ID: 915520096

View in Genome Browser
Species Human (GRCh38)
Location 1:156436883-156436905
Sequence TTCGGCAGCTTGGAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915520096_915520104 16 Left 915520096 1:156436883-156436905 CCTTTTCTTTCCAAGCTGCCGAA No data
Right 915520104 1:156436922-156436944 TACGTTCCCAGTAGAGGGTAGGG No data
915520096_915520101 10 Left 915520096 1:156436883-156436905 CCTTTTCTTTCCAAGCTGCCGAA No data
Right 915520101 1:156436916-156436938 AGACGCTACGTTCCCAGTAGAGG No data
915520096_915520102 11 Left 915520096 1:156436883-156436905 CCTTTTCTTTCCAAGCTGCCGAA No data
Right 915520102 1:156436917-156436939 GACGCTACGTTCCCAGTAGAGGG No data
915520096_915520105 21 Left 915520096 1:156436883-156436905 CCTTTTCTTTCCAAGCTGCCGAA No data
Right 915520105 1:156436927-156436949 TCCCAGTAGAGGGTAGGGCCAGG No data
915520096_915520103 15 Left 915520096 1:156436883-156436905 CCTTTTCTTTCCAAGCTGCCGAA No data
Right 915520103 1:156436921-156436943 CTACGTTCCCAGTAGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915520096 Original CRISPR TTCGGCAGCTTGGAAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr