ID: 915524211

View in Genome Browser
Species Human (GRCh38)
Location 1:156466357-156466379
Sequence TTACAATTACAGTAGCCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915524207_915524211 18 Left 915524207 1:156466316-156466338 CCTGGACTGTTACACCGCTAACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 915524211 1:156466357-156466379 TTACAATTACAGTAGCCAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 155
915524210_915524211 -9 Left 915524210 1:156466343-156466365 CCAAAGGTCGCTATTTACAATTA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 915524211 1:156466357-156466379 TTACAATTACAGTAGCCAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 155
915524209_915524211 4 Left 915524209 1:156466330-156466352 CCGCTAACGTTTTCCAAAGGTCG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915524211 1:156466357-156466379 TTACAATTACAGTAGCCAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915524211 Original CRISPR TTACAATTACAGTAGCCAAG AGG Exonic
909106813 1:71420814-71420836 TTAATATTAAAGTAGCCAATAGG + Intronic
909866887 1:80685362-80685384 TTACAATGACAGAAGGCAAAGGG + Intergenic
910179789 1:84469692-84469714 TTCCAATCACAAGAGCCAAGAGG - Intergenic
912179258 1:107197845-107197867 TTAAAATAACAGTGGCCAGGTGG - Intronic
912259717 1:108098288-108098310 TTGCCACTAGAGTAGCCAAGAGG + Intergenic
915524211 1:156466357-156466379 TTACAATTACAGTAGCCAAGAGG + Exonic
918277943 1:182972314-182972336 TTACAATTACAGTAACTAGCTGG + Intergenic
1063149971 10:3327930-3327952 TGTCATTCACAGTAGCCAAGAGG + Intergenic
1063384755 10:5609125-5609147 TTACCATTTAAGGAGCCAAGTGG - Intergenic
1064192945 10:13223326-13223348 CAACAGTTACAGCAGCCAAGAGG + Intronic
1064956479 10:20916563-20916585 TTACAAAAAAATTAGCCAAGTGG - Intronic
1066293367 10:34033925-34033947 TTACAATTACCCTAGCTCAGAGG + Intergenic
1068114531 10:52722828-52722850 TTACAATGACAGTACCAAGGGGG + Intergenic
1072244368 10:93529043-93529065 TCTCATTTACAGTAGCCCAGTGG - Exonic
1074674120 10:115828694-115828716 TTACTATTTCAGTGGCCTAGGGG + Intronic
1074885301 10:117688677-117688699 TTACACTTACATTAACCTAGTGG - Intergenic
1079310551 11:19361773-19361795 TTTCAATTACCGTAGGCAAAGGG - Intronic
1079802607 11:24889097-24889119 TTCCACTTACAGAAGCCAAAAGG + Intronic
1080197465 11:29629251-29629273 TTACAATTACACAAGACAAATGG + Intergenic
1081110710 11:39130064-39130086 TTACAATTACAGTGCCAAATAGG + Intergenic
1081226243 11:40526268-40526290 TTACCATTAAAGGAGCAAAGGGG + Intronic
1081479081 11:43467238-43467260 TACCATTCACAGTAGCCAAGAGG + Intronic
1087301583 11:96442524-96442546 TCACAATTACAATATCCAAGAGG + Intronic
1087422552 11:97948748-97948770 TTACAATAAAAGTAGAAAAGTGG + Intergenic
1088002390 11:104897995-104898017 TTTCAATTACAGCAGCAAATGGG - Intergenic
1088311222 11:108462754-108462776 TTACATTTACAGTAGCAATATGG + Intronic
1092755153 12:11756455-11756477 GTACAATTACAGTAGACAGGTGG + Intronic
1093066122 12:14660042-14660064 ACACAGTTACAGGAGCCAAGCGG + Intronic
1093353593 12:18134875-18134897 TAACAATTACAGAAGCAGAGGGG + Intronic
1094539808 12:31353602-31353624 TAAAAATTACAGCAGCCATGAGG - Intergenic
1095770532 12:45950826-45950848 TTACATAGACAGTAACCAAGTGG + Intronic
