ID: 915544912

View in Genome Browser
Species Human (GRCh38)
Location 1:156591724-156591746
Sequence GCCCCGCCCCCGAAGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544912_915544918 3 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86
915544912_915544916 -2 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544916 1:156591745-156591767 GCGAGCGCCGCACATGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 45
915544912_915544922 9 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
915544912_915544927 16 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544927 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG 0: 3
1: 4
2: 44
3: 221
4: 1349
915544912_915544924 14 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG 0: 1
1: 6
2: 58
3: 354
4: 1578
915544912_915544915 -3 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544915 1:156591744-156591766 GGCGAGCGCCGCACATGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 46
915544912_915544917 -1 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544912_915544923 13 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544923 1:156591760-156591782 GCGCCGGGGCCGGGCCGGGCCGG 0: 1
1: 8
2: 61
3: 352
4: 1899
915544912_915544921 8 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544921 1:156591755-156591777 CACATGCGCCGGGGCCGGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 177
915544912_915544919 4 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544919 1:156591751-156591773 GCCGCACATGCGCCGGGGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 146
915544912_915544925 15 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544925 1:156591762-156591784 GCCGGGGCCGGGCCGGGCCGGGG 0: 1
1: 7
2: 66
3: 372
4: 1883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544912 Original CRISPR GCCCCGCCCCCGAAGAGGCC GGG (reversed) Intergenic