ID: 915522781

View in Genome Browser
Species Human (GRCh38)
Location 1:156457518-156457540
Sequence TGCGGTCCCCGCCTTCGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522781_915522786 17 Left 915522781 1:156457518-156457540 CCCCTACGAAGGCGGGGACCGCA No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522781 Original CRISPR TGCGGTCCCCGCCTTCGTAG GGG (reversed) Intergenic
No off target data available for this crispr