934708-23934730 TACTGGGATGGTGGTGATGGGGG + Intronic
1136997289 16:35199093-35199115 TGCAGGGGTGGTGTTTTTGCAGG - Intergenic
1138492678 16:57385369-57385391 CCCTGGGATGGTGGTTCGGCAGG - Intergenic
1140640223 16:76963311-76963333 AAGTGGCATGGTGGTTTTCCAGG - Intergenic
1140912567 16:79467412-79467434 TACTGTGCTGGGTGTTTTGCAGG + Intergenic
1145863334 17:28225539-28225561 TACTGGGCAGGTGGGTTTGAGGG + Intergenic
1145981786 17:29016963-29016985 TGCTGGGATCCTTGTTTTGCTGG + Intronic
1146136473 17:30325666-30325688 TACGGTGGTGGTGGTTTTGAGGG + Intronic
1149185530 17:53992773-53992795 AAGTGGAATGGTGGTTTTGTGGG - Intergenic
1152026262 17:77811398-77811420 CATTGGGCTGATGGTTTTGCAGG - Intergenic
1152048057 17:77951594-77951616 TACTGGGCAGATGGTTTTGGGGG - Intergenic
1153307354 18:3644205-3644227 TCCTGTGATGTTCGTTTTGCAGG - Intronic
1153543042 18:6177516-6177538 GACTGGGATGGTGGCTATGCAGG + Intronic
1156657954 18:39309952-39309974 TAGTGGGTTCGTGGTCTTGCTGG - Intergenic
1157399076 18:47371741-47371763 TACTGGGATTATGGTTTTTTTGG + Intergenic
1157777899 18:50410681-50410703 TAATGGCATTGTGGTTATGCAGG + Intergenic
1158860990 18:61592216-61592238 TACTTGGCTCATGGTTTTGCAGG - Intergenic
1159682014 18:71366777-71366799 GACTGTGATGTTGGTTTTGAGGG + Intergenic
1160363251 18:78302402-78302424 TACTGGGATGGGGTGTGTGCTGG + Intergenic
1160627007 18:80217578-80217600 TACTGGGATTATGGGTTTGGGGG - Intronic
1161096256 19:2393298-2393320 TGGTGGGTTTGTGGTTTTGCTGG - Intronic
1163658070 19:18559382-18559404 TAGAGGGAAGGGGGTTTTGCTGG + Exonic
1165049309 19:33131669-33131691 GGCTGGGGTGCTGGTTTTGCTGG + Intergenic
927495823 2:23550965-23550987 GACTGGGATCGTGTGTTTGCAGG + Intronic
928690949 2:33797995-33798017 TAGTGGGTTCGTGGTCTTGCTGG - Intergenic
928722899 2:34141075-34141097 TACTGGGATGTTGGATTTGGGGG - Intergenic
929570050 2:43017090-43017112 TGTTTGGGTGGTGGTTTTGCAGG - Intergenic
932490517 2:72117110-72117132 TACTTGGCTCATGGTTTTGCAGG + Intergenic
935188331 2:100754941-100754963 AAATGGGATGGTGGCTTTGATGG - Intergenic
936040101 2:109143033-109143055 CACTGGGATGCTGGTATTCCTGG + Intronic
937016326 2:118609365-118609387 TACTGGGATGGCAGGATTGCTGG - Intergenic
941820030 2:169835396-169835418 TATTGGTATTGTGGTTTTGGGGG - Intronic
1170334185 20:15249849-15249871 TAATGGGATGGTGGTCCTGTTGG - Intronic
1170967442 20:21087510-21087532 AACTGGGATGATGTTTTTGGAGG - Intergenic
1171380392 20:24729981-24730003 TATTGGGGTGGTGGCTATGCGGG + Intergenic
1171380404 20:24730028-24730050 TATTGGGGTGGTGGCTATGCGGG + Intergenic
1171380452 20:24730213-24730235 TATTGGGGTGGTGGCTATGCGGG + Intergenic
1171391747 20:24805935-24805957 TTCTGGGCTGGTGGTTCTGGAGG - Intergenic
1171877941 20:30595862-30595884 TGCTGGCATGGTGGTGTTGGTGG - Intergenic
