ID: 915544922

View in Genome Browser
Species Human (GRCh38)
Location 1:156591756-156591778
Sequence ACATGCGCCGGGGCCGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544912_915544922 9 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
915544913_915544922 8 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
915544904_915544922 22 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
915544902_915544922 29 Left 915544902 1:156591704-156591726 CCGGAATCCGCGCGTGCTGGCCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262
915544914_915544922 4 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544922 1:156591756-156591778 ACATGCGCCGGGGCCGGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544922 Original CRISPR ACATGCGCCGGGGCCGGGCC GGG Exonic