1097716761 12:62974824-62974846 TTACAGTTTCAGCATCCAAGGGG - Intergenic
1104552239 12:129767762-129767784 CTACACTCACAATAGCCAAGAGG - Intronic
1106887122 13:34199081-34199103 TACCATTTACAATAGCCAAGAGG + Intergenic
1108442585 13:50470890-50470912 AAACAATCACAGTGGCCAAGGGG + Intronic
1108623845 13:52208881-52208903 CTACAGTTACAGCAGCCTAGAGG - Intergenic
1108662871 13:52602136-52602158 CTACAGTTACAGCAGCCTAGAGG + Intergenic
1110422783 13:75332285-75332307 TCACAATTACATGAGGCAAGTGG + Intronic
1112534777 13:100241809-100241831 TACCATTTACAATAGCCAAGAGG - Intronic
1116671506 14:47848026-47848048 TTACAACTACAGTAACCCAGTGG + Intergenic
1116671516 14:47848117-47848139 TTACAACTACAGTAACCCAGTGG + Intergenic
1117532699 14:56674949-56674971 TTGCCATGACAGAAGCCAAGAGG + Intronic
1118308158 14:64673429-64673451 TTACAATGACAGTCGTCATGGGG - Intergenic
1121904886 14:97730638-97730660 TGAAAATGACAGTAGCCAGGTGG - Intergenic
1121946428 14:98127036-98127058 TTACAATTACAGTATCACAGTGG + Intergenic
1123835198 15:24182918-24182940 ATATAAATACAGTTGCCAAGAGG - Intergenic
1123849955 15:24344274-24344296 ATATAAATACAGTTGCCAAGAGG - Intergenic
1123854893 15:24398829-24398851 ATATAAATACAGTTGCCAAGAGG - Intergenic
1124571262 15:30866258-30866280 TTACAATTTCAGAAATCAAGGGG - Intergenic
1126688551 15:51269119-51269141 TTACACTTACAGAAGAAAAGAGG - Intronic
1127660874 15:61098794-61098816 TTCCAATAACAGTAATCAAGAGG - Intronic
1130627809 15:85534000-85534022 TTAGAATTACTGTAGGAAAGTGG + Intronic
1131639670 15:94278411-94278433 TTACAATTAGATTATCCAAATGG + Intronic
1135582047 16:23636801-23636823 TTAAAATTACTTGAGCCAAGGGG - Intronic
1136654199 16:31700128-31700150 TGTCATTTACAGTAGCCTAGTGG - Intergenic
1137536074 16:49327243-49327265 TTGGAATTACTTTAGCCAAGGGG - Intergenic
1137750197 16:50855803-50855825 TTTTTATTACAGTAGCCAAAAGG - Intergenic
1138028003 16:53538078-53538100 GTACACACACAGTAGCCAAGTGG + Intergenic
1140692043 16:77493889-77493911 TTGCAATTACAGGAGCTATGAGG + Intergenic
1140842370 16:78851938-78851960 TTACAGGTACAGAAACCAAGAGG - Intronic
1141955918 16:87371241-87371263 CTGCAATGACAGTAGCCATGTGG + Intronic
1142646729 17:1318683-1318705 TTATATTTACAATAGCCAAAAGG - Intergenic
1144486676 17:15671847-15671869 TTTCAGTTACAGTGGCCAAGAGG + Intronic
1144552229 17:16251117-16251139 TTTCAAATACAGTAACAAAGTGG - Intronic
1144914344 17:18710450-18710472 TTTCAGTTACAGTGGCCAAGAGG - Intronic
1149277836 17:55064399-55064421 TTATAATTACAGTAGTGAAAGGG - Intronic
1153109517 18:1567815-1567837 TTACATTTACTGTACCCATGTGG + Intergenic
1154000850 18:10481257-10481279 CATCAATCACAGTAGCCAAGAGG + Intronic
1155152207 18:23132210-23132232 TCACACTTACAGTAGACAAAAGG + Intergenic
1157645724 18:49267962-49267984 TTACAACTACAGTTGCCATTGGG + Intronic
1157656380 18:49393370-49393392 CTCCACTAACAGTAGCCAAGAGG + Intronic
1162621315 19:11846758-11846780 TTACAATTAGACCATCCAAGGGG + Intergenic
1162630330 19:11922753-11922775 TTACAATTAGACCATCCAAGGGG + Intergenic
1162635250 19:11963026-11963048 TTACAATTAGACCATCCAAGGGG + Intronic
1164649172 19:29879680-29879702 TCACAGTTACTGTAGCCCAGGGG + Intergenic
1164690573 19:30208075-30208097 CTACAAATAAAGTAACCAAGTGG - Intergenic
933009656 2:77043857-77043879 TTACAATTAAAATAGCAAAATGG + Intronic
934061166 2:88295567-88295589 TTACAATTTCATTAGGGAAGGGG + Intergenic
940102049 2:150052231-150052253 ATACAAATACAGTATCTAAGTGG + Intergenic
940666053 2:156611184-156611206 TTGCAGTTTCAGTAGCCTAGAGG + Intronic
942737667 2:179134321-179134343 TTATAATAACAATAGCCAAGTGG - Intronic
943095578 2:183424926-183424948 TTCCAGTTACAGTAGACATGTGG + Intergenic
944401699 2:199334463-199334485 TTAAAATTACAGAAGGCTAGAGG + Intronic
945003548 2:205377635-205377657 TACCAACTCCAGTAGCCAAGTGG + Intronic
946408184 2:219503579-219503601 TTAGACTCACAGTAACCAAGAGG - Intronic
947635718 2:231680019-231680041 TTACAACTGCAGGAGCCACGTGG + Intergenic
1170385736 20:15814393-15814415 TTAGAATTATGGCAGCCAAGAGG - Intronic
1177305190 21:19306418-19306440 TTTCAATTACAATATCAAAGAGG + Intergenic
1183663266 22:39233801-39233823 GTTCACTTACAGTAGCAAAGGGG - Intronic
953790808 3:45946523-45946545 TTTCAATGACAGCAGCCAGGAGG + Exonic
953804413 3:46055691-46055713 TTACAGTTACAGTACCTCAGAGG + Intergenic
955721733 3:61889170-61889192 TTACTATTATGGTTGCCAAGTGG + Intronic
958922008 3:100117760-100117782 TTACCATCACAATAGCCAAAAGG + Intronic
959666876 3:108932510-108932532 TCACAACTACAGTAGCCACTTGG - Intronic
962092055 3:132254785-132254807 TCAGAATTACAGAAGCCAAATGG + Intronic
964858892 3:161178616-161178638 TTGCAATTAAAATAGCAAAGAGG + Intronic
965136521 3:164778603-164778625 TTACAATTACTTTTGCCAAAAGG + Intergenic
968677914 4:1895201-1895223 GCACTATTACAGTAGCCAAAAGG - Intronic
971308000 4:25500650-25500672 TTACAAGCAGAGAAGCCAAGAGG - Intergenic
971964915 4:33540877-33540899 TGACAGTTAAAGTAACCAAGTGG - Intergenic
972091278 4:35287909-35287931 TGACAATGACAGTTGACAAGAGG + Intergenic
972120507 4:35695968-35695990 TTACACTGAGAGTAGCCATGTGG + Intergenic
975423987 4:74205068-74205090 TTAGAATTACAGTAACTAAAAGG + Intronic
976499006 4:85764798-85764820 TGAGAATTACAGTAACGAAGAGG - Intronic
977982951 4:103347473-103347495 TAAAAATTACATTAGCCAAGGGG - Intergenic
979225223 4:118277430-118277452 TTAAAAAAAAAGTAGCCAAGTGG + Intergenic
979910120 4:126354626-126354648 TTTCTATTACAGAAGCCCAGAGG - Intergenic
981122057 4:141063588-141063610 TTACATTTCCAGTAGCCACCTGG + Intronic
984349992 4:178578114-178578136 GTACAATGACAGAAGCCAGGTGG + Intergenic
984940426 4:184927297-184927319 TTACAATTACAGTCTCAGAGAGG - Intergenic
985864096 5:2498556-2498578 TAATCTTTACAGTAGCCAAGCGG + Intergenic
986640021 5:9863036-9863058 GTACACTTCCAGTAGCCAACAGG + Intergenic
986818757 5:11441924-11441946 TAAAAATTACAGTAGCAAACAGG + Intronic
989358802 5:40575579-40575601 TAACAGTTACAGCAGCCAAAGGG - Intergenic
991399936 5:66241527-66241549 TTCCATTTGCAGGAGCCAAGGGG - Intergenic
993130959 5:83897745-83897767 TTACAATTACACTATTCAAGAGG + Intergenic
993379181 5:87186446-87186468 TTACAGATACAGTAGCCAGGAGG + Intergenic
994044201 5:95289816-95289838 TTAAAATTAAAGAAGCCATGTGG - Intergenic
994630041 5:102274200-102274222 TTGAAATTACAGTATCCATGGGG - Intronic
994681991 5:102899738-102899760 TTACTATTGCAGTAGGGAAGTGG + Intronic
995883269 5:116866093-116866115 TCACGATTACAGGGGCCAAGGGG - Intergenic
999016610 5:148113136-148113158 TTACAGTCACAACAGCCAAGTGG - Intronic
1001010561 5:168094151-168094173 TAAGAATTACAGGAGCAAAGAGG + Intronic
