ID: 915506051

View in Genome Browser
Species Human (GRCh38)
Location 1:156357135-156357157
Sequence CCGGCAGAGAGTGCCGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915506041_915506051 12 Left 915506041 1:156357100-156357122 CCGCTAGGTGGCGGGCTGGCTCA 0: 1
1: 0
2: 0
3: 6
4: 87
Right 915506051 1:156357135-156357157 CCGGCAGAGAGTGCCGGAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 149
915506040_915506051 15 Left 915506040 1:156357097-156357119 CCGCCGCTAGGTGGCGGGCTGGC 0: 1
1: 0
2: 1
3: 6
4: 66
Right 915506051 1:156357135-156357157 CCGGCAGAGAGTGCCGGAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915506051 Original CRISPR CCGGCAGAGAGTGCCGGAGG GGG Intronic
900123755 1:1060423-1060445 CCGGCAGGGAGCGCCGAGGGGGG + Intergenic
900479498 1:2891252-2891274 GAGGCAGAGAGTGCCTGAGGAGG + Intergenic
903365273 1:22802100-22802122 CAGGCAGAGAGTGGAGGAGGGGG + Intronic
904264752 1:29311783-29311805 CCTGCAGAGGGTGCCTGAGCAGG + Intronic
905867125 1:41382426-41382448 CCGGCAGAGCGTCCAGCAGGAGG - Exonic
906209058 1:44002261-44002283 GCTGCAGAGAGTGCAGGAAGGGG + Intronic
909443613 1:75724461-75724483 CCCACAGAGAGGGCCAGAGGTGG + Intronic
909477403 1:76096032-76096054 CAGGCAGAGATTGCAGGAGCTGG + Intronic
913450216 1:118987957-118987979 CCGGCAGAGGAGGGCGGAGGAGG - Intronic
913476905 1:119246378-119246400 GCAGCAGAGAGTGGGGGAGGAGG + Intergenic
915462845 1:156080435-156080457 CCGGCTGGGAGTGCGGGAGGAGG - Intronic
915506051 1:156357135-156357157 CCGGCAGAGAGTGCCGGAGGGGG + Intronic
1062805501 10:416770-416792 CCTGCAGCGTGTGCCTGAGGAGG - Intronic
1063005162 10:1963562-1963584 CCGGCAGAGAGCGCGGAGGGAGG - Intergenic
1064671031 10:17713961-17713983 GCGGCAGAGGGGGCCGCAGGGGG - Intronic
1067054708 10:43043922-43043944 CCGGCAGGGAGAGCCAGGGGTGG - Intergenic
1070682027 10:78455425-78455447 CAGGCAGACAGTGCCAGAAGTGG - Intergenic
1070822883 10:79373006-79373028 CCCTCAGAGAGCGCCAGAGGAGG + Intergenic
1077138496 11:1013223-1013245 CCAGCAGAGAGGGACTGAGGCGG - Exonic
1078091804 11:8268619-8268641 CGGGCAGGGAGCGCAGGAGGAGG + Intronic
1078164554 11:8871035-8871057 CCTGCAGAGAGGGCGGGCGGCGG + Intronic
1082944499 11:58743250-58743272 ACAGCAGAGAGTGACAGAGGTGG + Intergenic
1083553726 11:63609640-63609662 CGGGCAGAGAGAGAAGGAGGAGG + Intronic
1083742097 11:64716503-64716525 GCGGCTGAGAGTCCAGGAGGTGG + Intronic
1084444524 11:69196033-69196055 CCGGCAGAGGGTGAGCGAGGAGG + Intergenic
1085520654 11:77137352-77137374 ACGGCAGAGAGTGGGGGCGGGGG - Intronic
1089018738 11:115189116-115189138 CCTGCAGGGAGTGGGGGAGGGGG + Intronic
1090807595 11:130212072-130212094 CCCGCAGAGAGTCCCGGAAAGGG - Intergenic
1091286728 11:134412190-134412212 CCGGCGCAGAGTCCCCGAGGTGG + Intergenic
1096670849 12:53197529-53197551 CCAGCAGAGCGTGCCCGAGCTGG + Exonic
1097925495 12:65121886-65121908 CCTTCAGTGAGCGCCGGAGGAGG - Intergenic
1100632059 12:96399676-96399698 GCGGCAGCGAGCACCGGAGGCGG + Intronic
1101680096 12:106956114-106956136 ACGGCAGAGGGCGACGGAGGAGG - Intronic
1104366865 12:128185982-128186004 AAGGCAGAGAGAGCGGGAGGAGG - Intergenic