1174680921 20:52407373-52407395 TACTGGGATTGGGGTTTTCTGGG + Intergenic
1175059863 20:56232120-56232142 TACCTGGATGGTGGTTTTGGAGG + Intergenic
1175766905 20:61598390-61598412 TCCTGGGCTGGGGGTTTTGGGGG - Intronic
1177247939 21:18554260-18554282 TTCTGGGATGATGGATATGCTGG - Intergenic
1178781599 21:35608573-35608595 GACTGGTATGGTGATTGTGCAGG + Intronic
1180194522 21:46184714-46184736 CACTGGGATGGTGGTGGTGGTGG - Intergenic
1180237400 21:46471434-46471456 TACTGGGATGCTGATAATGCGGG - Intronic
1181106675 22:20579715-20579737 TGCTGGGGTGGTGGTGTTGCTGG + Intronic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
1182902736 22:33911931-33911953 TACTGGGGTGGAGGTGATGCGGG - Intronic
1184414987 22:44347001-44347023 TTCTGGGATGGTGGCTGTGGCGG - Intergenic
950149985 3:10679469-10679491 GACTGGGATGGTGGGTGTGATGG - Intronic
950342586 3:12260585-12260607 GACTGGGGTTGTGGGTTTGCGGG - Intergenic
950893194 3:16423283-16423305 TGCAGGGATGGGGGGTTTGCTGG + Intronic
951196154 3:19826040-19826062 TACCTGGGTGGTGGTTATGCAGG - Intergenic
951551744 3:23881971-23881993 TGGTGGGTTCGTGGTTTTGCTGG + Intronic
951829201 3:26905417-26905439 CACTGGGAGGGTGGGTATGCTGG - Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
954204879 3:49051197-49051219 TACAAGGAGGGTGGTATTGCTGG - Intronic
955325628 3:58007919-58007941 TACTGGGCTGTTGGTTATGGTGG + Intergenic
959040596 3:101418913-101418935 TACTAGCATCGTTGTTTTGCTGG - Intronic
960962623 3:123082980-123083002 AAGTGGGATGGTGGTTTGTCTGG + Intronic
962040798 3:131705645-131705667 TCCTAGGATGGTGCTTTTGTAGG - Intronic
962938806 3:140106654-140106676 GCCTGGAATGGTGGTTTTGAGGG - Intronic
963988369 3:151624316-151624338 TGCTGGGATGCTGGTATTACAGG + Intergenic
965208036 3:165747190-165747212 GATTGGGATGGTGGTTTTGCAGG + Intergenic
965678553 3:171226100-171226122 TACTGGAATGGTCGATTAGCAGG - Intronic
966098020 3:176229306-176229328 TAGTTGGCTCGTGGTTTTGCAGG - Intergenic
967498980 3:190176314-190176336 TGGTGGGTTCGTGGTTTTGCTGG + Intergenic
967617950 3:191595917-191595939 TATTGTGATGGTGGTTTTATGGG - Intergenic
968716308 4:2162248-2162270 CAGTGGGCTGGTGGTCTTGCTGG - Intronic
971109641 4:23570634-23570656 TTCTGGCATGGTTGGTTTGCTGG + Intergenic
972404443 4:38733194-38733216 TGGTGGGATGGTGGTGTTGGTGG + Intergenic
973614404 4:52664248-52664270 TACTTGGCTTGTGGTTCTGCAGG - Intergenic
974726357 4:65803931-65803953 AACTGGGATGGGGTTTTTTCGGG + Intergenic
976198345 4:82555747-82555769 TACTGGGATGTAGGTACTGCGGG + Intronic
976401813 4:84615483-84615505 TACTAGGAGGGTGGAGTTGCTGG - Intronic
976844375 4:89471140-89471162 ATCTGTGATGGTGGTTTTGGAGG + Intergenic
977067070 4:92332182-92332204 TACTTGGATCATGGTTTTGGTGG + Intronic
