ID: 915544923

View in Genome Browser
Species Human (GRCh38)
Location 1:156591760-156591782
Sequence GCGCCGGGGCCGGGCCGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2321
Summary {0: 1, 1: 8, 2: 61, 3: 352, 4: 1899}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544913_915544923 12 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544923 1:156591760-156591782 GCGCCGGGGCCGGGCCGGGCCGG 0: 1
1: 8
2: 61
3: 352
4: 1899
915544904_915544923 26 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544923 1:156591760-156591782 GCGCCGGGGCCGGGCCGGGCCGG 0: 1
1: 8
2: 61
3: 352
4: 1899
915544912_915544923 13 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544923 1:156591760-156591782 GCGCCGGGGCCGGGCCGGGCCGG 0: 1
1: 8
2: 61
3: 352
4: 1899
915544914_915544923 8 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544923 1:156591760-156591782 GCGCCGGGGCCGGGCCGGGCCGG 0: 1
1: 8
2: 61
3: 352
4: 1899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544923 Original CRISPR GCGCCGGGGCCGGGCCGGGC CGG Exonic