ID: 915544918

View in Genome Browser
Species Human (GRCh38)
Location 1:156591750-156591772
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544914_915544918 -2 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86
915544902_915544918 23 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86
915544913_915544918 2 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86
915544904_915544918 16 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86
915544912_915544918 3 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type