ID: 915545857

View in Genome Browser
Species Human (GRCh38)
Location 1:156597336-156597358
Sequence AGAGAACACTGGATGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915545855_915545857 6 Left 915545855 1:156597307-156597329 CCAGTGACATGATGACATTTATG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG 0: 1
1: 0
2: 1
3: 21
4: 275
915545854_915545857 7 Left 915545854 1:156597306-156597328 CCCAGTGACATGATGACATTTAT 0: 1
1: 0
2: 1
3: 24
4: 246
Right 915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG 0: 1
1: 0
2: 1
3: 21
4: 275
915545853_915545857 23 Left 915545853 1:156597290-156597312 CCTAGGTCAAACAAGACCCAGTG 0: 1
1: 0
2: 1
3: 11
4: 373
Right 915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG 0: 1
1: 0
2: 1
3: 21
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915545857 Original CRISPR AGAGAACACTGGATGCTTTG TGG Intronic
900490563 1:2946818-2946840 ATAGAGCACTGGAGGCTTAGCGG - Intergenic
902631722 1:17708691-17708713 AGAGAATGCTGGTGGCTTTGGGG + Intergenic
903381255 1:22898489-22898511 AGAGAGAAATGGAAGCTTTGAGG + Intronic
903424385 1:23242849-23242871 AGGTAACACTGGAAGCTTTTGGG + Intergenic
903589799 1:24446176-24446198 AGAGAAAATTGAATGCTTTCGGG + Intronic
903602048 1:24549691-24549713 GGAGAACAGTGGGGGCTTTGAGG - Intergenic
908084468 1:60616003-60616025 AGAGGACTTTGAATGCTTTGTGG + Intergenic
908579061 1:65494507-65494529 AAAGAAAAATTGATGCTTTGGGG - Intronic
911683325 1:100744567-100744589 ACAGATCAGTGGTTGCTTTGGGG + Intergenic
912403083 1:109412434-109412456 AGAGTAAACTTGGTGCTTTGAGG - Intronic
912619469 1:111140371-111140393 AGAGAGGACTGGATGCTCTGGGG + Intronic
912949962 1:114113793-114113815 AGAGCACTCTGGCTGCTGTGTGG - Intronic
913085460 1:115432577-115432599 AGAGATCACAGGACGTTTTGAGG + Intergenic
913205651 1:116536027-116536049 AGAGTACACTGTATTTTTTGTGG + Exonic
914339422 1:146746293-146746315 TGAGCACACTGGAAGATTTGAGG + Intergenic
915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG + Intronic
915934507 1:160082797-160082819 AGAGGACCCTGGGTGCTTTGGGG + Intronic
916052536 1:161046401-161046423 TTAGAACACTAGAAGCTTTGGGG - Intergenic
917072849 1:171171090-171171112 AGAAAACAGTGGAAGCTTGGTGG - Intergenic
917204357 1:172555248-172555270 AGAGAACACTGGAGGCATAGGGG + Intronic
919144276 1:193613748-193613770 AAAGGACTCTGGATGCTGTGTGG + Intergenic
920906338 1:210173330-210173352 AGAGAAAACTGAAAGCTTTCAGG + Intergenic
921179727 1:212622471-212622493 TGAGAACACAGGATGCTCAGTGG - Intergenic
921292562 1:213672086-213672108 AGAGCATCCTGGAAGCTTTGAGG - Intergenic
922168344 1:223134388-223134410 AGAAAACACAGGAAGCTTTCCGG - Intronic
923729595 1:236537665-236537687 AGAGACCATTTGATACTTTGAGG + Intronic
924062812 1:240193807-240193829 AGATAACTCTGGAGGCATTGTGG - Intronic
