ID: 915522783

View in Genome Browser
Species Human (GRCh38)
Location 1:156457520-156457542
Sequence AGTGCGGTCCCCGCCTTCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522783_915522786 15 Left 915522783 1:156457520-156457542 CCTACGAAGGCGGGGACCGCACT No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522783 Original CRISPR AGTGCGGTCCCCGCCTTCGT AGG (reversed) Intergenic