1105058983 12:133130376-133130398 CCGGCACAGAGTGGCGGCTGCGG + Exonic
1106416373 13:29549343-29549365 CCGCATGAGAGTGCCAGAGGGGG + Intronic
1109215602 13:59586172-59586194 CTGGCAGAGAGTGGCAGAGCTGG - Intergenic
1112402050 13:99086243-99086265 GCGGCAGAGCGTGTCTGAGGTGG - Intronic
1113778632 13:112963174-112963196 CCTGCTGAGAGTGGTGGAGGTGG - Intronic
1114595594 14:23909185-23909207 CCTGCAGAGAGTTCCGAAGATGG + Intergenic
1114643892 14:24242749-24242771 CCGGCAGAGAGTGCAGGAAGCGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122497011 14:102164416-102164438 GTGGGAGAGAGTGCCAGAGGTGG - Intronic
1122860350 14:104579731-104579753 CCAGCAGAGAGGGCTGGAGACGG + Intronic
1128514122 15:68331638-68331660 CAGGGAGAGAGTGCCAAAGGGGG + Intronic
1129377074 15:75140483-75140505 CAGGGACAGAGAGCCGGAGGTGG + Intergenic
1129601522 15:77001541-77001563 CTTGCAGACAGTGCAGGAGGTGG + Intronic
1131265454 15:90912690-90912712 CTGGCAGGGAGGGCAGGAGGGGG + Intronic
1131510852 15:93048779-93048801 CCGCCTGGGGGTGCCGGAGGTGG + Intronic
1132546030 16:533852-533874 CCTGCAGAGAGGGCTGGAGGCGG + Intronic
1133465083 16:6020397-6020419 CCCGCAGGGTGTGCAGGAGGAGG + Intronic
1134145286 16:11755831-11755853 CAGGCAGTGAGTGACGGAGCCGG + Intronic
1135549591 16:23387932-23387954 GTGGCAGAGAGTGAAGGAGGAGG - Intergenic
1136010197 16:27358623-27358645 CCAGCACAGAGTTCCTGAGGAGG - Intronic
1136286795 16:29248892-29248914 CCTCCAGACAGTGCCGGAGAAGG + Intergenic
1141659224 16:85432866-85432888 GCTGCAGAGAGTGCCGGGGTAGG - Intergenic
1141866197 16:86751772-86751794 CCAACAGAGGGTGCCGGGGGAGG - Intergenic
1141980095 16:87544871-87544893 GTGGCAGAGACTGCCAGAGGTGG + Intergenic
1142592347 17:1011933-1011955 CCGGCAGTGTGTGGAGGAGGTGG - Exonic
1143130504 17:4674284-4674306 CCCGCAGAGAGGCCAGGAGGAGG - Intronic
1143147341 17:4785333-4785355 CCGGGAGAGAGCGGCGGCGGCGG + Exonic
1143668166 17:8376708-8376730 CCGGCGGAGCGGGCGGGAGGTGG - Intronic
1143880482 17:10026095-10026117 GGGGGAGAGAGTCCCGGAGGTGG - Intronic
1143904509 17:10198370-10198392 CCGGCAGCGAGCGCCGGACATGG + Exonic
1146219975 17:31009327-31009349 CCGGCAGCGGTAGCCGGAGGCGG - Intergenic
1148128224 17:45247714-45247736 CCGGCAGGCGGTGACGGAGGCGG - Intergenic
1150122990 17:62618760-62618782 GTGGCAGAGAATGCCGGAGGAGG - Intergenic
1151964672 17:77425216-77425238 GGGACTGAGAGTGCCGGAGGAGG + Intronic
1152961078 18:80454-80476 CTGGAACAGAGTGCAGGAGGAGG + Intergenic
1153321090 18:3774922-3774944 TAGGCAGGGAGTGCAGGAGGTGG - Intronic
1153955066 18:10089077-10089099 CCTGCAGAGTGTGCAGGAAGAGG + Intergenic
1154023549 18:10685898-10685920 CCTGCAGAAAGGGCAGGAGGAGG - Intronic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1156171689 18:34493798-34493820 CGGGCGGAGAGCGCCGGCGGGGG + Intronic
1157251235 18:46098089-46098111 CCTGCAGAGAGCGCCCGAGCCGG + Intronic
1158690970 18:59660116-59660138 CCAGCTGAGAGTGCCGAAAGGGG + Intronic
1160227828 18:77024961-77024983 CCCGCAGAGAGTGGCAGAGAGGG + Intronic
1160874881 19:1292293-1292315 CCGGCAGGCAGAGCCGGGGGTGG + Intronic
1160919688 19:1513685-1513707 CCGGCAGGGAGGGCGGGAGGCGG - Intergenic
