ID: 915526045

View in Genome Browser
Species Human (GRCh38)
Location 1:156476933-156476955
Sequence GGAAAGAGCAGACCTCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915526045_915526052 16 Left 915526045 1:156476933-156476955 CCTGCTAGAGGTCTGCTCTTTCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 915526052 1:156476972-156476994 CATTCCCCAGCCCCCACCCTTGG 0: 1
1: 0
2: 4
3: 93
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915526045 Original CRISPR GGAAAGAGCAGACCTCTAGC AGG (reversed) Intronic
902155207 1:14479480-14479502 GCAGAGAGCAAACCACTAGCAGG - Intergenic
903689265 1:25159742-25159764 GGAAAGGGCAGACCACAAGTTGG + Intergenic
903832404 1:26183074-26183096 GGCAAGAGCTGACCCCAAGCTGG - Intronic
904747221 1:32718648-32718670 GGGAAGAGCAGGCCTCTGGGAGG + Intergenic
907400765 1:54223487-54223509 GGCCAGAGCAGGGCTCTAGCGGG - Intronic
915526045 1:156476933-156476955 GGAAAGAGCAGACCTCTAGCAGG - Intronic
916209316 1:162347092-162347114 GGACACATCAGACCTCTAGCTGG + Intronic
917074077 1:171185394-171185416 GAAAAGCTCAGAACTCTAGCTGG + Intronic
918087418 1:181257538-181257560 GGATAGAGCAGACTTCTTGGAGG - Intergenic
918404479 1:184198030-184198052 GGAGAGAGCAGGGCTCTAGGGGG + Intergenic
1063639922 10:7818977-7818999 GGAAACAGCAGATCTCGAGGCGG - Intronic
1068468383 10:57426722-57426744 GGAAAGATCAGACCTCTCTTTGG - Intergenic
1068644112 10:59446439-59446461 GGAAAGAGCAGGCATTCAGCTGG - Intergenic
1069562618 10:69441495-69441517 GGACACAGTAGAACTCTAGCAGG + Intergenic
1070518359 10:77228731-77228753 GGAAAGAGCAAAGCAGTAGCCGG - Intronic
1070983728 10:80670249-80670271 GCAAAGACCAGACCTCTTGTTGG + Intergenic
1071088499 10:81892181-81892203 GGCAATAGCACACCTATAGCTGG - Intronic
1071488856 10:86122500-86122522 GGAATGAGCAGCCCTGGAGCTGG + Intronic
1071605078 10:86980339-86980361 GCAGAGAGCAGATCTGTAGCAGG + Intronic
1078566862 11:12422658-12422680 GGAAAGAGAAGGACACTAGCAGG - Intronic
1082857009 11:57817162-57817184 GGAAGAAGAAGACCTCTAGGAGG + Exonic
1086226041 11:84510947-84510969 CGAAAGAGGAGACCCCTACCAGG + Intronic
1088047696 11:105473495-105473517 GGAAAGAGCAGTCCTCAGACAGG + Intergenic
1088367719 11:109056679-109056701 GGAAAGAGCAGACATCTCCCTGG + Intergenic
1090074891 11:123574096-123574118 AGAAAGAGCAGGACTCCAGCAGG + Intronic
1093016880 12:14163788-14163810 GGAAAGAGTAGTTCCCTAGCAGG - Intergenic
1093778644 12:23107649-23107671 GGAAAGAGCATGCCTCAAGGGGG + Intergenic
1098703991 12:73664691-73664713 GGTAGGAGCAGAACTCTAGCTGG + Intergenic
1101427556 12:104600351-104600373 GGAGTGACCAGACCTCAAGCAGG - Intronic
1101722488 12:107362230-107362252 GGAAACTGCAGACCTCAACCTGG + Intronic
1102502067 12:113359464-113359486 GGGAGGAGCAGAGCCCTAGCAGG - Intronic
1102549956 12:113684336-113684358 CGAAAGCCCAGACCTCCAGCTGG - Intergenic
