ID: 915522032

View in Genome Browser
Species Human (GRCh38)
Location 1:156452058-156452080
Sequence GTGAAAAAGAGTTCCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522029_915522032 12 Left 915522029 1:156452023-156452045 CCACTACATCGTACTGAAGCATG No data
Right 915522032 1:156452058-156452080 GTGAAAAAGAGTTCCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522032 Original CRISPR GTGAAAAAGAGTTCCTCCTT TGG Intergenic
No off target data available for this crispr