ID: 915526304

View in Genome Browser
Species Human (GRCh38)
Location 1:156478388-156478410
Sequence TGCCATTCCCAGAGTGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915526304 Original CRISPR TGCCATTCCCAGAGTGGTCC GGG (reversed) Intronic
901527957 1:9835922-9835944 TGCCTTTCCCAGGCTGCTCCGGG - Intergenic
902944407 1:19824392-19824414 TGGCCTTCCCAGAGTTCTCCTGG + Intergenic
904085692 1:27906012-27906034 TGCTAGTCACATAGTGGTCCTGG - Intronic
904206016 1:28855671-28855693 TTCCATTCCCAGAGGGGGCTGGG - Intronic
906098940 1:43243637-43243659 TAACATTCCCAGAGGGGTCTGGG + Intronic
908466689 1:64402974-64402996 TGTCTTTTCCAGAGTGGGCCAGG - Intergenic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
919727477 1:200893668-200893690 TGCTAGCCCCAGAGTGCTCCAGG - Intronic
920380803 1:205533558-205533580 TGGCATTCTCAGAGTGGTCTCGG - Intergenic
920812762 1:209302775-209302797 TACCATTCCCGGATTGGTCGTGG - Intergenic
920827862 1:209438557-209438579 TGCTATTCACAGTGTGATCCAGG - Intergenic
921129811 1:212210019-212210041 AGCCATTCACAGACTGGCCCGGG - Intergenic
921418884 1:214923169-214923191 TGCCTTTCCCAGAGTGGATTTGG + Intergenic
922619052 1:226979518-226979540 TGACATTCCCTGAATGGGCCGGG - Intronic
1065271471 10:24037691-24037713 TACCATTCCCAGAGTGAGACAGG + Intronic
1066106681 10:32163031-32163053 TGCCATTAAAAGTGTGGTCCAGG + Intergenic
1066312217 10:34208468-34208490 TGGCATTCCCCTGGTGGTCCTGG - Intronic
1070153529 10:73819619-73819641 TGCCATTCCCAGTGCGGAGCGGG + Exonic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1076685884 10:132198313-132198335 CCCCATTCCCCAAGTGGTCCTGG - Intronic
1077410237 11:2400457-2400479 TGCAATTCCCAGAATGCTCGAGG - Intergenic
1079304403 11:19309653-19309675 TGTCATTCACAGAGCTGTCCTGG - Intergenic
1081856697 11:46308507-46308529 TCACATTCCCAGAGGGGTCTTGG - Intronic
1085315948 11:75545038-75545060 AGCCATTCCCAGGGTGGCCCTGG - Intergenic
1085531353 11:77194114-77194136 TGCCAGTGCCAGAGGGATCCAGG + Intronic
1085764576 11:79271676-79271698 TGAACTTGCCAGAGTGGTCCTGG + Intronic
1087137468 11:94735218-94735240 TGGCATTCCCAGACTGCTACAGG + Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1090681357 11:129061374-129061396 AGGCATTCCCTGAGTGGTCTTGG - Intronic
1090959863 11:131546664-131546686 TTACATTCCCCCAGTGGTCCAGG - Intronic
1096777157 12:53971333-53971355 TCCCATTCTCAGGGTGGTTCTGG - Intergenic
1097288734 12:57896715-57896737 AGCCCTTCCCAGAGGGGCCCGGG - Intergenic
1101645298 12:106626113-106626135 TGCCACACCAAGAGTGATCCTGG + Intronic
1103237347 12:119384581-119384603 TGCCATTCCCTGCGAGCTCCGGG + Intronic
1104713570 12:131002781-131002803 TCCCCATCCCAGAGTGGACCTGG + Intronic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1112183136 13:97104632-97104654 TGCCATGCCCTGAGAGGTCATGG - Intergenic
1113611081 13:111645469-111645491 TGCCATGCCCAGCCTGGTCCTGG - Intronic
1117018834 14:51548816-51548838 TGCCCTTCTAAGTGTGGTCCTGG + Intronic
1117769188 14:59115246-59115268 TGCCATTCCCAAAGTTGTCTAGG - Intergenic