1103283937 12:119784685-119784707 GGAAGAAGCAGACATCTGGCTGG + Intronic
1105558515 13:21468355-21468377 AGAAGGAACATACCTCTAGCTGG - Intergenic
1105779548 13:23695084-23695106 GGAAAGGGCAGGCCCCTAGGAGG + Intergenic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1109865387 13:68257344-68257366 GGAAGGAGAAGACCGCAAGCTGG - Intergenic
1113443807 13:110350344-110350366 GGAAAAAGAAGAGCTCTAGAAGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1116896294 14:50318201-50318223 GGAAAGAGGAGACCTCTAGTGGG - Intronic
1117102179 14:52361042-52361064 GGAAAGAGCTGAAGTCCAGCTGG + Intergenic
1117447527 14:55818936-55818958 GGAAAGGGCAGACCACCAGGTGG - Intergenic
1119955252 14:78791290-78791312 TGAAAGAGAAAACCCCTAGCAGG - Intronic
1122671785 14:103378397-103378419 GGAAAGGGCAGCCCTCCAGGAGG + Intergenic
1123713331 15:23007571-23007593 GGAATGAGCAGACCTCTGCCGGG + Intronic
1124126932 15:26944916-26944938 GGAGAGAGCACACCTGTGGCTGG + Intronic
1125578350 15:40769624-40769646 GGAAGGAAGAGACCTGTAGCTGG - Intronic
1134094626 16:11411338-11411360 GGAAAGAGAAGGCCTGAAGCTGG + Intronic
1134257592 16:12624954-12624976 GGAAAGAGCCGAGATCTGGCAGG + Intergenic
1135259011 16:20965090-20965112 GAAAAGAGCAGAGCTGAAGCTGG - Exonic
1136286505 16:29247248-29247270 GGAAAGAGCTGAGCTCTTGGTGG - Intergenic
1138337456 16:56264291-56264313 AGAAGGAACAGAGCTCTAGCAGG + Intronic
1138532836 16:57644077-57644099 GCAAAGAGCAGGGCTCTTGCAGG - Intronic
1138536656 16:57663857-57663879 GGAGAGACCAGGCCTCCAGCTGG - Exonic
1139185084 16:64796788-64796810 GGAAAGAGGAGATCTCTTGGGGG + Intergenic
1139291924 16:65867236-65867258 GATAAGAGCAGACATCAAGCTGG + Intergenic
1141451365 16:84105679-84105701 GGGAAGAGAGGACCTCAAGCAGG + Intronic
1142092092 16:88219822-88219844 GGAAAGAGCTGAGCTCTTGGTGG - Intergenic
1143860333 17:9885897-9885919 GTGATGAGCAGAGCTCTAGCTGG - Intronic
1144997355 17:19279343-19279365 GGAAGCAGAAGACCTCCAGCTGG - Intronic
1146925560 17:36742557-36742579 GGCAAGAGAAGACCCCCAGCTGG + Intergenic
1147213778 17:38887366-38887388 AGAAAGGGAAGATCTCTAGCAGG - Intronic
1148546195 17:48520807-48520829 GGACAGAGAAGACCTCCTGCAGG - Intergenic
1149613349 17:57975283-57975305 GGGAAGAGCCAACCTCCAGCAGG + Intronic
1151566496 17:74901362-74901384 GGAGAGAGCCAGCCTCTAGCTGG + Intergenic
1151731510 17:75914214-75914236 GGAGAGAGCAGCCCTGGAGCAGG - Exonic
1152247000 17:79190085-79190107 GGAAAGAGGTGACCTCAAACAGG - Intronic
1153412423 18:4808789-4808811 GAAAAGAACAGACCTACAGCGGG - Intergenic
1154502896 18:15005368-15005390 GGACAGAGCAGATCTGTGGCTGG - Intergenic
1156557989 18:38089132-38089154 AGAAAGAGCACACATTTAGCAGG - Intergenic
1158972063 18:62677741-62677763 GGCAAGAGCAAACCTATTGCAGG - Intergenic
1159171338 18:64772166-64772188 GTAAAGAGCTAGCCTCTAGCAGG - Intergenic
