ID: 915544050

View in Genome Browser
Species Human (GRCh38)
Location 1:156585965-156585987
Sequence CTGGACCTACAAATGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544050_915544053 -8 Left 915544050 1:156585965-156585987 CCATCTTCCATTTGTAGGTCCAG 0: 1
1: 0
2: 1
3: 10
4: 183
Right 915544053 1:156585980-156586002 AGGTCCAGGCCCTCCCAGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 215
915544050_915544062 20 Left 915544050 1:156585965-156585987 CCATCTTCCATTTGTAGGTCCAG 0: 1
1: 0
2: 1
3: 10
4: 183
Right 915544062 1:156586008-156586030 CCTAGCATCTTGGTACCCAATGG 0: 1
1: 0
2: 0
3: 8
4: 149
915544050_915544059 10 Left 915544050 1:156585965-156585987 CCATCTTCCATTTGTAGGTCCAG 0: 1
1: 0
2: 1
3: 10
4: 183
Right 915544059 1:156585998-156586020 AGCGGAGTACCCTAGCATCTTGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544050 Original CRISPR CTGGACCTACAAATGGAAGA TGG (reversed) Exonic
905946446 1:41905140-41905162 CTGGACCCACAACTGAGAGAAGG + Intronic
909276777 1:73696871-73696893 CTGGACCTCTAAATGAAAAAGGG - Intergenic
909438702 1:75673464-75673486 CTGGACCTACTAGGGGAAGGGGG + Intergenic
910810937 1:91235660-91235682 CTGGCCTTGAAAATGGAAGAAGG - Intergenic
911663346 1:100527815-100527837 CTGGACCTACAAATTGTGGCTGG + Intergenic
911795858 1:102075291-102075313 ATTGACCCACGAATGGAAGAAGG - Intergenic
912774358 1:112495921-112495943 CTGGATCTTCACATGGCAGAAGG + Intronic
913663709 1:121028796-121028818 CAGGTCCTACCCATGGAAGATGG + Intergenic
914015107 1:143812076-143812098 CAGGTCCTACCCATGGAAGATGG + Intergenic
914162714 1:145149149-145149171 CAGGTCCTACCCATGGAAGATGG - Intergenic
914196303 1:145449766-145449788 CTGGACTTACAAGTGGCAGCTGG - Intergenic
914653724 1:149720616-149720638 CAGGTCCTACCCATGGAAGATGG + Intergenic
915544050 1:156585965-156585987 CTGGACCTACAAATGGAAGATGG - Exonic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
918115091 1:181489303-181489325 CTGAACCTAAAAATGAGAGAGGG - Intronic
919212256 1:194502596-194502618 CCAGATCTACAAATAGAAGATGG + Intergenic
922691524 1:227696005-227696027 CTGGACTTCCAAAGGAAAGATGG - Intergenic
923630904 1:235649315-235649337 TGTGACCTACAAATGGAAGAGGG + Intronic
924226873 1:241929112-241929134 CTGTACCTGCAAATGGTGGAGGG - Intergenic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
924494817 1:244576738-244576760 CTGAGCCTAGAAATGGAAGGTGG - Intronic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1063483768 10:6400207-6400229 CTGGGGCTACAGATGAAAGAAGG - Intergenic
1063733575 10:8725982-8726004 CTGGACTTCAAAAGGGAAGAGGG + Intergenic
1065742945 10:28813360-28813382 CTGGACCTTCAAATTGGAGGGGG + Intergenic
1068403486 10:56560787-56560809 CTGGACCAACACTTGTAAGAAGG - Intergenic
1068503795 10:57873380-57873402 CTGTACCTAGAAATGAAAGCTGG + Intergenic
1071107949 10:82120725-82120747 CTAGTCATACAAATGCAAGAAGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075441259 10:122480739-122480761 CTGGACCTGCCAGTGGGAGAAGG - Intronic
1075572920 10:123558500-123558522 CTGAACCTTCAAAGGAAAGAGGG - Intergenic
1077466750 11:2737058-2737080 CTGGACCCACTAATGGAAAGTGG - Intronic
1081378766 11:42389502-42389524 CTGTAGGTGCAAATGGAAGAAGG + Intergenic
1081744926 11:45466203-45466225 CTGGACCCACCAAAAGAAGAGGG - Intergenic
1085970795 11:81588203-81588225 TAGGACCTACACAGGGAAGAGGG - Intergenic
1086060841 11:82698467-82698489 CTGCACCTTCATATGGTAGAAGG - Intergenic
1086815118 11:91360535-91360557 ATGCACTTACAAATGTAAGAAGG - Intergenic
1089097780 11:115933715-115933737 CTGGCCCCACGAATGGCAGAAGG - Intergenic
