ID: 915513715

View in Genome Browser
Species Human (GRCh38)
Location 1:156400888-156400910
Sequence TCCCCACAGCTTCTCCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915513705_915513715 20 Left 915513705 1:156400845-156400867 CCGAGCCTCCGGCACTATGAATG No data
Right 915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG No data
915513713_915513715 -5 Left 915513713 1:156400870-156400892 CCAACAAGGGGCCTCTCTTCCCC No data
Right 915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG No data
915513708_915513715 15 Left 915513708 1:156400850-156400872 CCTCCGGCACTATGAATGGGCCA No data
Right 915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG No data
915513709_915513715 12 Left 915513709 1:156400853-156400875 CCGGCACTATGAATGGGCCAACA No data
Right 915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915513715 Original CRISPR TCCCCACAGCTTCTCCACAA AGG Intergenic
No off target data available for this crispr