ID: 915510209

View in Genome Browser
Species Human (GRCh38)
Location 1:156382804-156382826
Sequence CAGCCCGAAGAGCTGGTGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915510209_915510214 10 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510214 1:156382837-156382859 TGATGTTTGCCTCTGTGGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 218
915510209_915510216 12 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510216 1:156382839-156382861 ATGTTTGCCTCTGTGGGCGGGGG 0: 1
1: 0
2: 2
3: 12
4: 155
915510209_915510212 6 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510212 1:156382833-156382855 ACACTGATGTTTGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 166
915510209_915510215 11 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510215 1:156382838-156382860 GATGTTTGCCTCTGTGGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 194
915510209_915510211 5 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510211 1:156382832-156382854 CACACTGATGTTTGCCTCTGTGG 0: 1
1: 0
2: 2
3: 34
4: 228
915510209_915510219 21 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510219 1:156382848-156382870 TCTGTGGGCGGGGGCCTTGGAGG 0: 1
1: 0
2: 3
3: 31
4: 308
915510209_915510217 18 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510217 1:156382845-156382867 GCCTCTGTGGGCGGGGGCCTTGG 0: 1
1: 0
2: 2
3: 38
4: 350
915510209_915510213 9 Left 915510209 1:156382804-156382826 CCATGCACCAGCTCTTCGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 915510213 1:156382836-156382858 CTGATGTTTGCCTCTGTGGGCGG 0: 1
1: 0
2: 2
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915510209 Original CRISPR CAGCCCGAAGAGCTGGTGCA TGG (reversed) Exonic
901438575 1:9264069-9264091 CAGCCGGAGCAGCTGGTGCCAGG + Exonic
904643990 1:31952234-31952256 CAGGCTGAAAAGCTGGGGCAAGG - Intergenic
904951004 1:34238746-34238768 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
908135458 1:61127595-61127617 CAGCCAGAAGATATGGTGAATGG + Intronic
908806309 1:67936851-67936873 AAACCAGAAGAGCTGGTACAGGG + Intergenic
910479015 1:87638342-87638364 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
912550628 1:110483212-110483234 CAGCCCGGAAGGCAGGTGCAGGG - Intergenic
915510209 1:156382804-156382826 CAGCCCGAAGAGCTGGTGCATGG - Exonic
917035317 1:170742173-170742195 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
917035614 1:170744395-170744417 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
917968720 1:180194171-180194193 CAGCCTGAAGGGCTGGTGCGTGG + Intronic
920952693 1:210587313-210587335 CAGGCCGGAGAGCATGTGCAGGG + Intronic
1063940549 10:11124033-11124055 CAGGCAGGAGAGCTTGTGCAGGG + Intronic
1064311314 10:14214024-14214046 CAGCCAAGAGAGCTTGTGCAGGG - Intronic
1064608055 10:17064697-17064719 CAGCCCCAAGAGCCTGTGCATGG - Intronic
1064907312 10:20360799-20360821 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
1067534259 10:47096541-47096563 CCTCCCGAAGTGCTGGTGCTGGG + Intergenic
1070758398 10:79007788-79007810 AAGCCAGAAGGGCTGGAGCAGGG - Intergenic
1075897353 10:126008639-126008661 CAAACCCAAGGGCTGGTGCAGGG - Intronic
1076445679 10:130512294-130512316 CGGCCCCAGGAGCAGGTGCAAGG - Intergenic
1077020198 11:413900-413922 CAGGCAGAAGAGAGGGTGCAGGG - Intronic
