ID: 915544924

View in Genome Browser
Species Human (GRCh38)
Location 1:156591761-156591783
Sequence CGCCGGGGCCGGGCCGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1997
Summary {0: 1, 1: 6, 2: 58, 3: 354, 4: 1578}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544904_915544924 27 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG 0: 1
1: 6
2: 58
3: 354
4: 1578
915544914_915544924 9 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG 0: 1
1: 6
2: 58
3: 354
4: 1578
915544913_915544924 13 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG 0: 1
1: 6
2: 58
3: 354
4: 1578
915544912_915544924 14 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG 0: 1
1: 6
2: 58
3: 354
4: 1578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544924 Original CRISPR CGCCGGGGCCGGGCCGGGCC GGG Exonic