924513593 1:244748436-244748458 GGAGAACACTGGATGCTGATTGG + Intergenic
1062994091 10:1848634-1848656 AGAGAACAGAGGAGGATTTGTGG + Intergenic
1064392334 10:14952802-14952824 AGAAATCACTGGTGGCTTTGTGG + Intronic
1065136083 10:22671593-22671615 AGAGAACACAGGATGCTGGGAGG + Intronic
1065422920 10:25567100-25567122 ACAGAAGACTGGATGGCTTGAGG + Intronic
1066510285 10:36087858-36087880 AGAGAAAAATGGCTGCATTGAGG + Intergenic
1067100802 10:43333140-43333162 AGAGAAGGCTGGAAGCTTAGGGG - Intergenic
1067112608 10:43410815-43410837 AGAGAAAACTGCATAATTTGAGG + Intergenic
1067224792 10:44368565-44368587 TGAGAAAAGTGGATTCTTTGGGG - Intergenic
1068498201 10:57812179-57812201 AGAGAAAACTGTATCCTCTGTGG - Intergenic
1068645160 10:59457942-59457964 AAGGAACACTGGATGCTGTGTGG + Intergenic
1069075001 10:64030096-64030118 AGAAAGCACTGAGTGCTTTGGGG + Intergenic
1069358673 10:67616464-67616486 AGACCACACTGGCTTCTTTGAGG + Intronic
1070061301 10:72985688-72985710 AGAGGAGACTGGATCTTTTGTGG - Intergenic
1071252932 10:83839323-83839345 AAAGAACACTGGATATTTTTTGG + Intergenic
1072499431 10:95998390-95998412 AGAGCACACAGGATGTTTAGGGG - Intronic
1072537135 10:96372197-96372219 AGAAAACGCTGCATGGTTTGTGG - Intronic
1072601217 10:96931902-96931924 AGAGAAGACTGAATGTTTTAAGG + Intronic
1075087264 10:119421968-119421990 AGAGTCCACTGGATGGTTTCTGG - Intronic
1075159338 10:120009661-120009683 AGACAACACTGGGTGGTCTGTGG - Intergenic
1075555065 10:123424675-123424697 ACAGAACACAGGATGTCTTGGGG + Intergenic
1077457262 11:2688564-2688586 AGCGAGCACTGGCTGCTATGAGG - Intronic
1077837066 11:5934743-5934765 AGATGACAATGGAGGCTTTGTGG + Intronic
1079472914 11:20797210-20797232 AGACCACACTGGCTGCTTAGTGG + Intronic
1079475208 11:20822786-20822808 AGAGAACGCTGGAAGATTGGAGG + Intronic
1079933158 11:26590080-26590102 AGAGAATAGATGATGCTTTGAGG + Intronic
1080745820 11:35107818-35107840 AGGAAACACTGGCTCCTTTGGGG + Intergenic
1082274737 11:50209077-50209099 AGAGAAAACTGGATGCAGTTAGG - Intergenic
1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG + Exonic
1083022778 11:59524154-59524176 AGAGAGCAATATATGCTTTGTGG + Intergenic
1083911717 11:65713675-65713697 AGAGAACAAGAGATGGTTTGGGG - Intronic
1084834889 11:71795263-71795285 AGGGAACAATGGATGCTGTTGGG + Intronic
1084869145 11:72084275-72084297 TGATAACACAGGAAGCTTTGAGG - Intronic
1085032606 11:73281815-73281837 AGAGAACTCTGGAAGCTCTAAGG + Intronic
1085710414 11:78824267-78824289 GGAGACCACTGGAAGCTTAGAGG + Intronic
1087886460 11:103488622-103488644 AGAGAAAACTGGATAAATTGTGG - Intergenic
1088706643 11:112469866-112469888 ACAGAGCACTGGATACGTTGTGG + Intergenic
1089531804 11:119134702-119134724 TGAGGACTCTGGATTCTTTGAGG + Exonic
