ID: 915544927

View in Genome Browser
Species Human (GRCh38)
Location 1:156591763-156591785
Sequence CCGGGGCCGGGCCGGGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1621
Summary {0: 3, 1: 4, 2: 44, 3: 221, 4: 1349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544912_915544927 16 Left 915544912 1:156591724-156591746 CCCGGCCTCTTCGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 915544927 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG 0: 3
1: 4
2: 44
3: 221
4: 1349
915544914_915544927 11 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544927 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG 0: 3
1: 4
2: 44
3: 221
4: 1349
915544904_915544927 29 Left 915544904 1:156591711-156591733 CCGCGCGTGCTGGCCCGGCCTCT 0: 1
1: 0
2: 2
3: 9
4: 163
Right 915544927 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG 0: 3
1: 4
2: 44
3: 221
4: 1349
915544913_915544927 15 Left 915544913 1:156591725-156591747 CCGGCCTCTTCGGGGGCGGGGCG 0: 1
1: 1
2: 1
3: 16
4: 153
Right 915544927 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG 0: 3
1: 4
2: 44
3: 221
4: 1349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544927 Original CRISPR CCGGGGCCGGGCCGGGCCGG GGG Exonic