ID: 915508406

View in Genome Browser
Species Human (GRCh38)
Location 1:156371947-156371969
Sequence GTGGACTTGGATACTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915508400_915508406 -5 Left 915508400 1:156371929-156371951 CCCTAGGTTTCCATTCCTGTGGA 0: 1
1: 0
2: 1
3: 25
4: 273
Right 915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 90
915508397_915508406 11 Left 915508397 1:156371913-156371935 CCTACTTCTTTTTCTGCCCTAGG 0: 1
1: 0
2: 1
3: 50
4: 339
Right 915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 90
915508401_915508406 -6 Left 915508401 1:156371930-156371952 CCTAGGTTTCCATTCCTGTGGAC 0: 1
1: 0
2: 1
3: 23
4: 181
Right 915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915508406 Original CRISPR GTGGACTTGGATACTGTTGT GGG Intronic