1089978742 11:122755039-122755061 AGAGAACAATGGCTTCTTTAAGG - Intronic
1090540229 11:127693990-127694012 AGTGAATTCTGTATGCTTTGGGG + Intergenic
1090681591 11:129064987-129065009 AGGGAAAACTGGATGGTTTCTGG + Intronic
1092760268 12:11804252-11804274 AGATTACTCTGGATGCTGTGTGG - Intronic
1092792848 12:12084606-12084628 AGGGAACACTGGATGGGGTGGGG - Intronic
1094256934 12:28441800-28441822 TCAGAACACTTGTTGCTTTGGGG + Intronic
1097779271 12:63684927-63684949 AGAGAACCCTGGATGGGGTGAGG + Intergenic
1100842600 12:98628934-98628956 AGGGGGCAATGGATGCTTTGAGG + Intronic
1103861055 12:124014275-124014297 AGAGCACACAGGCTGCTCTGGGG + Exonic
1105500186 13:20965104-20965126 AGAGAACACTGCATTCCTTAGGG - Intergenic
1106010886 13:25821176-25821198 TCAGAACACTGGCTGCTTAGAGG + Intronic
1106113570 13:26797860-26797882 AGCCAACACTGGATCCTTGGGGG + Intergenic
1108020177 13:46120251-46120273 AGAGAACACAGGAGGCTTCCTGG - Intergenic
1108626377 13:52232842-52232864 ATAGAAAACAGGATGCTCTGAGG + Intergenic
1109085866 13:57970915-57970937 AGGGAATACTGACTGCTTTGTGG + Intergenic
1110048933 13:70869856-70869878 AGGGAAAAGTGGATACTTTGGGG + Intergenic
1111639679 13:90951737-90951759 AGAGAAAACTGGGAGCATTGGGG + Intergenic
1111720254 13:91934864-91934886 AGAGAAGACTGAATGTCTTGTGG - Intronic
1113315057 13:109170477-109170499 ATAGAACACTGGCAGCTCTGCGG - Intronic
1114248928 14:20940797-20940819 AAAGACCACTGGATTCTTTCTGG - Intergenic
1117623056 14:57607764-57607786 AGAGAAAACTGGATGTCTAGGGG + Intronic
1117755977 14:58974559-58974581 AAACAACACTGGATGGTTTTAGG + Intergenic
1118006334 14:61567432-61567454 AGAGGACACTGGAGGCTGGGAGG - Intronic
1119053970 14:71399639-71399661 AGAGAAGAGAGGATGGTTTGAGG - Intronic
1119523904 14:75307142-75307164 AGATGACACTAGATGCTATGAGG + Intergenic
1121306414 14:92910498-92910520 AGAAAACTCTGGATGGTTGGGGG - Intergenic
1121821905 14:96976669-96976691 GGAGCACTCTGGCTGCTTTGTGG + Intergenic
1122656958 14:103268492-103268514 AGAGACCACAGAAAGCTTTGTGG + Intergenic
1126693875 15:51309541-51309563 AGAGAACACAGTCTGTTTTGGGG - Intronic
1126757063 15:51935257-51935279 AAACAACACTGCATGCTTGGGGG - Intronic
1126861764 15:52891229-52891251 AGAGCACCCTGCATTCTTTGAGG + Intergenic
1127777987 15:62283472-62283494 AGAGGAAACTGGGTGGTTTGGGG - Intergenic
1129381896 15:75173239-75173261 AGAGAAACCTGGGTGCCTTGAGG - Intergenic
1130416531 15:83699568-83699590 AAACAACACTGACTGCTTTGTGG - Intronic
1131417896 15:92276708-92276730 AGAGTAGGCTGGATTCTTTGAGG + Intergenic
1133851624 16:9509852-9509874 AGAGAAGTCTGGATGTATTGAGG - Intergenic
1135718124 16:24790670-24790692 AGAAAGCACTGGACGCCTTGAGG + Exonic
1137955537 16:52825285-52825307 AGATCACTCTGGATGTTTTGTGG - Intergenic
1139476995 16:67207755-67207777 ACAGGACACTGGATGCTATTGGG - Exonic