1078573903 11:12482739-12482761 CAGGCAGAAAAGCTTGTGCAGGG + Intronic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1080024261 11:27597229-27597251 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1081648681 11:44808252-44808274 CAGCTAGAAGAGGTGGTGCGAGG + Intronic
1083651960 11:64209129-64209151 CAGCCCTGAGAGGTGGTGTAGGG + Intronic
1084656465 11:70522638-70522660 CAGCCCGCGGAGCTGGAGCCGGG - Intronic
1084800169 11:71538419-71538441 CAGCCTGAAGAGCAGCTGCAGGG - Exonic
1084800182 11:71538506-71538528 CAGCCTGAAGAGCAGCAGCAGGG - Exonic
1089148932 11:116349926-116349948 CAGCCCCATGAGCTGCAGCAGGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1096174716 12:49506415-49506437 CAGCCAAGAGAGCTTGTGCAAGG + Intronic
1097587248 12:61529797-61529819 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1098676483 12:73295311-73295333 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1099625790 12:85071761-85071783 CAGGCCAAAGGGCTTGTGCAGGG + Intronic
1100280720 12:93115791-93115813 CAGCCTTCAGAGATGGTGCAGGG - Intergenic
1100302629 12:93322020-93322042 CAACCAGAAGAGCAGGTGGAAGG + Intergenic
1101423500 12:104568343-104568365 CAGACAGAGGAGCTGTTGCAAGG - Intronic
1102813441 12:115843449-115843471 CAGCCCCAAGTGCTGCTGCCTGG - Intergenic
1104717815 12:131028032-131028054 CAGCATGAACAGCTGGTGCCCGG + Intronic
1106675447 13:31953185-31953207 CAGCCGGACGGGCTGGTGCGGGG + Intergenic
1110645384 13:77877510-77877532 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1111364119 13:87219009-87219031 CAGACAGAAGACCAGGTGCAGGG - Intergenic
1112238786 13:97660666-97660688 CAACCCAGAGAGCCGGTGCAAGG + Intergenic
1113321525 13:109236892-109236914 GAGCCCAAAGAACTGGGGCAGGG + Intergenic
1113812703 13:113152065-113152087 CAGCCAGGACAGCTGGTGGACGG + Intergenic
1117496789 14:56313429-56313451 CAGACAGGAGAGCGGGTGCAGGG + Intergenic
1117748732 14:58898554-58898576 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1119617029 14:76105549-76105571 CAGACGGCAGAGCTAGTGCATGG + Intergenic
1119706814 14:76788264-76788286 CAGCCTGCAGAACTGGGGCAAGG - Exonic
1121401018 14:93677422-93677444 CAGGCAAAAGAGCTTGTGCAGGG + Intronic
1121406706 14:93723359-93723381 CAGTCAGAAGGGCTGGTGCCTGG + Intronic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1122801406 14:104231558-104231580 CACCACCAAGTGCTGGTGCAGGG - Intergenic
1124202079 15:27687097-27687119 CAGCCGCAAGAGCTGGGGCGGGG + Intergenic
1125149624 15:36517100-36517122 CAGTCCTAAGAGCGGGTGCATGG - Intergenic
1127648034 15:60976793-60976815 AAGCCAAAAGAACTGGTGCAAGG - Intronic
1128253623 15:66180954-66180976 CAGCCGGAGGAGCTGGTGAGTGG - Intronic
1131095636 15:89652833-89652855 CTGCCCAAGGAGCTGCTGCACGG - Exonic
1131407921 15:92181857-92181879 CAGGCCAGAGAGCTTGTGCACGG + Intergenic
1132576398 16:666357-666379 CAGCCCCAAGAGCTGGGGAGAGG + Intronic
1133538599 16:6725593-6725615 CAGCCCCAAGAGCTGATGGTTGG - Intronic
1134678665 16:16108523-16108545 CCTCCCAAAGAGCTGGTGCTGGG + Intronic
1135121480 16:19769993-19770015 CAGCGAGAAGAGCAAGTGCAAGG + Intronic
1138975337 16:62200084-62200106 CACCCAGAGCAGCTGGTGCAAGG - Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1139547613 16:67657007-67657029 GAGCCAGAAGACCAGGTGCAAGG + Intronic
1140988883 16:80188768-80188790 CGGGCTGAAGAGCTTGTGCACGG - Intergenic
