ID: 915543160

View in Genome Browser
Species Human (GRCh38)
Location 1:156581603-156581625
Sequence AGCCCCCAGGTTGAAGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915543160_915543165 -5 Left 915543160 1:156581603-156581625 CCTGCGCCTTCAACCTGGGGGCT 0: 1
1: 0
2: 1
3: 11
4: 128
Right 915543165 1:156581621-156581643 GGGCTGCCTATGTGGAGACTGGG 0: 1
1: 0
2: 1
3: 9
4: 117
915543160_915543166 -4 Left 915543160 1:156581603-156581625 CCTGCGCCTTCAACCTGGGGGCT 0: 1
1: 0
2: 1
3: 11
4: 128
Right 915543166 1:156581622-156581644 GGCTGCCTATGTGGAGACTGGGG 0: 1
1: 0
2: 1
3: 20
4: 218
915543160_915543168 9 Left 915543160 1:156581603-156581625 CCTGCGCCTTCAACCTGGGGGCT 0: 1
1: 0
2: 1
3: 11
4: 128
Right 915543168 1:156581635-156581657 GAGACTGGGGACCCAGCCAGAGG 0: 1
1: 0
2: 2
3: 30
4: 1426
915543160_915543164 -6 Left 915543160 1:156581603-156581625 CCTGCGCCTTCAACCTGGGGGCT 0: 1
1: 0
2: 1
3: 11
4: 128
Right 915543164 1:156581620-156581642 GGGGCTGCCTATGTGGAGACTGG 0: 1
1: 0
2: 2
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915543160 Original CRISPR AGCCCCCAGGTTGAAGGCGC AGG (reversed) Exonic
900214072 1:1471912-1471934 GGCCCCAAGGGTGAAGGCGCGGG + Exonic
900221621 1:1512296-1512318 GGCCCCAAGGGTGAAGGCGCGGG + Exonic
900941268 1:5800095-5800117 AGCCCCCAGGAAGAAGGGGGTGG + Intergenic
901626885 1:10629733-10629755 GGCCCCCAGGAGGAAGGCGAGGG + Exonic
902293679 1:15451553-15451575 AGCCCCCAGGCAGAAGGTGGAGG - Intergenic
902549422 1:17210560-17210582 AGAGCCCAGGCTGAGGGCGCAGG - Intronic
903071232 1:20727896-20727918 GGCCCTCAGGTAGCAGGCGCTGG - Intronic
903800406 1:25963067-25963089 AGCCCTCAGGCTGAGGGAGCAGG + Intronic
904355538 1:29936696-29936718 AGTCCCCAGGTAGAAGGTGGTGG - Intergenic
909030605 1:70534571-70534593 AGTCCCCATGTTGAAAGCCCAGG - Intergenic
915033990 1:152907441-152907463 AGCCCCCAGGTGGAGAGCTCTGG + Intergenic
915543160 1:156581603-156581625 AGCCCCCAGGTTGAAGGCGCAGG - Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
919640173 1:200039025-200039047 AGCCCCGAGGGTGACGGTGCTGG - Intronic
923141228 1:231162708-231162730 TGGCCGCAGGTTGAAGCCGCTGG + Intronic
1063593093 10:7410779-7410801 GGCCCGCAGGTTGAGTGCGCTGG - Intronic
1069158280 10:65054894-65054916 AGCCGCCAGTCTGAAGGCCCAGG + Intergenic
1069894627 10:71672774-71672796 AGGCCCCAGGGTGAAGGGGATGG + Intronic
1070194123 10:74140386-74140408 AGACCCCGCTTTGAAGGCGCTGG - Intronic
1071669930 10:87598831-87598853 AGCCCCGAGTCTGAAGGGGCAGG - Intergenic
1073088525 10:100912655-100912677 ACCCGCCTGGTTGAAGGCGAGGG - Intronic
1075001976 10:118805345-118805367 AGTGCCGAGGTTCAAGGCGCGGG - Intergenic
1075342184 10:121655882-121655904 AGCCCTGAGGTTGATGGAGCAGG - Intergenic
