ID: 915508406

View in Genome Browser
Species Human (GRCh38)
Location 1:156371947-156371969
Sequence GTGGACTTGGATACTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915508400_915508406 -5 Left 915508400 1:156371929-156371951 CCCTAGGTTTCCATTCCTGTGGA 0: 1
1: 0
2: 1
3: 25
4: 273
Right 915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 90
915508401_915508406 -6 Left 915508401 1:156371930-156371952 CCTAGGTTTCCATTCCTGTGGAC 0: 1
1: 0
2: 1
3: 23
4: 181
Right 915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 90
915508397_915508406 11 Left 915508397 1:156371913-156371935 CCTACTTCTTTTTCTGCCCTAGG 0: 1
1: 0
2: 1
3: 50
4: 339
Right 915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915508406 Original CRISPR GTGGACTTGGATACTGTTGT GGG Intronic
901184272 1:7362361-7362383 GTGGACTTGGATAGAGTTGGTGG + Intronic
901184301 1:7362559-7362581 GTGGACTTGGGTAGTGGTGGTGG + Intronic
901185507 1:7370165-7370187 GAGGACATGGCTGCTGTTGTTGG - Intronic
901884888 1:12215894-12215916 AGGGACTTGGATGCTGCTGTGGG + Intergenic
909586276 1:77292245-77292267 GCAGAATAGGATACTGTTGTTGG + Intronic
911056405 1:93712096-93712118 CTGGAGGTGGCTACTGTTGTGGG + Intronic
911274880 1:95849116-95849138 GGTGACTTGGGTACTGTTGAAGG + Intergenic
912006255 1:104904498-104904520 GTTGACTTGGATGCTGTTAAAGG - Intergenic
914373107 1:147048204-147048226 GGAGACTTGGACACAGTTGTAGG - Intergenic
915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG + Intronic
923724512 1:236494770-236494792 GTGGAATTCGATACTGGTGCAGG + Intergenic
1064842335 10:19607819-19607841 GTGGGCTGGGATACAGCTGTTGG - Exonic
1065266700 10:23983809-23983831 CAGGACTTGGATCCTGTTCTTGG - Intronic
1066350201 10:34630401-34630423 GTGGACTAGGATGCTCTGGTCGG - Intronic
1069592484 10:69650696-69650718 GGGGACCTGGAGACTGTAGTGGG - Intergenic
1078398598 11:11003078-11003100 CTGGAATTGAATAGTGTTGTGGG + Intergenic
1078530150 11:12130866-12130888 GTGGACCCTGATACTGCTGTGGG + Intronic
1083953055 11:65967384-65967406 GTGGGCTTGGACACGGTGGTGGG + Intronic
1090739019 11:129640216-129640238 GTGGACCTGGCTTCTGTTCTAGG - Intergenic
1092206754 12:6619484-6619506 TTGGACTTGGATGTTGTTGAGGG + Exonic
1094485400 12:30922702-30922724 ATGGATATGGACACTGTTGTTGG + Intergenic
1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG + Intronic
1111666873 13:91280757-91280779 GTTGAATTGGAAAATGTTGTTGG - Intergenic
1111673626 13:91359517-91359539 TAGGACTTGGATATTGTTGGAGG + Intergenic
1115495556 14:34000866-34000888 ATGCACTTGGGTACTGTTTTAGG + Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1128387360 15:67159617-67159639 GTGCACTTGGAAACTTTTTTGGG - Intronic
1130230239 15:82091502-82091524 GTGGACTTGGGGACTGGTGAGGG + Intergenic
1130416835 15:83702219-83702241 GATGACTTGGATACTGTTAAAGG + Intronic
1131638692 15:94265377-94265399 GTGGACTTGGACATTGTGGCTGG + Intronic
1133315767 16:4883028-4883050 GTGGGCTTGGCTGCTGTGGTTGG + Exonic
1133393951 16:5431173-5431195 GATGACTTGGATTGTGTTGTCGG + Intergenic
1135230422 16:20701378-20701400 ATGGACTTGTATACTGTGGAAGG + Intronic
1138077180 16:54053993-54054015 GTGCACTTAGATCCTGGTGTCGG + Intronic
1141013095 16:80421674-80421696 GTGGACTTGGACACAATTGCTGG + Intergenic
1142770008 17:2089832-2089854 GTAGACTGGGTTACTGTTCTGGG + Intronic
1147041776 17:37725150-37725172 GTGCTCTTGGAAACTGTTGAAGG - Intronic
1155649114 18:28119087-28119109 TTGGACTTGGTTGCTGCTGTGGG - Intronic
1155781914 18:29848474-29848496 TTGTACTTGGATACTGATATTGG + Intergenic
928880897 2:36095314-36095336 GTGCACTTTCATACTGTTGGTGG + Intergenic
930656172 2:54009207-54009229 GTGGTTTTGAATACTATTGTGGG + Intronic
930743341 2:54856424-54856446 CAGGACATGGATACTTTTGTGGG - Intronic
940381407 2:153018641-153018663 GGTGACTTGGGTACTGTTATAGG - Intergenic