1118990423 14:70792513-70792535 AAACATTCCCAGAGTGGACCTGG - Intronic
1119263413 14:73251262-73251284 TCCCACTCCCAGTGTGCTCCGGG + Intronic
1121927467 14:97941452-97941474 TGACTTTCCTAGTGTGGTCCTGG - Intronic
1122113312 14:99515973-99515995 TGCCCTTCCCAGAGGGCCCCTGG - Intronic
1122693966 14:103543972-103543994 TGCCAGGCCCAGAGGTGTCCTGG + Intergenic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1128525958 15:68412428-68412450 TGTCATTCCCTGAGTGATTCAGG - Intronic
1133272223 16:4615807-4615829 TGCCAATCACAGAGGGGTTCAGG - Intergenic
1136159965 16:28413602-28413624 TGCCATGCACAGTATGGTCCTGG - Intergenic
1136203123 16:28701690-28701712 TGCCATGCACAGTATGGTCCTGG + Intronic
1137983883 16:53091650-53091672 TCCCATGCCTAGTGTGGTCCTGG + Intronic
1140977452 16:80073769-80073791 TGCCACTCAAAGAGTGGTCTGGG + Intergenic
1144861182 17:18303454-18303476 TTCCATTCCCAGAGACGTGCAGG - Intronic
1148727719 17:49807294-49807316 TGCTTTTCCCAGGATGGTCCTGG + Intronic
1149990516 17:61380668-61380690 TGCCCTCCCTAGAGTGCTCCTGG - Intronic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1152354334 17:79799354-79799376 GGGCCTTCCCAGAGTGGGCCGGG + Intronic
1153502961 18:5767641-5767663 TGCCACTCAAAGTGTGGTCCAGG + Intergenic
1153784111 18:8518956-8518978 TGCCACTTCCAGAGTGGCCATGG - Intergenic
1154289356 18:13093554-13093576 TGCCAGTCCCAGACTTCTCCAGG - Intronic
1155174754 18:23292362-23292384 TGCCATTTCCCCAGTGCTCCTGG + Intronic
1156228986 18:35135866-35135888 TGCCTTTCCCAGAGCCCTCCTGG + Intronic
1156231649 18:35159043-35159065 TGAAGTTCCCAGAGTGTTCCAGG + Intergenic
1157562731 18:48660100-48660122 TGCCATTCCCAGAGGAGCCTGGG - Intronic
1159080002 18:63726117-63726139 TACCATTCCCCGGGTGGTCTGGG + Intronic
1159939154 18:74392810-74392832 TGTTATTCCCTGAGTGTTCCTGG - Intergenic
1162225600 19:9219104-9219126 TACCAGACCCAGAGTGGTCTGGG - Intergenic
1162502485 19:11061780-11061802 TGCCACTTCCTGAGCGGTCCTGG - Exonic
1164614130 19:29656000-29656022 TGCCTTTTCCAGAGTGCCCCTGG - Intergenic
1166966801 19:46533897-46533919 TGCCATCCCCACAGAGGTCCTGG + Intronic
1167939679 19:52936558-52936580 TTCCATTCCCAGAGACGTGCAGG - Intronic
1168158569 19:54492821-54492843 TGCCATGCCAAGACTGGTCAAGG - Intergenic
925251874 2:2445578-2445600 TGCCTTTCACAGAGTGCTGCTGG - Intergenic
926250529 2:11153301-11153323 GGCCACTCCCTGCGTGGTCCTGG + Intergenic
927414823 2:22868205-22868227 TGCCATTCCCTGCTGGGTCCTGG + Intergenic
928095222 2:28400563-28400585 TCCCATCCCCAGAGGGGCCCGGG - Intronic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
932074920 2:68653806-68653828 TGCTGTTACCACAGTGGTCCAGG - Intronic
935282668 2:101532694-101532716 TGCTACTCAAAGAGTGGTCCGGG - Intergenic
935708461 2:105876887-105876909 GGCAAGTCCCTGAGTGGTCCAGG - Intronic
939426520 2:142045218-142045240 TACCATTCCCACAGTGCTTCAGG + Intronic
942099420 2:172564545-172564567 TGTCATTCCCACAATGGCCCAGG + Exonic
942692817 2:178605065-178605087 TAGCATTCCCAAAGCGGTCCGGG - Exonic
944413311 2:199462494-199462516 GCCCTTTCCCAGAGTGCTCCGGG + Intronic