1075401444 10:122163959-122163981 AGCCTCCAGGTTCAGGTCGCTGG - Intronic
1076978355 11:192338-192360 ACCCCCCAGGTTGAAGGCCCTGG - Intronic
1077413947 11:2415822-2415844 AGCCCACAGGGTGCAGGAGCAGG + Intronic
1081932516 11:46881853-46881875 AGCCCCAAGATTGAACGAGCTGG - Exonic
1083441350 11:62678730-62678752 TGCCCCCAGGGAGAAGGCTCTGG - Exonic
1083907743 11:65684920-65684942 AGCCTCCTGGTTGAAGGGGTGGG - Intergenic
1084166025 11:67375087-67375109 AGGCCACAGGTTGGAGGCGCTGG - Intronic
1084185366 11:67468417-67468439 AGTTCCCAGGTTCAAGGCACAGG + Intronic
1089363004 11:117903564-117903586 AGCACCCAGGTTGTAGGCAGAGG - Intronic
1089775634 11:120833565-120833587 AGCCCCCAGGTAGAAGCTTCTGG + Intronic
1090325106 11:125879289-125879311 ATCCCACAGGTTGAGGGCTCAGG + Intergenic
1091708538 12:2718660-2718682 AGTCCCATGGTTGAAGGGGCAGG + Intergenic
1096398806 12:51288222-51288244 GGCCCCCAGGTGGAAGGTGTGGG - Intronic
1099747195 12:86720373-86720395 AGCCCTCAGGTTCAAGGTGGTGG + Intronic
1100430274 12:94525991-94526013 AGAGCCCATGTTGAAGGGGCAGG + Intergenic
1102652172 12:114449734-114449756 AGTCCCCAGGATGAAAGCTCAGG + Intergenic
1103091736 12:118103080-118103102 AGACCCCGCTTTGAAGGCGCTGG + Intronic
1103862911 12:124028520-124028542 AGCCCCGTGTTTGAAGGCACTGG + Intronic
1104028798 12:125049378-125049400 AGCCCCTAGGATGAGTGCGCTGG - Intergenic
1104579809 12:130002899-130002921 ATCCCCCAGGCTGAAAGGGCTGG - Intergenic
1104626014 12:130355431-130355453 CGCCGTCAGGGTGAAGGCGCTGG - Intronic
1105323074 13:19345980-19346002 TGCAGCCAGGTTGAAGGCGATGG - Intergenic
1106410206 13:29506132-29506154 AGCCCCCAGGCTGGAGGGGTGGG - Intergenic
1109155712 13:58906507-58906529 AGGCCCCTGGTGGAAGGCTCAGG + Intergenic
1113371214 13:109727302-109727324 AGACACAAGGTTGAAGGCCCTGG + Intergenic
1113428601 13:110230371-110230393 AGCACACAGGTGGCAGGCGCGGG + Intronic
1113938023 13:114005497-114005519 GGGTCCCAGGCTGAAGGCGCAGG + Intronic
1121405283 14:93715940-93715962 ACTCACCAGGTTGAAGGAGCTGG + Intergenic
1125589941 15:40847711-40847733 AGCCCCCAGGACCAAGGAGCAGG - Intronic
1128212049 15:65909652-65909674 AGCACCCAGCTTGAAGGGACAGG - Intronic
1128333624 15:66772161-66772183 AGCCCACAGGTTGCAGCCACAGG + Intronic
1128506813 15:68278322-68278344 AGGGCCCAGGTTTAAAGCGCTGG + Exonic
1129464564 15:75716629-75716651 AGGCCCCAGGTCAAAGGCCCAGG - Intergenic
1129720683 15:77876383-77876405 AGGCCCCAGGTCAAAGGCCCAGG + Intergenic
1131174562 15:90201687-90201709 AGCGCCCAGGTCGGAGGCGGCGG - Exonic
1131455063 15:92577034-92577056 AACCCCCAGGTGGAAGGGGGAGG - Intergenic
1133017417 16:2950553-2950575 AGCCCACAGGTGGAGGGCGCAGG - Exonic
1136279426 16:29199237-29199259 GGACACCAGGTTGAAGGCACAGG - Intergenic
1138211162 16:55164412-55164434 AGCCCAGAGGCTGAAGGCCCAGG - Intergenic