977657453 4:99538180-99538202 GACTGAGTTGATGGTTTTGCTGG - Intronic
978035301 4:103985710-103985732 TACTGTGATGGTGAATTTGATGG - Intergenic
978359575 4:107915658-107915680 CACTGGCATGCTGATTTTGCTGG + Intergenic
979735158 4:124073554-124073576 TCCTTGGATGGAGGTTTTGTGGG - Intergenic
980383868 4:132062047-132062069 TGCTGGGTTCATGGTTTTGCTGG + Intergenic
981696722 4:147566241-147566263 TACTGGATTGATAGTTTTGCTGG + Intergenic
981714083 4:147735495-147735517 GGCTGGAATGGTGGTTTTTCAGG + Intronic
982539466 4:156650298-156650320 TACTTGGATGGGGTTTTTGTGGG - Intergenic
983272937 4:165584495-165584517 TTCTGTGATGGTGTTTTTCCTGG - Intergenic
983488660 4:168362097-168362119 TGCAGGCATGGTGGTTTTTCTGG - Intronic
986560195 5:9053185-9053207 TTCTGGGATGGTGGTGGTGGTGG + Intronic
986626358 5:9726586-9726608 TGGTGGGTTGGTGGTTTCGCTGG - Intergenic
986672830 5:10158238-10158260 TATTTGGCTGGTGGTTCTGCAGG + Intergenic
986916241 5:12624209-12624231 TAGTGGGATCATGGTTTTTCAGG - Intergenic
993003719 5:82408513-82408535 TTCTGGGGTGGTGGATATGCAGG - Intergenic
993225749 5:85165910-85165932 CAGTGGGAGGGTGGTTGTGCTGG + Intergenic
993752343 5:91686384-91686406 TACTGGGATGGTGTTTTTTCAGG + Intergenic
994931572 5:106193811-106193833 AACTGAAATGATGGTTTTGCTGG + Intergenic
995894426 5:116995869-116995891 TATTGTGGTGATGGTTTTGCAGG - Intergenic
996758826 5:126966253-126966275 TATTGGGATGATGGTTACGCAGG + Intronic
999703766 5:154252422-154252444 TACTTGAAAGTTGGTTTTGCTGG + Intronic
1002380635 5:178825806-178825828 CACTGGGTTCGTGTTTTTGCAGG + Intergenic
1003055223 6:2812272-2812294 TACTGGTATGTTGGTATGGCTGG + Intergenic
1003896866 6:10616228-10616250 CAGTGGGTTCGTGGTTTTGCTGG + Intronic
1004606696 6:17201477-17201499 TACTGGGTTTGTGGTCTTGCAGG - Intergenic
1005372207 6:25145533-25145555 GACTGGGATTATGGGTTTGCAGG - Intergenic
1005869460 6:29963697-29963719 TAGTGGGATTGTGGGATTGCTGG - Intergenic
1005938906 6:30546266-30546288 CACGGAGCTGGTGGTTTTGCAGG - Exonic
1006226937 6:32547398-32547420 TAGTGGGCTCGTGGTCTTGCTGG + Intergenic
1007018822 6:38498085-38498107 CACTTGGATGTTGGTTGTGCTGG - Intronic
1009739427 6:67724135-67724157 TAGTGGGTTTGTGGTCTTGCTGG - Intergenic
1011143135 6:84182612-84182634 TCCTGGGTTGATGGTTTGGCTGG + Intronic
1011495210 6:87930651-87930673 TTTTGGGATGATGGTTTTGATGG + Intergenic
1012496366 6:99837715-99837737 TACTGTGATGATGGTTTAGTTGG - Intergenic
1012844108 6:104368008-104368030 TAGTGAAATGGTGTTTTTGCTGG + Intergenic
1013062780 6:106653391-106653413 TTGTGGGATTGTGGTTTTGGTGG - Intronic
1013263349 6:108469265-108469287 TCCTGGGATAGAAGTTTTGCTGG + Intronic
1017422256 6:154284585-154284607 TATTGACATGGTGGTGTTGCAGG + Intronic
