ID: 915528334

View in Genome Browser
Species Human (GRCh38)
Location 1:156489611-156489633
Sequence TATTCCCCCAGCGCTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915528334 Original CRISPR TATTCCCCCAGCGCTGGGCC AGG (reversed) Intronic
901857871 1:12055809-12055831 CAATCCTCCAGCGCTGGTCCTGG + Intergenic
902554682 1:17240005-17240027 CATTGCCCCAGCGTGGGGCCGGG - Intronic
902686820 1:18082839-18082861 TATTCCCCCAGGACTGGACCAGG + Intergenic
902817870 1:18926402-18926424 ACTTCCCACAGCCCTGGGCCAGG + Intronic
903000689 1:20263415-20263437 AATTGACCCAGAGCTGGGCCAGG - Intergenic
903325968 1:22568712-22568734 TGTTCCCCCAGCACGGTGCCTGG - Intronic
903542203 1:24102903-24102925 TATTCCTCCAGCCCTGGGGCTGG + Intronic
904993559 1:34613427-34613449 TATGTCCCCAGCGCTGTGCTAGG - Intergenic
905396981 1:37673034-37673056 AATTCACCCAGCACTGTGCCAGG + Intergenic
906523826 1:46482770-46482792 AACTCACCCAGGGCTGGGCCAGG + Intergenic
907442902 1:54489508-54489530 TATTCTCCCGGCGCTGAGCCGGG + Intergenic
908560552 1:65301869-65301891 TCTTCCCCCAGGGATGGGGCAGG + Intronic
909485027 1:76162894-76162916 TCTTTCCCCAGCTCTGGGCCTGG - Intronic
914970936 1:152307572-152307594 TCTTCCTCCAGTGCTGGTCCCGG + Exonic
914971876 1:152313410-152313432 TCTTCCTCCAGTGCTGGTCCCGG + Exonic
915528334 1:156489611-156489633 TATTCCCCCAGCGCTGGGCCAGG - Intronic
918210655 1:182348241-182348263 TCTTCCCCCAGCTGTGAGCCTGG + Intergenic
920674603 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG + Intronic
922720362 1:227897068-227897090 GAGTCCCCCAGCACTGGGCTTGG + Intergenic
923087419 1:230712149-230712171 TGTCCCCCCAGGGCTAGGCCAGG + Intronic
923678599 1:236100996-236101018 GCTTCCCACAGCCCTGGGCCCGG + Intergenic
924025051 1:239823412-239823434 AATTCCCCCAGCCTTGGTCCAGG + Intronic
924456009 1:244219507-244219529 AATTTCCCCAGCACTGGGCCTGG - Intergenic
924787435 1:247211062-247211084 AATGCCCCCTGGGCTGGGCCAGG - Intergenic
1063971927 10:11387214-11387236 TGTTCCCACGGCGCTGGGGCCGG + Intergenic
1066393597 10:34998305-34998327 AGTTCCTCCAGCCCTGGGCCTGG + Intergenic
1067792696 10:49299828-49299850 AGCTCCCCCAGCGCTGGGCCAGG + Intronic
1068709934 10:60122820-60122842 TAATGCCCCAGTGCTGGGACTGG - Intronic
1070733984 10:78851173-78851195 TATTCCCCCAGGGCTGGCTGGGG - Intergenic
1071875416 10:89838065-89838087 CAGCCCCACAGCGCTGGGCCTGG - Intergenic
1073060707 10:100731740-100731762 TTTTCCCCCAGCTCTTGCCCTGG + Intergenic
1073136968 10:101225545-101225567 TCTGCCCCCAGCGGTGTGCCGGG + Intergenic
1074508090 10:114088853-114088875 GATTCCACCAGCACTGTGCCAGG - Intergenic
1075255832 10:120925324-120925346 TAATCCCACAGAGCTGAGCCAGG + Intergenic
1077009973 11:375371-375393 TAGTCCCCCGGCCCTGAGCCAGG + Intronic
1077029723 11:459594-459616 TTTTCCACCAGCGATGGGACAGG + Intronic
1077149353 11:1062556-1062578 TGTTCCCCCAGCCCTGGGAGTGG + Intergenic
1079109904 11:17599557-17599579 TCTTCCCCAAGTGCTGGGCCTGG - Intronic
1083347411 11:62003254-62003276 TATTCTCCCTACGCTGGGCCAGG + Intergenic
1083795631 11:65014853-65014875 TGTTCCCCCAGCTCTGTGCCAGG + Intronic
1083846957 11:65340994-65341016 TTTTCCGCCAGCGCCGGGCAGGG - Exonic
1084264646 11:67998531-67998553 TGTTCCCCCAAGGCTGTGCCTGG - Intronic
1084858092 11:72001537-72001559 TCCTCACCCAGAGCTGGGCCAGG - Exonic
1084954227 11:72683010-72683032 TATTCCCCAGGGGCTAGGCCTGG + Intergenic
1085109342 11:73873842-73873864 TGTGCCCCCAGCACTAGGCCTGG + Intronic
1085306507 11:75488981-75489003 TATGTCCCCTGCACTGGGCCTGG + Intronic
1088420992 11:109646738-109646760 CATTCCCCGAGTGCTGGGACTGG - Intergenic
1090385614 11:126356118-126356140 CAATCCCCCAGCCCTGCGCCCGG + Intronic
1096497222 12:52045561-52045583 AATTCTACCAGCACTGGGCCTGG + Intronic
1097464744 12:59908375-59908397 TATTCCCTAAGGGCTGGGCGTGG + Intergenic
1097798739 12:63890128-63890150 TTTTTCCCCTGCTCTGGGCCAGG - Intronic
1101581542 12:106046595-106046617 TATCCTCCCAGCTCTGAGCCAGG - Intergenic
1102386891 12:112517412-112517434 TATTTGCCCTGCTCTGGGCCGGG - Intergenic
1103898748 12:124292280-124292302 CCTTCCTACAGCGCTGGGCCTGG + Intronic
1104718496 12:131031718-131031740 TGTGCCCCCAGGGTTGGGCCTGG + Intronic
1104752714 12:131250303-131250325 CATTCCCCAGGAGCTGGGCCAGG + Intergenic
1105415286 13:20206598-20206620 TAATGCCCCAGTGCTGTGCCAGG - Intergenic
1105704020 13:22957759-22957781 TTCTACCCCAGGGCTGGGCCTGG - Intergenic
1105856973 13:24382843-24382865 TTCTACCCCAGGGCTGGGCCTGG - Intergenic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107969234 13:45625246-45625268 TGTGCCCCCATCTCTGGGCCTGG + Intergenic
1109775614 13:67037338-67037360 TATACCCTCAGAGCTGAGCCTGG + Intronic
1112333817 13:98497757-98497779 TATCCACCCAGCTCTGCGCCAGG - Intronic
1112595774 13:100805734-100805756 GAGGCCCCCAGCTCTGGGCCAGG - Intergenic
1114680109 14:24477100-24477122 GGTTCCCCCAGCACTGGGCCTGG + Intergenic
1118000899 14:61522620-61522642 TCTTCCCCCAGTGCTAGGTCAGG + Intronic
1119401449 14:74365393-74365415 TGTTCCCCCAGCTCTCTGCCTGG - Intergenic
1121694810 14:95904078-95904100 TAATCCCCCATTGCTGGGCAAGG + Intergenic
1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG + Intergenic
1122845731 14:104497089-104497111 TTCTACCCCAGGGCTGGGCCTGG - Intronic
1122919776 14:104875237-104875259 AAGTCCCCCAGCCCTGGGACAGG - Intronic
1130340066 15:82992657-82992679 TACTCCTCCAGCGCTGGCCTTGG - Intronic
1131112869 15:89776407-89776429 TCTTCGCCCAGGGCTGGGGCTGG + Exonic
1132457136 16:30160-30182 CACTCCCCCAGCACAGGGCCTGG + Intergenic