1162456212 19:10786575-10786597 CCGGCAGCGACTCCCGGATGTGG - Exonic
1163424928 19:17236030-17236052 CAGGCAGCGAGTGCGGGATGCGG + Exonic
1165983939 19:39751148-39751170 CTGCCAGGGAGTGCCGGGGGAGG - Intergenic
1166122537 19:40694096-40694118 CCGGCAGAGAGGGCCCCAAGGGG + Intronic
925384429 2:3452271-3452293 CCTGCAGAGAGGGAGGGAGGAGG + Intronic
925904463 2:8531148-8531170 CCGGGAGAGAGGGCAGGAGGAGG + Intergenic
929852941 2:45609654-45609676 CAGGCAGAGAGTACCTGAGGTGG - Intronic
933772559 2:85753680-85753702 CGGGGAGGGAGCGCCGGAGGAGG + Intronic
934248551 2:90325957-90325979 CGGGCAGAAAGTCCCGGGGGGGG + Intergenic
936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG + Intergenic
936192302 2:110342610-110342632 CCAGCAGAGAGTGCCAGAGCTGG - Intergenic
941000418 2:160196966-160196988 CTGGCAGAGAGTGCTAGATGGGG - Intronic
941400315 2:165022262-165022284 CAAGCAGAGACTGCCTGAGGAGG + Intergenic
947499128 2:230659534-230659556 TTGGCACAGAGTGACGGAGGAGG - Intergenic
948394168 2:237632345-237632367 CCCGCAGAGAGCTCCGGAGCAGG - Intronic
948438123 2:237967385-237967407 CCGGCAGTGAGTGACCGCGGCGG + Intronic
948894831 2:240923238-240923260 CAGGGAGAGAGTGGCGGAGAGGG + Intronic
1171987130 20:31668270-31668292 CAGGCAGAGAGAGACGGGGGTGG - Intronic
1172618727 20:36306472-36306494 ACGGCAGAGCGGGCCGGAGGCGG + Exonic
1174246915 20:49188356-49188378 CCGGCAGGAAGTGACGGGGGAGG + Exonic
1175191025 20:57212282-57212304 CCGGCAGAGAGAACCGAATGCGG + Intronic
1175765026 20:61586474-61586496 CAGCCAGGGAGTGCCTGAGGGGG + Intronic
1175949658 20:62576556-62576578 GAGGCAGGGGGTGCCGGAGGAGG + Intergenic
1175958517 20:62623424-62623446 GCGGCAGAGAGACCCGGAGGGGG + Intergenic
1178319992 21:31597887-31597909 CCGGCAGAGGGTGCAGCCGGCGG + Intergenic
1179028276 21:37698388-37698410 CTGGCTGGGAGTGCGGGAGGGGG + Intronic
1179915788 21:44477338-44477360 CTGGCTGAGTGTGGCGGAGGGGG - Intergenic
1179937695 21:44615625-44615647 CCTGCAGAGAGACCCGGGGGAGG - Intronic
1180682677 22:17639124-17639146 CCGGCGTGGGGTGCCGGAGGCGG + Intronic
1181147328 22:20858446-20858468 CCGGCAGCCTGTGCGGGAGGGGG - Intronic
1181174025 22:21025938-21025960 CAGGCAGACAGGGCTGGAGGAGG + Intronic
1181387963 22:22558516-22558538 GAGGCAGAGAGTGGGGGAGGGGG + Intronic
1184270776 22:43381671-43381693 TCCGCAGAGAGTGCTGGAGCTGG + Intergenic
953404332 3:42653150-42653172 CTGGCAGAGAGTGGGGGTGGGGG + Intergenic
954109121 3:48424465-48424487 CAGGTAGAGGGTGCCTGAGGTGG + Exonic
954912426 3:54121508-54121530 GAGGCAGTGAGCGCCGGAGGAGG - Intergenic
961464106 3:127071126-127071148 CCAGCAGAAAGTGCTGGAAGTGG - Intergenic
961756989 3:129134038-129134060 ATGGCAGTGAGTGCCAGAGGGGG + Intronic
962583670 3:136819863-136819885 ACGGCCGAGAGTGGCGGAGAAGG + Intronic
967814408 3:193787140-193787162 CTGGCGGAGAGCGCTGGAGGTGG + Intergenic
969523626 4:7693056-7693078 CTGGCCGAGGGTGCCGGTGGCGG + Intronic
983390370 4:167123605-167123627 CTGGCAGAGAGTGGCAGAGGTGG - Intronic
984024177 4:174522840-174522862 CCGGGAGGGAGTGCAGGAGGAGG - Exonic
989011598 5:36877423-36877445 CCGGCGGAGAGTGCAGGCCGCGG + Intronic
991305862 5:65175174-65175196 CCAGCAGAGAGAGACAGAGGAGG + Intronic
