ID: 915544902

View in Genome Browser
Species Human (GRCh38)
Location 1:156591704-156591726
Sequence GGGCCAGCACGCGCGGATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544902_915544917 19 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544902_915544919 24 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544919 1:156591751-156591773 GCCGCACATGCGCCGGGGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 146
915544902_915544915 17 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544915 1:156591744-156591766 GGCGAGCGCCGCACATGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 46
915544902_915544911 -4 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544911 1:156591723-156591745 GCCCGGCCTCTTCGGGGGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 170
915544902_915544909 -6 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544909 1:156591721-156591743 TGGCCCGGCCTCTTCGGGGGCGG 0: 1
1: 0
2: 2
3: 11
4: 172
915544902_915544916 18 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544916 1:156591745-156591767 GCGAGCGCCGCACATGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 45
915544902_915544921 28 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544921 1:156591755-156591777 CACATGCGCCGGGGCCGGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 177
915544902_915544907 -10 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544907 1:156591717-156591739 GTGCTGGCCCGGCCTCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 113
915544902_915544910 -5 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544910 1:156591722-156591744 GGCCCGGCCTCTTCGGGGGCGGG 0: 1
1: 0
2: 5
3: 17
4: 182
915544902_915544922 29 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
915544902_915544908 -9 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544908 1:156591718-156591740 TGCTGGCCCGGCCTCTTCGGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
915544902_915544918 23 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544902 Original CRISPR GGGCCAGCACGCGCGGATTC CGG (reversed) Intergenic