1091963765 12:4721031-4721053 CTGTGCCTTCAAATGGGAGATGG + Intronic
1092705309 12:11277534-11277556 ATAGACTTACAAATGCAAGAAGG - Intergenic
1092834033 12:12471353-12471375 CTGCATCTAGAAATGGAAGCAGG - Intergenic
1095297568 12:40544505-40544527 CTGGACCTATAAATGACAGGAGG - Intronic
1095524365 12:43107697-43107719 CTAAGCCTTCAAATGGAAGAGGG + Intergenic
1096096905 12:48941440-48941462 CTGCACCTGTAAATGGAAGGGGG + Intronic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1097213862 12:57394436-57394458 CTGGAACTACAAGTACAAGACGG - Intronic
1097388426 12:58979310-58979332 CTGGAGCTAGAAAGGGAAGCAGG - Intergenic
1097411304 12:59256348-59256370 CTTGAACTACAAGTGGGAGATGG + Intergenic
1098987153 12:77024938-77024960 CTTGAACTACAAATGGAGGTTGG + Intronic
1100910063 12:99349855-99349877 CTGGAGCTAGATATGGATGATGG + Intronic
1102422765 12:112817140-112817162 CTGGATCTTCAAATGGAAGTTGG + Intronic
1102779125 12:115548277-115548299 CTGAACCTGCAAATAGAAGTCGG - Intergenic
1105356772 13:19665867-19665889 CTGAACCTGCAAATGTACGATGG - Intronic
1107054978 13:36093164-36093186 CTGGTCCTATAATTGGAGGAAGG + Intronic
1107558659 13:41541127-41541149 ATGGCCCTACAAAAGGAATAGGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108492319 13:50993900-50993922 CTGCACCTACAGCTGGAAGCAGG + Intergenic
1111915942 13:94360432-94360454 TTGGACCTCCTAAAGGAAGATGG + Intronic
1113316225 13:109182285-109182307 CTGGACAAACACATGTAAGATGG + Intronic
1113740495 13:112709419-112709441 CTGGACCTGGAAAGGAAAGAAGG - Intronic
1114318680 14:21528571-21528593 CTGGACTTACAAATGAGGGAGGG + Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1119130977 14:72173076-72173098 GTGGCCCTACAAATCTAAGAGGG - Intronic
1122625075 14:103080865-103080887 GTGGAGGTACAAATGGAAGGTGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1127241597 15:57121594-57121616 CTGTATCTTCAAATGGCAGAAGG - Intronic
1130649221 15:85752555-85752577 AGGGACCTTCAAATGGAAAATGG + Intergenic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1137390282 16:48075527-48075549 CTGGACTGACAACTGGAGGATGG - Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1138155820 16:54702096-54702118 CTGGACCCAGAAGGGGAAGAGGG + Intergenic
1139392672 16:66614900-66614922 CTGGTCCTTCAAATGAAAGGGGG + Exonic
1139845266 16:69916557-69916579 CTGGACATAGGAATGGAAAATGG + Intronic
1143986579 17:10919784-10919806 CTTGACCTTCAAATGTAGGATGG - Intergenic
1146733123 17:35212721-35212743 CAAGAGGTACAAATGGAAGAAGG - Intergenic
1149938926 17:60841925-60841947 GGGGACCAGCAAATGGAAGATGG + Intronic
1151315160 17:73317339-73317361 CTGGGGTTGCAAATGGAAGAAGG - Intergenic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1153583051 18:6594689-6594711 CTGGACCTTCACATGGCAGAAGG + Intergenic
1155992051 18:32287902-32287924 CTGGAACTTCAGATGCAAGAGGG - Exonic
1158837077 18:61342357-61342379 CTGCATCTACAAAGTGAAGATGG - Intronic
1158869368 18:61669780-61669802 CTGGACCTAGGGATGGAAGGAGG - Intergenic
1160862428 19:1243191-1243213 CTGGACCAACCAATGTAGGATGG + Intronic
1166441672 19:42820971-42820993 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166449806 19:42888959-42888981 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166461111 19:42989257-42989279 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166501059 19:43341549-43341571 CTGCAGCTAGAAAGGGAAGAAGG + Intergenic
1166509041 19:43391903-43391925 CTGCAGCTAGAAAGGGAAGAAGG - Intergenic
1168313023 19:55470917-55470939 CTGGACCTAGAGATCAAAGATGG - Intergenic