1160339227 18:78072534-78072556 TTAAAGAGCAGAGCTCTCGCCGG - Intergenic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1162296688 19:9818759-9818781 GGTAAGAGAAGATCTCGAGCAGG + Exonic
1163189184 19:15664015-15664037 GAGAAGTGCAAACCTCTAGCTGG + Intergenic
1163471498 19:17500050-17500072 GTCAAGAGAAGACCTCTGGCTGG - Intronic
1164985810 19:32647668-32647690 GGGGTGAGCAGATCTCTAGCAGG - Intronic
926017903 2:9470446-9470468 GGAAACAGCAGTCCACCAGCAGG - Intronic
926290439 2:11525067-11525089 GGGAAGAACAGACCTCTACTGGG + Intergenic
928748771 2:34447113-34447135 GGAATGTGAAGACTTCTAGCAGG - Intergenic
929443447 2:41984384-41984406 GGAAAGAGCAAACCTTGAACTGG - Intergenic
931045867 2:58352323-58352345 GTAAAGAGCAGACCCCAGGCAGG - Intergenic
931492143 2:62759698-62759720 GGAAAAAGCACACCACTGGCTGG - Intronic
932279549 2:70478087-70478109 GGACAGAACAGACCTTAAGCTGG - Intronic
936062339 2:109303306-109303328 GGAAAGAGCTTGCCTCTGGCAGG + Intronic
936580317 2:113694585-113694607 GTAAAGAGCAGACCTCACACGGG - Intergenic
936986780 2:118318987-118319009 GGAAAGAACTGACCTATAGTTGG - Intergenic
938502060 2:131835538-131835560 GGACAGAGCAGATCTGTGGCTGG - Intergenic
941680715 2:168395803-168395825 GGAAAGACAAGAACTCTATCTGG - Intergenic
944138621 2:196429817-196429839 GGAAAGAAAAGAGCTCTAGAAGG + Intronic
1168922777 20:1554194-1554216 GGACAGAGCAGACATATTGCAGG + Intronic
1172360838 20:34311754-34311776 GGAAAGGAGAGACCCCTAGCGGG - Intronic
1172573997 20:35992790-35992812 GAAAAGAGCAGTCCTTTAGAGGG - Intronic
1173557625 20:43977796-43977818 GGAAAGAACTGACCTCTACCAGG - Intronic
1174093014 20:48064632-48064654 GGAAAGAGTGGCCCCCTAGCAGG - Intergenic
1175966692 20:62663362-62663384 GGAAAGAGCCGCCCTCCTGCAGG + Intronic
1178743235 21:35223134-35223156 GAAAAGACCACACCACTAGCAGG + Intronic
1178877102 21:36421962-36421984 GGGAAGAGAAGACCTGGAGCAGG - Intergenic
1179243349 21:39610564-39610586 GGACAGAGCAGACCACTGCCTGG + Intronic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1184978679 22:48081003-48081025 GGAGAGAACAGGCCTCTAGGAGG - Intergenic
950562957 3:13746357-13746379 GGAAGGAGCTGACTTCTGGCAGG + Intergenic
951395340 3:22158544-22158566 GGAAAGAGAAGACATGTATCTGG + Intronic
952569132 3:34693383-34693405 GGAAAGAGCAGAATACTAACTGG - Intergenic
952672372 3:35985770-35985792 GAAAAGAGTAGACCTAAAGCAGG - Intergenic
954143147 3:48620782-48620804 GGAAAGAGCAGACCTGGCCCAGG + Exonic
960692975 3:120366548-120366570 GGAAAGAGAAGACATCAAACAGG + Intergenic
966940034 3:184740525-184740547 GGGAAGAGCACACCCCTAGAAGG - Intergenic
967893271 3:194378475-194378497 GGAAAGAGCACATCGCTAGGGGG - Intergenic
978549634 4:109911657-109911679 GGAAAGAGAAGTCCTTTAGGTGG - Intergenic
978599667 4:110414536-110414558 GGTAAGAGCAGACCTCTCCATGG - Intronic
