ID: 915544925

View in Genome Browser
Species Human (GRCh38)
Location 1:156591762-156591784
Sequence GCCGGGGCCGGGCCGGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2329
Summary {0: 1, 1: 7, 2: 66, 3: 372, 4: 1883}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544904_915544925 28 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544925 1:156591762-156591784 GCCGGGGCCGGGCCGGGCCGGGG 0: 1
1: 7
2: 66
3: 372
4: 1883
915544912_915544925 15 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544925 1:156591762-156591784 GCCGGGGCCGGGCCGGGCCGGGG 0: 1
1: 7
2: 66
3: 372
4: 1883
915544913_915544925 14 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544925 1:156591762-156591784 GCCGGGGCCGGGCCGGGCCGGGG 0: 1
1: 7
2: 66
3: 372
4: 1883
915544914_915544925 10 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544925 1:156591762-156591784 GCCGGGGCCGGGCCGGGCCGGGG 0: 1
1: 7
2: 66
3: 372
4: 1883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544925 Original CRISPR GCCGGGGCCGGGCCGGGCCG GGG Exonic