925098791 2:1228686-1228708 CTGGACTATCAAATGGAACATGG - Intronic
925639420 2:5973057-5973079 CTGGCCATACAAATGGCATATGG + Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927811797 2:26184575-26184597 CTGGAGCTGCAGATGCAAGAGGG + Exonic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
928171428 2:29007043-29007065 CAGAACTTAGAAATGGAAGAGGG - Intronic
928583101 2:32728403-32728425 CTGGGTCTACTAATGGGAGATGG - Intronic
928701684 2:33904391-33904413 CGGGACCTAGAAAGGGGAGAAGG + Intergenic
930670038 2:54139146-54139168 CAGGACATACAAATTGGAGAGGG - Intronic
930885161 2:56317079-56317101 ATGTACCTGTAAATGGAAGATGG + Intronic
932510194 2:72279060-72279082 CTTGCCCTACAAATTGAATATGG - Intronic
933556985 2:83843005-83843027 CTAGAATTACAAATGAAAGAGGG + Intergenic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
935048050 2:99499317-99499339 CTGGTCCTCCAGATGGAAGCTGG - Intergenic
937423218 2:121775612-121775634 CTGAACTTACAAATGTAAGGAGG + Intergenic
940525438 2:154808045-154808067 CTGGAGTGTCAAATGGAAGAGGG + Intronic
940901887 2:159133227-159133249 CAGGTCCTTCAAATGGATGAGGG + Intronic
942155628 2:173124444-173124466 CTGCAGCTGCAAATGGATGATGG + Intronic
948386949 2:237586334-237586356 ATGGACCTAAAAATTGCAGATGG - Intronic
948507908 2:238442749-238442771 CTGGACATCCATATGGAAAAAGG - Intronic
1173248274 20:41350795-41350817 CTTGAGCAAGAAATGGAAGACGG + Intronic
1174183089 20:48687169-48687191 GGGGACCTACACATGGGAGATGG - Intronic
1175581571 20:60103811-60103833 CAGGACCTACAACTTCAAGAAGG - Intergenic
1178408725 21:32346993-32347015 CTGGAGGTACACATGGATGAGGG + Exonic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179633060 21:42690636-42690658 CTGGACCTAACAGTGGCAGAGGG - Intronic
951451443 3:22843903-22843925 CTGGACCTATAACTTGAAGATGG - Intergenic
952707932 3:36399110-36399132 TTGGCTCTAGAAATGGAAGAGGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954549259 3:51466871-51466893 CTCGACCTACCAAGAGAAGAGGG + Exonic
956176114 3:66474709-66474731 CTGGACCTGCAAATGGGAGTGGG - Intronic
957365527 3:79217988-79218010 ATAGACATAAAAATGGAAGATGG + Intronic
957414787 3:79887483-79887505 CTGGTCCTAAGACTGGAAGATGG - Intergenic
958898236 3:99854485-99854507 CTGGAACTATTAATGGAAAAAGG - Intronic
959358001 3:105356189-105356211 CTATACCTATAAAAGGAAGAGGG - Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
960638690 3:119808011-119808033 CTGGGCATTCAAATGGAAAAGGG + Intronic
960707744 3:120496535-120496557 CTTGAGTTACAAATGGATGATGG + Intergenic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
963921271 3:150908214-150908236 AAGGACATAAAAATGGAAGAGGG - Intronic
966314370 3:178629161-178629183 CTGGAACTAAAAATGCAGGAAGG - Intronic
967062506 3:185884623-185884645 TAGGAGCTACAAAAGGAAGAAGG + Intergenic
969073291 4:4557122-4557144 GTGGACCAAGAAATGGAGGAAGG - Intergenic
969592126 4:8127889-8127911 CTGCCCCTACACATGGAGGAAGG - Intronic
972711777 4:41604210-41604232 CTGTGCCTACAAATGGAAAGGGG - Intronic
974465876 4:62255330-62255352 CTGCAGTTACAAATGGAACAGGG + Intergenic
974636986 4:64577954-64577976 GAGGACATACAAATGGGAGAGGG + Intergenic
975461084 4:74654106-74654128 CTAGAGCTACAAATGGAAGAGGG + Intergenic
976630668 4:87232849-87232871 ATGGACCAACAAATTGAACATGG - Intronic
977060997 4:92256695-92256717 TTGGACCGACACATGGAAAATGG - Intergenic
980099097 4:128523515-128523537 CATGAGCTAGAAATGGAAGAAGG - Intergenic
980190175 4:129514984-129515006 CTGCAGCTAAAGATGGAAGATGG + Intergenic
980424248 4:132605960-132605982 CTGGCTTTACAAATGAAAGAAGG + Intergenic