983030528 4:162795972-162795994 GGAAAGCACAGACATCTTGCTGG - Intergenic
984140533 4:176000093-176000115 GAAAAGAGCAGGCCTGTAGCAGG - Intronic
984396751 4:179211524-179211546 AGAAAGAGCAGAAGCCTAGCTGG - Intergenic
986748441 5:10763754-10763776 GGAAGGAGCAGAGCTCCAGAGGG + Intergenic
988041139 5:25890360-25890382 GGAAAGAGTAAACCACTTGCTGG - Intergenic
989289624 5:39748132-39748154 GGAAGGTGCAGACATCTAGGTGG + Intergenic
990288710 5:54327183-54327205 GGAAAGAGAAGACCATTAGCTGG - Intergenic
998148362 5:139743276-139743298 GGACAGAGCAGACGTCTCTCTGG + Intergenic
998161019 5:139813094-139813116 GAAAAGAGCAGACCTGGGGCCGG - Intronic
998261171 5:140632985-140633007 GGAGAGAGCAGAGGTCTAGGAGG + Intronic
1001144297 5:169170368-169170390 AGGAAGAGCAGGCCCCTAGCAGG - Intronic
1006775643 6:36590401-36590423 GGAAATAGCACACCTCTCTCTGG + Intergenic
1006794664 6:36724064-36724086 GGGAAGAGGAAACCTATAGCAGG + Intronic
1014180386 6:118377982-118378004 GGAAAGAGCAGAGCCCCTGCTGG + Intergenic
1016090727 6:139975882-139975904 GGAAGGAGCAGAGCACTAGGAGG - Intergenic
1016428832 6:143962059-143962081 TGAAAGAGGAGAACTCTGGCAGG + Intronic
1017410764 6:154165602-154165624 AGAAAGAGCAGTTCCCTAGCTGG + Intronic
1020725498 7:11808313-11808335 AGAAAGAGCAGACCTCTCTGTGG - Intronic
1023939012 7:44758181-44758203 GTAAAGAGCAGGCTTCTGGCTGG + Intronic
1027811424 7:82905214-82905236 GGAAAGAACAGCCCTCTTTCTGG - Intronic
1028264866 7:88710591-88710613 GGAAATAGAAGACCTCCAGGGGG - Intergenic
1029284448 7:99456152-99456174 TGAAAGAGCAGGTCGCTAGCAGG + Intronic
1033041704 7:137925161-137925183 GGAAAGAGAAGAGTTCTAGTGGG + Intronic
1037590279 8:20306185-20306207 GGAAAGAGCAGACTCCTGGAAGG + Intergenic
1045941379 8:107742835-107742857 TGAAAGAGAAGACCTCAAGGAGG - Intergenic
1048443918 8:134479225-134479247 GGAAGGAGCAGACGCCTGGCAGG + Intronic
1048875623 8:138835063-138835085 GGCCAGAGCAGGCCTCTACCTGG - Intronic
1049343035 8:142123968-142123990 GGAAAGGGCAGGCAGCTAGCAGG + Intergenic
1049678807 8:143906151-143906173 GGAAGCAGCAGCCCTCTACCAGG + Intergenic
1050038139 9:1459599-1459621 AGAAACAGCAGACCTCTGGGAGG + Intergenic
1054954605 9:70894321-70894343 GGCTAGAGCAGACCTCTGCCAGG - Intronic
1058069914 9:100591437-100591459 GGAATGGGCAGACCTCTAGTGGG - Intergenic
1061101511 9:128495978-128496000 GGAAAGGGGAGGGCTCTAGCGGG + Intronic
1061592006 9:131603757-131603779 GCAAAGGGCAGACCTCCACCTGG + Intronic
1190435857 X:50424429-50424451 GGAAACAGCAGATATCTAGAAGG + Intronic
1190997382 X:55623657-55623679 TGAAAGAACAGATATCTAGCAGG - Exonic
1191256046 X:58280073-58280095 GGAAGGCGCAGACCTCAGGCGGG + Intergenic
1195244381 X:102982455-102982477 GGAAGAAGCACAGCTCTAGCGGG + Intergenic
1198680034 X:139171427-139171449 GGAAAGAGAATACCTCTTGATGG + Intronic