942649873 2:178155145-178155167 GGTGACTTGGATGCTGTTGAGGG - Intergenic
1169999321 20:11596975-11596997 GGTGACTTGGATACTGTTAAAGG - Intergenic
1172533844 20:35654943-35654965 TTAAAGTTGGATACTGTTGTGGG + Exonic
1173184775 20:40832151-40832173 GTGAACTGGGAAACTGTTGGAGG + Intergenic
1174209820 20:48868675-48868697 GTGGAGTGGGAAACTGTAGTAGG - Intergenic
1174993108 20:55535136-55535158 TTGCTCTTGGATTCTGTTGTTGG - Intergenic
1178626139 21:34220417-34220439 GTGGCCTGGGATACTGCTTTTGG + Intergenic
951631018 3:24720431-24720453 GTGGATTTGGATTCTGTAGTTGG + Intergenic
954794229 3:53153367-53153389 GAGGTCTTGGATTGTGTTGTGGG + Intergenic
955378582 3:58418486-58418508 GTGCTCTTAAATACTGTTGTTGG + Intronic
955957002 3:64301013-64301035 TTGGAATTGGATACTGGTGTTGG + Intronic
956094754 3:65704145-65704167 CTGGACTTGGAGGATGTTGTAGG - Intronic
963150395 3:142039930-142039952 GTGGATTTGGATTTTGATGTTGG - Intronic
963681462 3:148383300-148383322 CTGGAGCAGGATACTGTTGTGGG - Intergenic
964441039 3:156710483-156710505 TAGGACTTGGACACTTTTGTGGG - Intergenic
966090487 3:176129617-176129639 GGGGACTTGGAGTCTGTGGTAGG - Intergenic
966475176 3:180336352-180336374 GTGGGCTTGGAAACTTTTGCTGG - Intergenic
973063939 4:45763940-45763962 GGTGACTTGGATACTGTTAAAGG - Intergenic
974328676 4:60448162-60448184 GTGGACTTGGTGTCTGTTGAGGG - Intergenic
974864701 4:67565838-67565860 GTGGAATTAGATACTGGTGATGG - Intronic
976286508 4:83375951-83375973 GGTGACTTGGATACTGTTAAAGG - Intergenic
976424882 4:84891101-84891123 GTGGATCAGGAGACTGTTGTAGG - Intronic
979580028 4:122347183-122347205 CTGGATTTAGATATTGTTGTAGG + Intronic
983291891 4:165817917-165817939 GTGTACTTTGAAACTTTTGTTGG + Intergenic
988067125 5:26236544-26236566 GTGGACTTGGGTGTTGTGGTGGG + Intergenic
994473981 5:100244030-100244052 GGGAACTCGTATACTGTTGTTGG + Intergenic
994626592 5:102228117-102228139 TTGGACTTTGATAATGTTCTTGG + Intergenic
994963103 5:106629604-106629626 GTAGACTTGTACACTGTTGGTGG + Intergenic
995405994 5:111796634-111796656 CTAGACTATGATACTGTTGTAGG - Intronic
996367992 5:122723248-122723270 ATGGACTTGGAGAGTGTTCTGGG - Intergenic
996892539 5:128438902-128438924 GTGGCATTGGATATTGTTGGGGG - Intronic
997111700 5:131082293-131082315 GTGGACTAGGATACTTCTGTGGG + Intergenic
999594343 5:153185481-153185503 CTGGACTTGGAGACTGCTCTGGG - Intergenic
1001784799 5:174402986-174403008 GTGGACTTGGATAGGTTTCTAGG - Intergenic
1002983806 6:2168294-2168316 TTGGTTTTGGATGCTGTTGTTGG - Intronic
1011827448 6:91326227-91326249 GTACACTTAGATACTGTTGGCGG - Intergenic
1014478621 6:121906957-121906979 GAAGACTTAGATACTGTTGGTGG - Intergenic
1015590251 6:134816256-134816278 ATGGACTAGGAAAGTGTTGTAGG + Intergenic
1021110135 7:16684293-16684315 TTGGAGATGGAGACTGTTGTAGG + Intronic
1028080952 7:86575270-86575292 GTGGATTTGGATACTCTAATAGG - Intergenic
1033108287 7:138551118-138551140 GTGAAATTGGATGGTGTTGTTGG - Exonic
1035643690 8:1202381-1202403 GTGGACGTCCATGCTGTTGTGGG + Intergenic
1036048266 8:5167593-5167615 ATGCACTTGGATGCTGCTGTGGG + Intergenic
1056599705 9:88036997-88037019 GTGGTGTTGGATCCTGTTGGGGG + Intergenic
1057005668 9:91556404-91556426 GTTGAGTGGGTTACTGTTGTGGG - Intergenic
1060081650 9:120652991-120653013 GTAGACTTGGATTCTGTTCTTGG - Intronic
1185961474 X:4549761-4549783 GTGGACTAGCATAAAGTTGTAGG + Intergenic
1187673630 X:21693342-21693364 GTAGAGTTGGTTTCTGTTGTTGG - Intergenic
1188240227 X:27777630-27777652 GAGGCCTTGTATAGTGTTGTAGG + Intergenic
1191655265 X:63590202-63590224 GAGCACTTGCATACTGTTGGTGG - Intergenic
1195266687 X:103188158-103188180 GGTGACGTGGTTACTGTTGTGGG + Intergenic
1195899876 X:109786565-109786587 GTATTATTGGATACTGTTGTAGG + Intergenic
1196646287 X:118120764-118120786 GTGGATGTGGAGACTGTTGGTGG - Intergenic
1201943720 Y:19487420-19487442 ATGGACTTGGCTACTGTTTTTGG - Intergenic