945040791 2:205742293-205742315 TCCCATTCCCAGTGTGTGCCTGG - Intronic
948577352 2:238963509-238963531 TCCCACTCCCAGGGTGGTCTTGG + Intergenic
1170353918 20:15471336-15471358 TGCCATTCCTTGAGTGGAGCAGG - Intronic
1172022505 20:31924427-31924449 TGCCCAGCCCAGAGTGGTGCAGG - Intronic
1173534319 20:43797862-43797884 TCCCATTTCCAGAGTGTACCAGG + Intergenic
1173559007 20:43989049-43989071 TGCTATCCCCAGTGTGGTCATGG + Intronic
1173640921 20:44601314-44601336 TGCCATTCAAAGAGTGGCCCTGG - Intronic
1174146242 20:48454749-48454771 TCCCCTTCCCAGAAGGGTCCTGG + Intergenic
1174364936 20:50050871-50050893 TTCCATTCCCAGAAGGGGCCTGG - Intergenic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1175447258 20:59031947-59031969 TGCCATTCACAAAGGTGTCCAGG + Intronic
1175953769 20:62597562-62597584 TGTGATTCCCGGAGTGATCCGGG - Intergenic
1177061928 21:16386645-16386667 TGCCATTTCCAAAGTAGTGCTGG - Intergenic
1178027302 21:28482947-28482969 CGCCACTCACAGTGTGGTCCTGG + Intergenic
1179495076 21:41766516-41766538 TGACACTCCCCGAGTGGCCCTGG - Intronic
1179558043 21:42193225-42193247 TGCCCTTCCCAGCATGGCCCAGG + Intergenic
1179955325 21:44735102-44735124 GGCCATTCCCAGAGCGGCTCTGG - Intergenic
1181413536 22:22743467-22743489 AGCCATTCAAAGTGTGGTCCTGG - Intronic
1181712189 22:24697595-24697617 TTCCTTTCCCAAAGTGGTCTTGG - Intergenic
1182907726 22:33952515-33952537 TGACATGCTCAGAGTGGCCCCGG + Intergenic
1182996012 22:34812995-34813017 TTCCATCCCCTGAGTGATCCTGG - Intergenic
952416172 3:33093151-33093173 TGCCATGGCCAGAGTAGTGCAGG + Exonic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
953901857 3:46847984-46848006 TCCCCTTCCCAGAGTGGCCCAGG - Intergenic
955912791 3:63874993-63875015 TGCCATTACGAAAGAGGTCCAGG - Intronic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
959737787 3:109680360-109680382 TCCCCTTCCCTGAGTAGTCCTGG + Intergenic
960968335 3:123121069-123121091 AGCCTTTCCCAAAGTGATCCTGG + Intronic
961591519 3:127985073-127985095 TGCCAGCCCCGGAGTGGACCAGG - Exonic
961942123 3:130649112-130649134 TGACATCCCGGGAGTGGTCCAGG - Exonic
967080113 3:186042181-186042203 TGCCATTTCCAGAGTGGCAGAGG - Intergenic
967275975 3:187774868-187774890 TCACATTCCCAGAGTGGGCCTGG + Intergenic
969352570 4:6606263-6606285 CCCCATTCCCAGAGAAGTCCTGG - Intronic
971422389 4:26485545-26485567 TGCCTTGCCCAGAGTGGTTGGGG - Intronic
975019320 4:69467605-69467627 TTTCTTTCCCTGAGTGGTCCTGG - Intergenic
976776347 4:88710423-88710445 TGCCATTACCAGGGTCCTCCTGG + Intergenic
977572917 4:98648417-98648439 TGACACACGCAGAGTGGTCCAGG + Intronic
986182625 5:5407640-5407662 TGCCATCCCCATAGTGTTCCAGG - Intergenic
992989835 5:82273143-82273165 TGCCATCCAAAGAGTGCTCCTGG - Intronic
999104131 5:149054476-149054498 TGCTACTCCAAGTGTGGTCCTGG - Intronic
1002530584 5:179842168-179842190 TGCCTTTCCTAGAGTGGAGCTGG - Intronic
1006019623 6:31110388-31110410 TGCCATGCCTGCAGTGGTCCAGG - Intergenic
1007202479 6:40121519-40121541 TTCCATTCCCTGAGTTGTCTAGG + Intergenic
1009350715 6:62674625-62674647 TCCCATTACCAGAGAGGACCAGG + Intergenic