1141441680 16:84033381-84033403 CAGCACGGAGAGCAGGGGCAGGG + Exonic
1141594012 16:85086576-85086598 CAGGGCGAGGAGCTGGGGCAAGG + Intronic
1144001370 17:11058175-11058197 CATCCAGAATAGCAGGTGCAAGG + Intergenic
1144788396 17:17844348-17844370 CAGCCCGGAGAGTTGGGGCAAGG - Intronic
1148000621 17:44385190-44385212 CAGGCCGGAGAGCTGGTGCTTGG - Exonic
1151421521 17:74001155-74001177 CAGACAGAAGTGATGGTGCAGGG - Intergenic
1151838672 17:76601583-76601605 CAGCCCCAAGAGCTGCTGGGTGG + Intergenic
1155663452 18:28278902-28278924 CAGGCCAGAGAGCTTGTGCAGGG - Intergenic
1156079558 18:33316534-33316556 GCGCCCGGAGAGCAGGTGCAGGG + Intronic
1158686624 18:59620695-59620717 CAGGCAGGAGAGCTTGTGCAGGG - Intronic
1158875107 18:61726218-61726240 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1160510486 18:79450842-79450864 CAGCCCCACGAGCTCGTGCCAGG - Intronic
1161910251 19:7188066-7188088 CACCCAGAACAGCTTGTGCAAGG - Intronic
1163241067 19:16064285-16064307 CAGCCTGAACAGCTGGGGCAGGG + Intergenic
1165375505 19:35438950-35438972 CACCCCGAAAAGCTGTGGCAAGG - Intergenic
1168353889 19:55690658-55690680 CAGCCCGACGAGCTTGTCCTGGG - Intronic
924995776 2:359181-359203 CAGCCTGGAGAGCAGGTTCAGGG - Intergenic
925076294 2:1019046-1019068 CTGCTCGAAGAGCTGATGCCAGG - Intronic
925247770 2:2399654-2399676 CTCCCAGAAGGGCTGGTGCACGG - Intergenic
925625736 2:5840883-5840905 CTTCCCTTAGAGCTGGTGCAGGG + Intergenic
926289515 2:11517314-11517336 CAGTCCAAAGAGCAGGTGCCTGG - Intergenic
927157866 2:20231947-20231969 CAGCCCGAAGAGCACCAGCACGG - Intergenic
927564955 2:24104120-24104142 GAGCCCAAACAGCTGGTGCCTGG - Intronic
932308175 2:70718743-70718765 CAGGCCACAGAGCTGGTGAAAGG + Intronic
932839575 2:75069110-75069132 CAGACAAGAGAGCTGGTGCAGGG - Intronic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
938639513 2:133265475-133265497 CAGAGCGGAGCGCTGGTGCAAGG - Intronic
939279174 2:140039889-140039911 CAGCCAAGAGAGCTTGTGCAGGG + Intergenic
945094591 2:206207019-206207041 CAGTCAGAAGTGCTGGTCCAAGG - Intronic
946656351 2:221952176-221952198 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
947003471 2:225485206-225485228 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
948040181 2:234895422-234895444 CAGGCAAGAGAGCTGGTGCAGGG + Intergenic
1172979719 20:38931733-38931755 CAGCCTGAAGCGCTGGTTCTGGG + Intronic
1174160366 20:48546165-48546187 CAGCTGGCAGAGCGGGTGCATGG + Intergenic
1174400636 20:50273975-50273997 CAGCCAGCAGGGCTGGAGCAGGG - Intergenic
1177184980 21:17783344-17783366 CAGCCCCCAGAGCTGGTTTAGGG + Intergenic
1177479486 21:21668698-21668720 CAGCCAAGAGAGCTTGTGCAGGG + Intergenic
1179551376 21:42146083-42146105 CAGCCCTAGGAGCTGGTGCTGGG + Intergenic
1180126252 21:45792250-45792272 CAACCCGCAGAGCTGCGGCAAGG + Intronic
1181309089 22:21934027-21934049 CAAGCCGAAGAGCTGGTTGAAGG + Exonic
1181327008 22:22057575-22057597 CAACCCAAAGAGCTGAAGCATGG - Intergenic
1182146048 22:27997424-27997446 CAGCCCCAGGTGCTGGTGCCAGG - Intronic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
949469531 3:4380079-4380101 CAGCAGGAAGAGCGGCTGCAGGG + Intronic
950671152 3:14526110-14526132 CAGCCCCAAGAGCAGGGGCCAGG - Intronic
953407065 3:42664771-42664793 CAGGCCCCAGAGCTGGTGGAGGG + Exonic
954003881 3:47577883-47577905 GAGGCCGAAGAGCTGGTGAAGGG - Exonic
957792539 3:84959257-84959279 CTGCCCGAGCAGGTGGTGCAGGG - Intronic
