ID: 915522784 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:156457536-156457558 |
| Sequence | TTGTTTGGTCTCATAAAGTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915522784_915522786 | -1 | Left | 915522784 | 1:156457536-156457558 | CCGCACTTTATGAGACCAAACAA | No data | ||
| Right | 915522786 | 1:156457558-156457580 | AACTGCCCGAGCGAAGCCCTTGG | No data | ||||
| 915522784_915522790 | 15 | Left | 915522784 | 1:156457536-156457558 | CCGCACTTTATGAGACCAAACAA | No data | ||
| Right | 915522790 | 1:156457574-156457596 | CCCTTGGAGCTCTAAATACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915522784 | Original CRISPR | TTGTTTGGTCTCATAAAGTG CGG (reversed) | Intergenic | ||