ID: 915522029

View in Genome Browser
Species Human (GRCh38)
Location 1:156452023-156452045
Sequence CATGCTTCAGTACGATGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522029_915522033 23 Left 915522029 1:156452023-156452045 CCACTACATCGTACTGAAGCATG No data
Right 915522033 1:156452069-156452091 TTCCTCCTTTGGTACTATACTGG No data
915522029_915522031 -10 Left 915522029 1:156452023-156452045 CCACTACATCGTACTGAAGCATG No data
Right 915522031 1:156452036-156452058 CTGAAGCATGTATGATTTGAGGG No data
915522029_915522036 28 Left 915522029 1:156452023-156452045 CCACTACATCGTACTGAAGCATG No data
Right 915522036 1:156452074-156452096 CCTTTGGTACTATACTGGAGAGG No data
915522029_915522032 12 Left 915522029 1:156452023-156452045 CCACTACATCGTACTGAAGCATG No data
Right 915522032 1:156452058-156452080 GTGAAAAAGAGTTCCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522029 Original CRISPR CATGCTTCAGTACGATGTAG TGG (reversed) Intergenic
No off target data available for this crispr