960255237 3:115504845-115504867 CAGGCAGGAGAGCTTGTGCAGGG - Intergenic
964313600 3:155420005-155420027 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
968671239 4:1852904-1852926 CAGCCCTCAGTGCTGGTGCCAGG + Intronic
968926604 4:3551658-3551680 CAGCCCGCAGAGTTCCTGCAAGG - Intergenic
972290766 4:37687651-37687673 CAGCAAGAAGAGGGGGTGCATGG + Intergenic
972402014 4:38714022-38714044 CAGGCAAGAGAGCTGGTGCAGGG + Intergenic
972735492 4:41836980-41837002 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
972738439 4:41867191-41867213 GAGCCCGCAGAGCTGCTGAAAGG + Intergenic
974520954 4:62979128-62979150 CACGCCGAAGAATTGGTGCAGGG + Intergenic
976410115 4:84703612-84703634 CAGAGGGAAGAGCTTGTGCAAGG - Intronic
978892618 4:113848195-113848217 CAGCCAAGAGAGCAGGTGCAGGG + Intergenic
979038252 4:115753535-115753557 CAGGCAGGAGAGCTTGTGCAGGG - Intergenic
979717837 4:123862980-123863002 AAGCCGGAAGCCCTGGTGCAAGG - Intergenic
982171065 4:152662388-152662410 CAGCTCCAAGAGTTTGTGCAAGG + Intronic
982627042 4:157780517-157780539 AAGCTCAAAGAGCTGGTCCAGGG + Intergenic
983354467 4:166638015-166638037 CACCCCAAAGAGCTGTGGCATGG - Intergenic
983515763 4:168655053-168655075 TAGCCAGAATAGTTGGTGCAAGG + Intronic
984608478 4:181811663-181811685 CAGCCAAGAGAGCTTGTGCAGGG + Intergenic
986761823 5:10886974-10886996 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
987457436 5:18164773-18164795 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
987826437 5:23035759-23035781 CAGACAGGAGAGCTTGTGCAGGG + Intergenic
988307234 5:29507899-29507921 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
993625562 5:90220499-90220521 CAGACCAAAGAGCTGGGCCAAGG + Intergenic
993778591 5:92035519-92035541 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
994857453 5:105142645-105142667 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
995137294 5:108693483-108693505 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
998697230 5:144653834-144653856 CAGGCAAAAGAGCTGGTGCAGGG + Intergenic
1002021460 5:176366425-176366447 CAGCGCGAGGTGCTGGTGCTGGG + Exonic
1002469347 5:179426181-179426203 CAGCCTGAAGGGCTCTTGCAGGG - Intergenic
1002506207 5:179680873-179680895 CATCCCCAAGATCTGGTTCAGGG + Exonic
1006124308 6:31827745-31827767 CAGCCTGAGGAGCTGCTGCGAGG + Exonic
1006373186 6:33657764-33657786 CAGCACCAAGAGCTGGGGCAGGG + Intronic
1008209427 6:48702667-48702689 GAGCCAGAAGAGCTGGAGAAAGG + Intergenic
1008405922 6:51118346-51118368 CAGCCCTAAGAGATGGTTAAAGG - Intergenic
1011692363 6:89882034-89882056 CAGGCCGGAGAGCTTGTGCAGGG + Intergenic
1012832952 6:104228750-104228772 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1014561973 6:122901675-122901697 CAGCACTAAGAGATGGAGCAAGG - Intergenic
1015757068 6:136618356-136618378 TAGCTTGAACAGCTGGTGCAGGG - Intronic
1017712972 6:157186421-157186443 CAGCCCCGAGAGCGCGTGCAGGG + Intronic
1018293456 6:162317338-162317360 CAGGCAGGAGAGCTTGTGCAGGG - Intronic
1019775979 7:2912508-2912530 CAGCCCATAGAGCAGGTGCTTGG + Intronic
1019818015 7:3215575-3215597 CAGCCTGTAGACCTGGTGCCGGG + Intergenic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1022874997 7:34519615-34519637 CAGGCCAGAGAGCTTGTGCAGGG + Intergenic