1139630651 16:68230135-68230157 AGCTACCAGGTTGAGGGTGCTGG + Exonic
1142083818 16:88165338-88165360 GGACACCAGGTTGAAGGCACAGG - Intergenic
1142719513 17:1766901-1766923 AGGCCCCAGGATGCAGGCCCTGG + Exonic
1143471139 17:7176968-7176990 AGCACCCAGGGTGAGGGCGCTGG - Exonic
1147428451 17:40357228-40357250 AGCCCCCACTGTGAAGGGGCTGG + Intronic
1151444219 17:74152714-74152736 ATCCTCCAGGTTGGAGGAGCCGG + Intergenic
1151523670 17:74648860-74648882 AGCCACCAGGCTGAAGTTGCAGG + Intergenic
1152741987 17:82022490-82022512 AGACCCCAGGCTCAGGGCGCAGG + Intronic
1152896029 17:82911880-82911902 AGCCCCCAGGGTGAAGGGCTGGG + Intronic
1157478227 18:48036770-48036792 AGCTTCCAGGTGGAAGGGGCAGG + Intronic
1157525396 18:48376623-48376645 AGCCTCCAGGCTGCAGGCCCTGG - Intronic
1159624151 18:70672214-70672236 AGCCCACAGGTTGAAAATGCAGG - Intergenic
1160025268 18:75211132-75211154 AGCCCCCCGGGTGGAAGCGCGGG + Exonic
1160831005 19:1104826-1104848 AGGCCCCAGCGTGCAGGCGCAGG + Intronic
1161587423 19:5113215-5113237 AGCCCCCAGGATGGCGGCGCGGG - Intronic
1162419830 19:10559760-10559782 AGCCCCCAGGGTTCAGGCCCAGG - Intronic
1164578022 19:29417497-29417519 AGCCCCCAGGCTGCAGGTGCTGG + Intergenic
1166042648 19:40213067-40213089 ACCCCGCAGGCTGAAGGGGCTGG + Exonic
1166504257 19:43361597-43361619 GGCCCCAAGGATGAAGGCACTGG + Intronic
1166506202 19:43373161-43373183 GGCCCCAAGGATGAAGGCGCTGG - Intergenic
928898916 2:36296995-36297017 ACCCCCCAGGATGAGGGCACGGG - Intergenic
935964910 2:108463930-108463952 AGGCCCCAGGTTGAGTGCGCAGG + Intronic
937315232 2:120927954-120927976 AGTCCCCAGGTAGAAGGTGTGGG + Intronic
942897060 2:181069849-181069871 ACCACCCAGGTTGAAGTCACTGG - Intronic
946054615 2:216889773-216889795 AGCCGCCAGGTAGAGGGTGCTGG - Intergenic
946131661 2:217611362-217611384 AGGCCCCAGGGGGAAGGCCCAGG + Intronic
1169142559 20:3234520-3234542 AGCCCCCAGGTAGAGGCCCCAGG + Intronic
1178050222 21:28738633-28738655 AGCCCCCAGGGAGAAGGCCCAGG - Intergenic
1179580921 21:42343547-42343569 AGACCCCAGGAGGAAGGGGCAGG + Intergenic
1179674691 21:42973941-42973963 AGCCCCCAGGGTAAAGCCTCAGG + Intergenic
1179953236 21:44723586-44723608 AGCCCCCACTTCAAAGGCGCGGG + Intergenic
1185029535 22:48434408-48434430 AGACCCCAGGCTGGAGGCCCGGG + Intergenic
950104277 3:10378470-10378492 AGCCCACAGGGTGGAGACGCTGG + Intronic
950118224 3:10464845-10464867 GGCCCTCAGGTGGAAGGCTCTGG + Intronic
950609561 3:14117231-14117253 AGGCCCCAGGGTGAGGGCTCTGG - Intronic
952775495 3:37042063-37042085 AGACCCCTGGTTGAAGACGTTGG + Intronic
963855947 3:150253831-150253853 AGCCCACAGGATGATGGTGCAGG + Intergenic
965087188 3:164113936-164113958 AGGCCCCTGGGTGAAGGGGCAGG + Intergenic
967925313 3:194641062-194641084 AGCCCCCTGGTGGGAGGCGATGG - Exonic