980972836 4:139582980-139583002 CTGAACTTACATATGTAAGAAGG + Intronic
981483915 4:145264987-145265009 CTGGACCAAGAAATGTAAGATGG + Intergenic
982419393 4:155176859-155176881 CTGTACCTTCACATGGCAGAAGG + Intergenic
984493527 4:180467761-180467783 AAGAACCTACAATTGGAAGAGGG + Intergenic
988605323 5:32673960-32673982 CGGGACCTAGAAAGGGGAGAAGG + Intergenic
992405699 5:76455565-76455587 CAGGATCTACACATGAAAGAGGG - Intronic
995704764 5:114976795-114976817 CTGGACTTACAATTGCATGACGG - Intergenic
998819927 5:146049118-146049140 CTGGACCTGCAAAAGGGAGAAGG + Exonic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1009964272 6:70562361-70562383 CTGGACTTAAAACTGGATGAGGG - Intergenic
1010659267 6:78549939-78549961 CAGGACCTACAAATTTAGGAAGG - Intergenic
1011161560 6:84396648-84396670 CTAGAACTACAGATAGAAGAGGG + Intergenic
1011265329 6:85512093-85512115 CTGGCCTTCCACATGGAAGAAGG - Intronic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1020740264 7:12007124-12007146 CTGAACCTACAGATAGAAGGTGG + Intergenic
1021518996 7:21519802-21519824 CTGGACATAGTAATGGAAGAAGG + Intergenic
1023792573 7:43764856-43764878 CTGCACCTTGAAATAGAAGAGGG - Intronic
1025108355 7:56191942-56191964 CTGGACCTCCAAGAGGGAGATGG + Intergenic
1025944707 7:66096910-66096932 CTGGTCTTGCAGATGGAAGAAGG - Intronic
1026309917 7:69174465-69174487 CTGGACCTCCAAGAGGGAGATGG - Intergenic
1030566635 7:111165823-111165845 CTTGGCCTTCAAATGGTAGAAGG - Intronic
1031739225 7:125407817-125407839 CTGGTGTTGCAAATGGAAGAAGG + Intergenic
1037862993 8:22419494-22419516 CTGGACTTACAAGATGAAGAAGG + Intronic
1038480982 8:27901765-27901787 CTGGAGCTACCAGTGAAAGAGGG + Intronic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1042573596 8:70193580-70193602 AAGGATCTACAAATTGAAGATGG + Intronic
1044317630 8:90768188-90768210 TTGGACCTACAAATGAAACCTGG - Intronic
1044696835 8:94932102-94932124 CTGGCCCTACAAATGTTAAATGG + Intronic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048616460 8:136080553-136080575 CTGGATTTCCTAATGGAAGAGGG - Intergenic
1049719351 8:144108457-144108479 CTGCACCTGCACAAGGAAGACGG + Exonic
1051698066 9:19789725-19789747 CTGGGCCAAAGAATGGAAGACGG + Intergenic
1055224167 9:73973883-73973905 CAGGGCCTAGAAATGAAAGACGG + Intergenic
1056159471 9:83874085-83874107 CTGGAGCAACATGTGGAAGAGGG - Intronic
1056351100 9:85749840-85749862 CTGGAGCAACATGTGGAAGAGGG + Intergenic
1056808479 9:89746213-89746235 CTGGAGCTACAAGTGGGAGGGGG + Intergenic
1058373881 9:104301481-104301503 CGTGATCTACTAATGGAAGATGG + Intergenic
1059501365 9:114756841-114756863 GTGGACCACCAACTGGAAGAAGG + Intergenic
1061896457 9:133651048-133651070 CTGTAGCTACAACTGGAAGGTGG - Intronic
1062559680 9:137135828-137135850 CTGCACTTACAAATGGAACGTGG - Intergenic
1062698430 9:137887069-137887091 CTGGACTTACAAGTGGCAGCTGG + Intronic
1185634717 X:1543311-1543333 CTGGACATTCAGACGGAAGAGGG + Intergenic
1188584917 X:31762213-31762235 CTGTACTTTAAAATGGAAGAAGG - Intronic
1189649651 X:43175822-43175844 CTGCACCATCACATGGAAGAAGG + Intergenic
1190443419 X:50498496-50498518 ACGTACCTACAAATGGAAAAAGG - Intergenic
1192763225 X:74118381-74118403 CTGGCCCCAGCAATGGAAGAAGG - Intergenic
1195093925 X:101488427-101488449 GTGGACCTAGAAGTGGAGGAAGG - Exonic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1197458779 X:126712358-126712380 CTGCACCTAGGAATGGAAGTGGG + Intergenic
1199266082 X:145827998-145828020 CTGGCCCTACAAATGACAAATGG + Exonic
1200422566 Y:2987145-2987167 CTGAAGTTACAAATGAAAGAAGG - Intergenic