1022978117 7:35576983-35577005 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1023770253 7:43550559-43550581 CAGACCGAGGCGCTGGTGCGCGG + Exonic
1026519527 7:71104437-71104459 CAGGCCAGAGAGCTTGTGCAGGG - Intergenic
1027161627 7:75806835-75806857 CAGCCTGGAGAGCCGGTGCTTGG - Intergenic
1027201949 7:76069520-76069542 CAGGCTGAAGAGCTTGTGGATGG + Intergenic
1028646022 7:93097598-93097620 AACCCCTAAGAGCTGCTGCATGG + Intergenic
1028767705 7:94578657-94578679 CAGACCTGAGATCTGGTGCAAGG + Intergenic
1029096458 7:98088880-98088902 CAGCCAGACGTGGTGGTGCATGG + Intergenic
1029113463 7:98224768-98224790 CAGCCCGAAGGCCCTGTGCAGGG + Intronic
1030059565 7:105612030-105612052 CAGCCAGAAGCGGTGGTGAAAGG - Intronic
1030139589 7:106291245-106291267 CAGCTTTAAGAGCTTGTGCATGG + Intergenic
1032127435 7:129205268-129205290 CAACCCCAAGAGCTGGTACGAGG + Exonic
1032513273 7:132488892-132488914 CAGCCAGAAGGGCTGGAGCAAGG + Intronic
1035421870 7:158736214-158736236 CAGCCCGATGAGGTTGTGCAGGG - Intronic
1035566519 8:644771-644793 GAGCCCCAAGACCTGCTGCAGGG - Intronic
1035700932 8:1638929-1638951 CAGCCCAGAGAGCTGGGTCATGG + Intronic
1036293259 8:7514324-7514346 CAGCCGGAAGGGCTTGTGCACGG - Intergenic
1036329297 8:7806677-7806699 CAGCCGGAAGGGCTTGTGCACGG + Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1038024487 8:23576516-23576538 CAACCTAGAGAGCTGGTGCAGGG - Intergenic
1038805864 8:30790665-30790687 CTGCCCCAGGAGCTGGGGCAGGG + Intronic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1041481208 8:58321515-58321537 AACCCCAAAGACCTGGTGCAGGG + Intergenic
1043374388 8:79632092-79632114 CAGTCCTCAGAGCTGGTGCCAGG - Intronic
1045932580 8:107644225-107644247 CAGGCAGGAGAGCTTGTGCAGGG - Intergenic
1049257690 8:141622742-141622764 CAGCCTGAGGGGCTTGTGCAGGG + Intergenic
1051179362 9:14394483-14394505 CAGGCAAAAGAGCTTGTGCAAGG + Intronic
1052861182 9:33438930-33438952 CAGCCAGAACTGCTGGTGGAAGG + Intergenic
1053801523 9:41767040-41767062 CAGCCCGCAGAGTTCCTGCAAGG - Intergenic
1054189954 9:61979194-61979216 CAGCCCGCAGAGTTCCTGCAAGG - Intergenic
1054463452 9:65479121-65479143 CAGCCCGCAGAGTTCCTGCAAGG + Intergenic
1054648560 9:67609397-67609419 CAGCCCGCAGAGTTCCTGCAAGG + Intergenic
1057155661 9:92836983-92837005 CAGCTGGAAGAGCTGGTCTAGGG - Intergenic
1058142724 9:101375170-101375192 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
1058754525 9:108072214-108072236 AAGCCCGAAGAGCTGTGGCTTGG - Intergenic
1060348818 9:122839466-122839488 CAGCCCACCGAGGTGGTGCAGGG + Intergenic
1061855255 9:133438423-133438445 CAGCCCAGAGCGTTGGTGCAGGG + Intronic
1062624019 9:137434923-137434945 CAACCAGAAGAGCTGGACCAAGG + Exonic
1185797606 X:2980384-2980406 CAGGCAGCAGAGCTTGTGCAGGG - Intergenic
1187079760 X:15974046-15974068 CAGCCGGAAGAGCCTGTGTAAGG - Intergenic
1187397830 X:18933518-18933540 CAGCCAGATGTGCTTGTGCAGGG - Intronic
1188090548 X:25959255-25959277 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1188907758 X:35808745-35808767 CAGACGGCAGAGCTTGTGCAGGG - Intergenic
1189114292 X:38327339-38327361 GAGCCGGAAGAGCTGATGCCCGG - Exonic
1190311125 X:49117646-49117668 CAGCCTCAAGGGCTGGTGCCTGG - Exonic
1191602809 X:63028073-63028095 CAGGCAGTAGAGCTTGTGCAGGG + Intergenic
1199003166 X:142663884-142663906 CAGGCCAAAGAGCCTGTGCAGGG - Intergenic
1201690072 Y:16753327-16753349 CAGCCCAAAGAGCAGAAGCAGGG - Intergenic