968765352 4:2465542-2465564 GGCCCCCAGTGTGAAGGCCCTGG - Intronic
968765376 4:2465614-2465636 GGCCCCCAGTGTGAAGGCCCTGG - Intronic
970531914 4:16993559-16993581 AGCATCCAGGTGGAAGGGGCTGG - Intergenic
970603324 4:17657535-17657557 GGCCACAAGGTAGAAGGCGCTGG + Intronic
972466919 4:39366244-39366266 CAGCCCCAGGATGAAGGCGCTGG + Exonic
974785746 4:66618487-66618509 AGCCCCCAGGTAGTGGGGGCAGG + Intergenic
985552830 5:541971-541993 AGCTCTCAGGTGGAAGGGGCAGG + Intergenic
985566975 5:623949-623971 AGCGCCAAGGTTGAAGGCCTGGG + Intronic
986203939 5:5605421-5605443 AGCCCACATGTTCAAGGAGCAGG - Intergenic
995493973 5:112722520-112722542 ATCCCACAGGTTGAGGGCTCAGG + Intronic
997393956 5:133541493-133541515 AGTCCCCAGGTTCAAGACGAGGG + Intronic
997749261 5:136328876-136328898 AGTCCCAAGGTAGAAGGTGCAGG + Intronic
999622850 5:153490292-153490314 AGCCCCCAGGCTGAAGCTGCTGG - Intronic
1006432767 6:34007953-34007975 ATCCCCCAGGTAGCAAGCGCAGG + Intergenic
1006446592 6:34083238-34083260 AGTCCCCAGGTTGGTGTCGCCGG - Intronic
1007408661 6:41649052-41649074 AGGCACCAGGTGGAAGGAGCAGG + Intronic
1008716284 6:54294013-54294035 GGCACCCAGGTAGAAGGGGCAGG - Intergenic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1020082122 7:5291771-5291793 AGCGGCCAGGTTGATGGCGTAGG - Exonic
1020204713 7:6105365-6105387 GGCCCCCAGGCCGAAGGGGCGGG - Intronic
1021723981 7:23532125-23532147 GGCGCCCAGGTTGAGAGCGCAGG - Intergenic
1022844309 7:34194192-34194214 AGCCCCCAGGTTGAATGAATGGG - Intergenic
1024539942 7:50468092-50468114 GGCCCCCATGTTGCAGGTGCTGG + Intronic
1025196796 7:56940369-56940391 AGCAGCCAGGTTGATGGCGTAGG + Intergenic
1025675152 7:63636568-63636590 AGCAGCCAGGTTGATGGCGTAGG - Intergenic
1026960471 7:74404445-74404467 GGCCCCCAGGTTCAAGGTGTTGG + Exonic
1029620116 7:101685015-101685037 AGCCCCCTGGGTGTAGGGGCAGG - Intergenic
1030199879 7:106891883-106891905 AGCCTCCAGGTTGGAGGCTTGGG - Intronic
1038530703 8:28316247-28316269 AGCTCACAGGCTGAAGGCACAGG - Intergenic
1042786384 8:72551318-72551340 AGCCCCCAAGTTGAAGGTTTAGG - Intronic
1048345044 8:133570008-133570030 GGCCCCAAGGTGGAAGGTGCTGG - Intronic
1054336391 9:63813515-63813537 AACCCCGAGGGTGCAGGCGCGGG + Intergenic
1060828952 9:126701996-126702018 AGCCACCTGGTTGAAGACCCGGG - Intergenic
1062371632 9:136242289-136242311 AGCCTCCAGCTGGAAGGAGCAGG - Intronic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1185641833 X:1592638-1592660 AGCCTCCAGGTTGATGGGGTGGG + Intronic
1185775196 X:2797440-2797462 AGACTCCAGGTAGAAGGCCCAGG - Intronic
1188072166 X:25730192-25730214 CGCCCCTAGGTTAAAAGCGCAGG - Intergenic
1193082321 X:77417905-77417927 AGCCACCAGGTTGCAGGAGGTGG + Intergenic
1193111175 X:77732109-77732131 AGCACCCAGGTTGATGGGGAGGG - Intronic