1132701085 16:1222381-1222403 CATCCCCCCAGTGCAGGGCCTGG - Intronic
1133802842 16:9098039-9098061 TGCTCCCCCAGGGCTGGGGCGGG + Intronic
1135003958 16:18801773-18801795 GCTTCCCACAGCGCTGGGCGGGG - Intergenic
1141661170 16:85442385-85442407 TGGACACCCAGCGCTGGGCCAGG - Intergenic
1141672972 16:85502528-85502550 AACTCAGCCAGCGCTGGGCCAGG + Intergenic
1142412341 16:89923145-89923167 GGATCCCCCAGCGCTGGGCCGGG - Intronic
1142581903 17:948535-948557 TAGGTCCCCAGCGCAGGGCCGGG - Intronic
1146299215 17:31675121-31675143 GATTCTCCCAGAGCAGGGCCTGG - Intergenic
1146692775 17:34888131-34888153 TCTCCTCCCAGAGCTGGGCCTGG + Intergenic
1146935146 17:36808517-36808539 CATTCCCGCGGCGCTGGCCCGGG + Intergenic
1146943425 17:36859255-36859277 TATCCCTGCAGCCCTGGGCCAGG + Intergenic
1151379786 17:73717739-73717761 CAGCCTCCCAGCGCTGGGCCTGG + Intergenic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1155680830 18:28483578-28483600 TATTCCTCTAGTGCTAGGCCAGG + Intergenic
1157476949 18:48029580-48029602 GATGCCCCCTGCGCTGGGCGAGG - Exonic
1157619271 18:49006746-49006768 CATTCCCCCAGTGCTGGGCAGGG + Intergenic
1159342644 18:67155891-67155913 TGTGCCCCCAGCCCTGGGCCCGG - Intergenic
1161015545 19:1981086-1981108 TATACCTGCAGGGCTGGGCCGGG - Exonic
1161563318 19:4985746-4985768 ACTGCCCCCAGCGTTGGGCCAGG + Intronic
1161800781 19:6415847-6415869 TATTGCCCCAGCCCTGGGGTGGG + Exonic
1162340998 19:10091544-10091566 TCCTCCCCCCGCGCTGGGACCGG + Exonic
1162997090 19:14343070-14343092 TAGTCCCCCAGGACTGGGCCAGG + Intergenic
1166282151 19:41801235-41801257 TATTGCCCCGGAGGTGGGCCAGG - Intronic
1166832204 19:45645481-45645503 GATGACCCCAGCGCCGGGCCCGG - Exonic
927651496 2:24916260-24916282 TATGGCCACAGGGCTGGGCCGGG - Intronic
927886315 2:26720938-26720960 AATCCCCCCTGCACTGGGCCTGG - Intronic
927974406 2:27327121-27327143 TTTCCCCCCAGTTCTGGGCCTGG - Intronic
930277825 2:49334177-49334199 TATCCCGCCAGCTCTGGGGCGGG + Intergenic
933848969 2:86350188-86350210 TATTCCCCCAGCCATAGGCCAGG + Intergenic
934112835 2:88758265-88758287 AGTTCCCCCAGCCCTGGGACTGG - Intergenic
935554276 2:104490603-104490625 TATTCCCCCAGCCGTGACCCCGG + Intergenic
936037688 2:109126064-109126086 CATTCCCCCAGGGCTGGAGCTGG + Intergenic
936703636 2:115043058-115043080 TATTCCAGCACCACTGGGCCAGG - Intronic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
947610660 2:231523001-231523023 TACTCCCCCAGGGCTGGCCAAGG + Intergenic
947813033 2:233016090-233016112 CATTCCCTCAGCCCTGGGCCTGG - Intergenic
948123265 2:235546474-235546496 TATGGCCCCAGAGCTGTGCCTGG + Intronic
1174183361 20:48688839-48688861 TACCCCCCCTGCCCTGGGCCTGG - Intronic
1175267550 20:57711613-57711635 TATTGCCCCACTCCTGGGCCGGG - Intergenic