1019393251 7:801904-801926 TTCTGGGCTGCTGGTTTTCCTGG + Intergenic
1019824573 7:3273148-3273170 AACTGGGATGGTTGATTGGCAGG - Intergenic
1020633675 7:10671561-10671583 TCCTTGGATGGGGTTTTTGCAGG + Intergenic
1020671278 7:11116357-11116379 TACTGGGATATTGCTTTTCCCGG + Intronic
1022782954 7:33604408-33604430 TTCTGGGACGGTGGTTGTGGTGG - Intronic
1023673959 7:42610840-42610862 TACTTGGATGCTGGGTTTTCAGG + Intergenic
1027829140 7:83155400-83155422 TGCTGGGTTGGAGGCTTTGCTGG + Exonic
1030946640 7:115731044-115731066 TTCTGTTATGGTGGTTTTGATGG + Intergenic
1031907909 7:127481059-127481081 TCCTGGGCTGGTAGTTTTCCGGG + Intergenic
1032253450 7:130277895-130277917 AACTGGGATGCAGGTTTTGGAGG + Exonic
1034094122 7:148390581-148390603 TACCAGGATGTTTGTTTTGCAGG + Intronic
1035353085 7:158260315-158260337 TGCTGAGAAGGTGTTTTTGCAGG - Intronic
1035999419 8:4584075-4584097 TAGTGGGTTCGTGGTCTTGCTGG - Intronic
1037503279 8:19505777-19505799 TTCCCGGGTGGTGGTTTTGCTGG - Exonic
1039927296 8:41946867-41946889 TCCTGGGATGGTTGCTTTGTGGG - Intronic
1041309160 8:56496723-56496745 TAGTGAGATGGTGGTTATGAGGG - Intergenic
1041596668 8:59662558-59662580 TAATGAGAATGTGGTTTTGCAGG - Intergenic
1045476965 8:102561345-102561367 CAGTGGGATTGTGGTTTTACTGG + Intergenic
1047989626 8:130272472-130272494 TAGTGGGATAGTGGAATTGCTGG - Intronic
1048644556 8:136405100-136405122 TAGTGGGATTGTGGGATTGCTGG - Intergenic
1049814191 8:144590558-144590580 TAATTGGCTGGTGGTTCTGCAGG - Intronic
1050807379 9:9698260-9698282 TTCTGGGTTGGTGTTTTTACTGG + Intronic
1056264575 9:84883438-84883460 CACAGGGATTGTGGTTTTGAGGG + Intronic
1056334327 9:85551169-85551191 TAATTGGCTGGTGGTTCTGCAGG - Intronic
1059152340 9:111960272-111960294 TTCTGGGATGGGGGGTTGGCAGG + Intergenic
1059390688 9:113997946-113997968 TCCTTGGAGGGTGATTTTGCTGG + Intronic
1062063363 9:134511648-134511670 CACTGGGACTGTGGGTTTGCCGG + Intergenic
1186445295 X:9622305-9622327 AAGTGGGATGGTGGTTTTCCGGG - Intronic
1186802660 X:13109242-13109264 TACTTGGCTGATGGTTCTGCAGG - Intergenic
1186803282 X:13114761-13114783 TATTGGGCTCATGGTTTTGCAGG + Intergenic
1189368627 X:40410122-40410144 AAATGGTATTGTGGTTTTGCAGG - Intergenic
1190875135 X:54454904-54454926 TAATGTTATGGTGGTTATGCAGG - Intronic
1191783817 X:64896277-64896299 TTCTGGGATGGTGGTTTTGATGG - Intergenic
1193067504 X:77275370-77275392 TAGTGGCAGGGTGGTTGTGCTGG - Intergenic
1194807485 X:98347423-98347445 GGATGGGATGGTGGTTTTGGTGG + Intergenic
1197502316 X:127256708-127256730 TTCTGGGATGGTGGTTATTCAGG - Intergenic
1198146192 X:133859828-133859850 TATTTGGATAGTGGTTCTGCAGG + Intronic
1202334283 Y:23790545-23790567 TACAGGCATGGTGGTTTTTATGG - Intergenic
1202536485 Y:25879514-25879536 TACAGGCATGGTGGTTTTTATGG + Intergenic