1010795292 6:80111148-80111170 TTCCATTCCCATAATGGTCGTGG + Intronic
1012942543 6:105430690-105430712 TGCCCTTCCCAGAGTGATGATGG + Intergenic
1015613562 6:135051571-135051593 TGCTTTACCCAGAGTGGTCAGGG - Intronic
1015855483 6:137619778-137619800 TGCCACACCCAGTGTGGACCTGG + Intergenic
1016886590 6:148964950-148964972 TCCCCCTCCCAGAGTGGTCATGG - Intronic
1017051844 6:150400662-150400684 TGCTACTCAAAGAGTGGTCCTGG + Exonic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1020668823 7:11080924-11080946 TGTCATTCCTAGAGTGTTGCTGG + Intronic
1022469084 7:30670932-30670954 TTCCATGCCCAGAGTGGCCCAGG + Intronic
1022795299 7:33727152-33727174 TGCCATTCAAAGTGTGGTCCTGG + Intronic
1023541150 7:41267521-41267543 TGCTACTCACAGTGTGGTCCAGG + Intergenic
1023618696 7:42047865-42047887 TGCCACTCAGAGTGTGGTCCAGG + Intronic
1024260535 7:47571000-47571022 TGTCCCTTCCAGAGTGGTCCAGG - Intronic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1027320472 7:77006912-77006934 GGCCCTGCCCAGGGTGGTCCCGG + Intergenic
1029293161 7:99518074-99518096 TGGTAATCCAAGAGTGGTCCAGG + Intronic
1029317963 7:99731724-99731746 TGTCATTCACAGAGAGGTCTTGG + Intronic
1029319817 7:99748908-99748930 TGTCATTCACAGAGAGGTCTTGG + Intergenic
1029677483 7:102080279-102080301 TGCCATGACCGGGGTGGTCCTGG + Intronic
1034094525 7:148394791-148394813 TGCCACTCCCAGTGTGTTCCAGG - Intronic
1038198497 8:25390056-25390078 TCCCATTTTCAGTGTGGTCCTGG + Intronic
1038318580 8:26508506-26508528 GGCCATTCCCAGTGAGGTCCAGG - Exonic
1039597868 8:38807098-38807120 TGGCATTCCCAGAGAGGGCATGG - Intronic
1039977313 8:42378390-42378412 TGCCATTCCGAGGGTGATGCAGG + Intergenic
1041858254 8:62482387-62482409 TGGCAATCCCAGACTGGTGCCGG + Intronic
1044724819 8:95185687-95185709 TGCCTTTTCCATAATGGTCCTGG - Intergenic
1045241866 8:100409720-100409742 AGCCATAAGCAGAGTGGTCCTGG + Intronic
1045556423 8:103218838-103218860 TGTCTTTCCCAGACTGGGCCAGG - Intronic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1056028105 9:82521914-82521936 TGCCACTCATAGTGTGGTCCAGG - Intergenic
1056412518 9:86345061-86345083 TGCCATTGACAAAGTGGTACAGG - Exonic
1056989357 9:91395855-91395877 TGCTATTCAAAGTGTGGTCCAGG - Intergenic
1057730657 9:97605448-97605470 TGCCATGCCCACAGTGCCCCGGG + Intronic
1061482787 9:130905336-130905358 TGCCATTCTCAAAGTCCTCCAGG + Exonic
1062145586 9:134988015-134988037 TGCCATTCCCAGGGTGGGGAAGG - Intergenic
1187521850 X:20021099-20021121 TGCCTTCCCCAGGGTGGACCCGG + Intronic
1192005255 X:67204776-67204798 TGCCCTCGCCTGAGTGGTCCAGG - Intergenic
1192975584 X:76280693-76280715 TCCCATCCCCAGACTGGCCCCGG + Intergenic
1193705798 X:84819591-84819613 TTCCTTTCCCTGAGTGGCCCTGG + Intergenic
1199986705 X:152957969-152957991 TCCCTTTCCCTGAGTGGCCCTGG + Intronic
1200937307 Y:8749435-8749457 TGCCTTTCCCAAAGTGCCCCTGG - Intergenic
1202130316 Y:21603227-21603249 TGCCTTTCCCAGAGAGCACCTGG - Intergenic
1202182062 Y:22148011-22148033 TGCCTTTCCCAGAGAGCCCCTGG - Intergenic
1202209298 Y:22438391-22438413 TGCCTTTCCCAGAGAGCCCCTGG + Intergenic