1176220756 20:63968438-63968460 TGTGCCCCCACTGCTGGGCCTGG - Intronic
1178993493 21:37375797-37375819 TATTCCTCCAGGGCTGGGTGTGG - Intronic
1183392189 22:37552072-37552094 GAAGCCCCCAGGGCTGGGCCAGG + Intergenic
949706514 3:6824228-6824250 TAATCCCACAGCCCTGTGCCAGG - Intronic
950460878 3:13121649-13121671 TGTCCCCCCAGCGCTGGCCTTGG - Intergenic
950949786 3:16986286-16986308 GGTTCCCCTAGTGCTGGGCCTGG + Intronic
954433090 3:50481669-50481691 TATTCTCCCAGCTCTGGGGAAGG + Intronic
961219780 3:125190488-125190510 TCTTCCACCAGGGCTGGGGCTGG + Exonic
961409427 3:126707894-126707916 TACTTGCCCAGCACTGGGCCTGG + Intronic
961809300 3:129512807-129512829 TGTGCCCCAAGCCCTGGGCCAGG + Intronic
963177221 3:142312634-142312656 TATTCCCCCAGCCATGGGCATGG + Exonic
964623432 3:158736982-158737004 TCTTCCAGCAGCCCTGGGCCAGG - Intronic
964667231 3:159187960-159187982 TCTTCCACCGGCGCTGGGCATGG + Intronic
966178948 3:177170445-177170467 TATTAACCCAGTGTTGGGCCAGG - Intronic
968565319 4:1309559-1309581 TCCTCCTCCAGCGCTGGCCCGGG - Intronic
968624681 4:1621795-1621817 TATTCCCCCAACACGGTGCCAGG - Intronic
969464030 4:7344198-7344220 CATGCCCCCAGTGCAGGGCCTGG + Intronic
969534305 4:7746545-7746567 TGTTCTTCCAGCGCTGAGCCAGG - Intergenic
970940014 4:21620913-21620935 TGCTTCCCCAGCTCTGGGCCTGG + Intronic
971339341 4:25753498-25753520 TCTTCCCCCAGCTGTGGGGCAGG + Intronic
984822677 4:183896235-183896257 ATTTCACCCAGCGCTGGTCCTGG - Intronic
985532205 5:440666-440688 TATTCTCCCAGAGCAGGGTCAGG + Intergenic
985866779 5:2520084-2520106 TCTGCCCCCAACTCTGGGCCTGG - Intergenic
986723736 5:10578905-10578927 TAATCCCCCAGCGCTTGGAGGGG + Intronic
989635963 5:43534112-43534134 TGTTCCTCCAGCCCTGGTCCTGG - Intronic
992553644 5:77882960-77882982 CATGCCCCAAGAGCTGGGCCAGG + Intergenic
993783456 5:92098315-92098337 TATTCTCCCAACACTGGGGCTGG + Intergenic
995476327 5:112552158-112552180 TCTTCCCCCAGCCCTTGGTCTGG - Intergenic
995831604 5:116361197-116361219 GGTGCTCCCAGCGCTGGGCCTGG + Intronic
996164180 5:120205028-120205050 TAATCCCCAAGGGCAGGGCCAGG - Intergenic
997241601 5:132312085-132312107 TATTCCCTCAGAGCTGGGCTGGG + Intronic
1001237772 5:170044566-170044588 TAATCCCCCTGGGCTGGGCCAGG - Intronic
1001245908 5:170105846-170105868 TATACCCCTAGGGCTTGGCCGGG - Intergenic
1006514439 6:34538189-34538211 TTTTCCCCCATCTCAGGGCCTGG + Exonic
1006633046 6:35443056-35443078 TTGACCCCCAGCGATGGGCCCGG - Intergenic
1006736859 6:36279748-36279770 TATTTGCCAAGCACTGGGCCAGG - Intronic
1010932098 6:81815757-81815779 AATTCCTCCATCTCTGGGCCAGG - Intergenic
1015101534 6:129487237-129487259 GCTTGCCCCAGCCCTGGGCCAGG + Intronic
1015109985 6:129581786-129581808 TATTCCACCTGTGCTGGGGCAGG - Intronic
