ID: 915544931

View in Genome Browser
Species Human (GRCh38)
Location 1:156591782-156591804
Sequence GGGGCGCGCGCTCTGCGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915544914_915544931 30 Left 915544914 1:156591729-156591751 CCTCTTCGGGGGCGGGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 915544931 1:156591782-156591804 GGGGCGCGCGCTCTGCGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 105
915544920_915544931 7 Left 915544920 1:156591752-156591774 CCGCACATGCGCCGGGGCCGGGC 0: 1
1: 0
2: 0
3: 13
4: 98
Right 915544931 1:156591782-156591804 GGGGCGCGCGCTCTGCGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 105
915544928_915544931 -10 Left 915544928 1:156591769-156591791 CCGGGCCGGGCCGGGGGCGCGCG 0: 1
1: 3
2: 21
3: 116
4: 688
Right 915544931 1:156591782-156591804 GGGGCGCGCGCTCTGCGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 105
915544926_915544931 -4 Left 915544926 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG 0: 3
1: 2
2: 41
3: 237
4: 1317
Right 915544931 1:156591782-156591804 GGGGCGCGCGCTCTGCGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915544931 Original CRISPR GGGGCGCGCGCTCTGCGAGC TGG Exonic