ID: 915522786

View in Genome Browser
Species Human (GRCh38)
Location 1:156457558-156457580
Sequence AACTGCCCGAGCGAAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915522783_915522786 15 Left 915522783 1:156457520-156457542 CCTACGAAGGCGGGGACCGCACT No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data
915522784_915522786 -1 Left 915522784 1:156457536-156457558 CCGCACTTTATGAGACCAAACAA No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data
915522782_915522786 16 Left 915522782 1:156457519-156457541 CCCTACGAAGGCGGGGACCGCAC No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data
915522781_915522786 17 Left 915522781 1:156457518-156457540 CCCCTACGAAGGCGGGGACCGCA No data
Right 915522786 1:156457558-156457580 AACTGCCCGAGCGAAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915522786 Original CRISPR AACTGCCCGAGCGAAGCCCT TGG Intergenic