ID: 915544917

View in Genome Browser
Species Human (GRCh38)
Location 1:156591746-156591768
Sequence CGAGCGCCGCACATGCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544912_915544917 -1 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544902_915544917 19 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544914_915544917 -6 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544913_915544917 -2 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544900_915544917 30 Left 915544900 1:156591693-156591715 CCGAGCGGCTTCCGGAATCCGCG 0: 1
1: 0
2: 1
3: 1
4: 22
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31
915544904_915544917 12 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544917 1:156591746-156591768 CGAGCGCCGCACATGCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544917 Original CRISPR CGAGCGCCGCACATGCGCCG GGG Exonic