ID: 915522782

View in Genome Browser
Species Human (GRCh38)
Location 1:156457519-156457541
Sequence GTGCGGTCCCCGCCTTCGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522782_915522786 16 Left 915522782 1:156457519-156457541 CCCTACGAAGGCGGGGACCGCAC No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522782 Original CRISPR GTGCGGTCCCCGCCTTCGTA GGG (reversed) Intergenic