1001156964 5:169280906-169280928 CCACAAATACAATAGCCAAGAGG + Intronic
1004052937 6:12107074-12107096 TTAAAATTTAAGTAGCCAATAGG + Intronic
1007297858 6:40840992-40841014 TAACATTTACAGTAGAAAAGAGG - Intergenic
1008990373 6:57594858-57594880 TTACAATTACATTTGACAAAAGG + Intronic
1009178950 6:60493405-60493427 TTACAATTACATTTGACAAAAGG + Intergenic
1009879764 6:69552146-69552168 TTACTATTATAATAGCCAACAGG + Intergenic
1011282769 6:85693089-85693111 GACCAATTACTGTAGCCAAGTGG - Intergenic
1011313810 6:86009412-86009434 TTACTATGACAGTTGCAAAGTGG - Intergenic
1014100260 6:117503863-117503885 AGACAATTACAGTACCAAAGGGG + Exonic
1014774715 6:125495067-125495089 ATAAAATTATAATAGCCAAGTGG + Intergenic
1017702248 6:157086112-157086134 TAACAATTACAGTAGGATAGCGG + Intronic
1018555967 6:165050897-165050919 TTCCAATTAGAGTTGTCAAGAGG - Intergenic
1021597890 7:22336547-22336569 TTTTAAGTACAGTGGCCAAGGGG + Intronic
1034940960 7:155230023-155230045 TTACTATAACAGATGCCAAGAGG - Intergenic
1037268968 8:17104580-17104602 TTAAAATTAAAGTAACAAAGAGG - Intronic
1040424966 8:47276535-47276557 GGACAAATACAGTAACCAAGGGG + Intronic
1040587023 8:48753525-48753547 TAAGAGTTACAGTAGGCAAGGGG + Intergenic
1043267267 8:78282185-78282207 TAACAATTGCAGCAGACAAGGGG - Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1043676461 8:82962005-82962027 GTACAATTTCAGCAACCAAGTGG - Intergenic
1043964254 8:86454145-86454167 TTACAATTACAGTATATAATAGG + Intronic
1044363319 8:91313872-91313894 AAACAATTATATTAGCCAAGCGG - Intronic
1048630618 8:136238474-136238496 TTACAGTTACATTAGCCATCTGG - Intergenic
1049151248 8:141036862-141036884 TCACATTTACAGGAACCAAGGGG + Intergenic
1049941490 9:550213-550235 TTAAAATTACAGTATCCCTGGGG - Intronic
1050150688 9:2616851-2616873 AACCAATTACAGTAGCTAAGGGG + Intergenic
1050406488 9:5314153-5314175 TTTCAAATGCAGTAGCCACGTGG - Intergenic
1051378659 9:16432161-16432183 TAACAAATTCAGAAGCCAAGAGG - Intronic
1051592248 9:18788215-18788237 CAAAAATTACAGTAGCCCAGAGG - Intronic
1051812154 9:21061430-21061452 TTACCATTACAGAAACCCAGAGG - Intergenic
1052015897 9:23465933-23465955 TCACAATAACAGTACACAAGTGG + Intergenic
1052125692 9:24771905-24771927 TTACAATTTCATTAGTCAAAAGG + Intergenic
1053076951 9:35141484-35141506 TTGCATTTACAGCAGCCAACAGG - Intergenic
1056142665 9:83698511-83698533 TTAAAATTACAATAGCCAAAAGG + Intronic
1056187793 9:84153143-84153165 TCACTATTTGAGTAGCCAAGAGG - Intergenic
1056187800 9:84153341-84153363 TCACTATTTGAGTAGCCAAGAGG - Intergenic
1058507102 9:105677188-105677210 TTACAAATTGATTAGCCAAGAGG - Intergenic
1058936631 9:109775492-109775514 TAACAACCACAGGAGCCAAGAGG + Intronic
1060804480 9:126565834-126565856 TTACAAATAGTGTGGCCAAGGGG + Intergenic
1185719910 X:2373258-2373280 TTACAATTCCAGGTGCCATGTGG + Intronic
1185857892 X:3552967-3552989 TCACCATCACACTAGCCAAGTGG - Intergenic
1186167952 X:6846772-6846794 TTACCCTTACAATAGCCATGAGG + Intergenic
1189596095 X:42567021-42567043 TTGCAATTAAAGAAGTCAAGGGG - Intergenic
1190243338 X:48674855-48674877 ATACAATTAAAGAAGGCAAGAGG - Intergenic
1194776745 X:97974459-97974481 TTATAATTACATTTGACAAGTGG - Intergenic
1197670986 X:129277116-129277138 TTACAATTCCAGAAGCCAACAGG + Intergenic