992627662 5:78649156-78649178 CCTGCCGGGAGGGCCGGAGGCGG + Intronic
993843472 5:92909885-92909907 CAGCCAGAGGGTGCCGGCGGAGG - Intergenic
995978550 5:118073212-118073234 CCTGCACAGAGTGCCTGAAGTGG + Intergenic
998349599 5:141492071-141492093 CCGGCGAAGCGTGCCGGAGCCGG - Intronic
999188976 5:149732237-149732259 CGGGCACTGAGTGCGGGAGGAGG + Intronic
999202300 5:149825034-149825056 ATGGGAAAGAGTGCCGGAGGAGG + Intronic
999236595 5:150101600-150101622 CAGGCAGAGAGTGGCGGTGCTGG + Intronic
1002594593 5:180313719-180313741 CGGGCAGAGCAGGCCGGAGGAGG + Intronic
1003496575 6:6668564-6668586 CTGGCAGGGAGTGCGGGACGGGG + Intergenic
1003872766 6:10415073-10415095 CCGGCGGTGAGCGCAGGAGGAGG + Exonic
1006098658 6:31672006-31672028 CCGGCAGAGAGCTCTGGAGTTGG - Exonic
1007665395 6:43510290-43510312 CTGGCAGAGAGAGCCTGAGGCGG + Exonic
1007704345 6:43781709-43781731 CGGGCAGAGAGTGCAGGGAGAGG - Intronic
1012505530 6:99942294-99942316 CCAGCAGAGAGGGTAGGAGGGGG - Intronic
1014140636 6:117938485-117938507 CCTGCAGAGAATGCATGAGGAGG - Intronic
1017995122 6:159525586-159525608 CAGGCAGAGAGGGCCAGAGAGGG - Intergenic
1018753853 6:166831183-166831205 CCTGCGGAGAGTGGAGGAGGAGG - Intronic
1019904067 7:4047687-4047709 CCGTCACAGAGCGCGGGAGGAGG - Intronic
1021510481 7:21427930-21427952 CCGGCGGAGAGAGGCCGAGGGGG + Intergenic
1022528349 7:31052426-31052448 CGGGCAGGGAGTGACGGCGGCGG + Intergenic
1024957078 7:54933406-54933428 CGAGCAGAGAGTGGAGGAGGAGG + Intergenic
1028382559 7:90214833-90214855 CAGGCAGTGAGTGACTGAGGTGG + Intronic
1034860200 7:154588202-154588224 CCCGCAGAGTGTCCCAGAGGAGG + Intronic
1036021332 8:4850542-4850564 CTGGGAGAGAGTGCTGGGGGAGG - Intronic
1036184561 8:6612612-6612634 TGGGCAGAGAGAGCCGGAGCAGG - Intronic
1039548940 8:38429619-38429641 CTGGCAGAGAGGGCTGGAGGGGG + Intronic
1041026612 8:53693214-53693236 CCAGCAGAGAGCACCGCAGGGGG + Intergenic
1043591863 8:81842261-81842283 CGGGCAGAGACTGGCTGAGGCGG - Exonic
1048504265 8:135006575-135006597 CCTGCAGAGAGAGGAGGAGGAGG + Intergenic
1049069989 8:140349060-140349082 CCGGCAGAGGGGGCTGAAGGGGG + Intronic
1049322283 8:142002955-142002977 CAGGCAGAGAGGGCCAGAGGAGG - Intergenic
1049444758 8:142624829-142624851 CAGGCAGGGAGGGCAGGAGGAGG - Intergenic
1057553896 9:96072403-96072425 CCTGCAGAGAGTTCTGAAGGTGG + Intergenic
1061055769 9:128222208-128222230 CCGGCAGTGTGTCCCGGATGTGG - Exonic
1061262659 9:129488606-129488628 CCGGCCGCGAGGGCGGGAGGGGG - Intergenic
1062494667 9:136826135-136826157 CCGCCAGGCAGTGCAGGAGGAGG - Intronic
1062565761 9:137163354-137163376 CTGGCGGAGAGGGGCGGAGGAGG - Intronic
1062573928 9:137197883-137197905 CCGGCAGATAGAGCCGGCAGGGG + Intronic
1062644681 9:137541463-137541485 CCGACAGGCAGTGCCGGAGCTGG + Intronic
1062699752 9:137892702-137892724 CCGGCAGGCAGAGCAGGAGGTGG - Intronic
1062737082 9:138143532-138143554 CTGGAACAGAGTGCAGGAGGAGG - Intergenic
1187658197 X:21505531-21505553 ATGGCAGAGAGTGTGGGAGGAGG + Intronic
1190287713 X:48971837-48971859 CGGGGAGAGAGAGCCAGAGGAGG - Intergenic
1200035057 X:153321422-153321444 CCCGCAGAGAGAGGAGGAGGGGG - Intergenic