ID: 915522784

View in Genome Browser
Species Human (GRCh38)
Location 1:156457536-156457558
Sequence TTGTTTGGTCTCATAAAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522784_915522786 -1 Left 915522784 1:156457536-156457558 CCGCACTTTATGAGACCAAACAA No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data
915522784_915522790 15 Left 915522784 1:156457536-156457558 CCGCACTTTATGAGACCAAACAA No data
Right 915522790 1:156457574-156457596 CCCTTGGAGCTCTAAATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522784 Original CRISPR TTGTTTGGTCTCATAAAGTG CGG (reversed) Intergenic