1015256659 6:131185248-131185270 TTTTCCGCCAGTGCTGGGCAGGG + Intronic
1016123016 6:140367108-140367130 TATTCCCCCAGAGGTTGGGCTGG + Intergenic
1017755633 6:157526831-157526853 TATTCACCAACCGCTGGACCAGG + Intronic
1018890015 6:167976650-167976672 CATTCCCCCAGCACTGTGCGGGG + Intergenic
1019016725 6:168885413-168885435 GGCTCACCCAGCGCTGGGCCTGG + Intergenic
1019337394 7:491845-491867 TCAGCCCCCAGCGCTGGGCAGGG + Intergenic
1023990694 7:45126525-45126547 CATTTCCCCAGCACTGGGCCTGG - Intergenic
1028391304 7:90320895-90320917 TGTGCCCCCAGCCCTGGGTCAGG + Intergenic
1030505642 7:110418458-110418480 TATTCCCCTAGCACAGGGCAAGG + Intergenic
1032018450 7:128393865-128393887 GGTTGCCCCAGCGCTGGCCCTGG + Intronic
1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG + Intronic
1035974535 8:4293046-4293068 TATTCCACCAGAGCTGCGTCTGG + Intronic
1037839409 8:22233076-22233098 AAATCGCCCAGCCCTGGGCCTGG + Intergenic
1037948897 8:23006200-23006222 AATTCCCCCAGGGCTGAGCAGGG - Intronic
1039468660 8:37800555-37800577 TGTTCCCCCAGCGCAGGGATGGG - Intronic
1039489962 8:37940095-37940117 TCTTCCTCCAAGGCTGGGCCGGG + Exonic
1039589580 8:38735393-38735415 TTTTCCACCCGCGCTGTGCCTGG + Intronic
1040902239 8:52428837-52428859 TGTTCCTCCAGCCCTGGGGCAGG - Intronic
1042183484 8:66114175-66114197 TAATCCCCCACGGCTGGGCACGG - Intergenic
1045425742 8:102064248-102064270 TATTCCCAGAGCTCTGGGGCTGG - Intronic
1048969890 8:139639574-139639596 CAGACCCCCAGCGCTGGGCTGGG - Intronic
1049069710 8:140347063-140347085 TGCTCCTCCAGCTCTGGGCCAGG + Intronic
1049432817 8:142573186-142573208 TAAGGCCCCAGGGCTGGGCCTGG - Intergenic
1049607784 8:143537659-143537681 TACTCCCCCTGCGCCTGGCCTGG + Intronic
1050732076 9:8720350-8720372 TAGTACACCAGCTCTGGGCCTGG - Intronic
1060209280 9:121700035-121700057 TGTGCCCCCAGCTCAGGGCCTGG - Intronic
1062390414 9:136331525-136331547 TCTTCCCCCAGGCCTGGCCCAGG - Intronic
1062646332 9:137550504-137550526 CATCCCCGCCGCGCTGGGCCTGG - Exonic
1185612133 X:1399053-1399075 TGTCGCCCCAGCTCTGGGCCAGG + Intergenic
1187337645 X:18394784-18394806 TCTTCCCCCTGCTCTGTGCCTGG - Intergenic
1188546272 X:31311127-31311149 TATTCCCCCAGCTCAAGGCTTGG + Intronic
1189276867 X:39792913-39792935 CATTCGCCCAGCTCAGGGCCAGG - Intergenic
1189719996 X:43906031-43906053 GCTTCCTCCAACGCTGGGCCTGG - Intergenic
1191666027 X:63703601-63703623 TATTCCCCCAGCACAGTGCCTGG - Intronic
1192894834 X:75431414-75431436 TATTTCCCCTGGGCTGGGCTTGG - Intronic
1195277673 X:103298185-103298207 TACTCCTCCAGCGCTAGGCAAGG - Intergenic
1197772133 X:130095929-130095951 TAGTCCCCTGGCCCTGGGCCTGG - Intronic
1200399223 X:156009566-156009588 CACTCCCCCAGCACAGGGCCTGG - Intronic
1200745512 Y:6900562-6900584 TATTCTTCCATCGCTGGGTCAGG + Intergenic