1139994854 16:70971054-70971076 TGAGCACACTGGAAGATTTGAGG - Intronic
1141257258 16:82414384-82414406 AGAGGAGACTGAATGTTTTGGGG + Intergenic
1144620816 17:16817376-16817398 GGAGGACACTGGATGTTTGGAGG + Intergenic
1144630790 17:16871174-16871196 AGAGAACACCGGCTGGTCTGCGG + Intergenic
1145998263 17:29116749-29116771 GGAAAACACTGGAAGCTCTGAGG + Intronic
1146109343 17:30073971-30073993 ATAGAAAAGTGGTTGCTTTGGGG - Intronic
1146824937 17:36013795-36013817 AGTGAACACGGGATGCTTCGTGG + Exonic
1147444058 17:40464079-40464101 AGACCACACAGGAGGCTTTGGGG + Intergenic
1147495867 17:40914599-40914621 TGAAAGCAGTGGATGCTTTGAGG + Intergenic
1148516349 17:48221824-48221846 AGAGAGCACTGCATGTTTTAAGG + Intronic
1149052053 17:52317198-52317220 AGGGAACACTGGAAGCAATGGGG - Intergenic
1151227312 17:72656682-72656704 AGAGAAGTCTGGATGCCCTGAGG - Intronic
1152282514 17:79393534-79393556 ATAGCACACTGGATGCTGAGCGG + Intronic
1152507695 17:80762066-80762088 AGAGAACACTGTCTTGTTTGGGG - Intronic
1157017972 18:43742302-43742324 AGTGACCACTGGTTGCATTGTGG - Intergenic
1157844584 18:50991308-50991330 AGAGAACACTTAATGCCGTGGGG - Intronic
1157965921 18:52207989-52208011 AGAGGAGACTTGATGCTTTCAGG + Intergenic
1158211539 18:55055673-55055695 AGAGAGAACTGAATGTTTTGAGG - Intergenic
1160070127 18:75621231-75621253 AGAGGCCACTGGCTGCTTTCTGG - Intergenic
1160262543 18:77308350-77308372 AGAGAACACAGAATGCTGTAGGG + Intergenic
1162680960 19:12340964-12340986 AAAGAACACTGGATGGTATCTGG + Intergenic
1163309431 19:16504401-16504423 TGACAACATAGGATGCTTTGGGG + Intronic
1164863622 19:31583757-31583779 ACAGAAAACTGGATGATTTAAGG + Intergenic
925837111 2:7956850-7956872 AGAGACCATTGGATGCTCTGCGG - Intergenic
926281909 2:11456001-11456023 AGAGAACCTGGGGTGCTTTGGGG + Intronic
927394148 2:22630306-22630328 ATAGAATGCTGAATGCTTTGGGG + Intergenic
927522167 2:23705620-23705642 AGAGAAGACTGGAAGCTTCAGGG + Intronic
928331194 2:30359385-30359407 AGACACCCCTGGATTCTTTGGGG + Intergenic
929406717 2:41650958-41650980 AGGGAATGTTGGATGCTTTGTGG + Intergenic
929573640 2:43039073-43039095 AGAGAACCCTGGATCCTTGAGGG - Intergenic
929608831 2:43254690-43254712 AGAGAAGAATGGCTGCTTGGAGG - Intronic
930075949 2:47405740-47405762 AGAAAACACTGGAAGTTTTTGGG + Intronic
930862167 2:56086343-56086365 AGAGTATACTGGATCCTTTCAGG + Intergenic
931066253 2:58590903-58590925 TGAAATCACTGGATGCTTTCTGG - Intergenic
931295814 2:60924026-60924048 AGTGCATACTTGATGCTTTGAGG - Exonic
931813231 2:65875222-65875244 AAAGAACACAGGCAGCTTTGGGG - Intergenic
932131691 2:69193333-69193355 AGGGAAAACTCGATGCCTTGTGG + Exonic
932544653 2:72695111-72695133 AAAGACGGCTGGATGCTTTGGGG + Intronic
935365192 2:102281854-102281876 AGAGGCCACTGTATGCTTTCAGG + Intergenic
936751139 2:115643545-115643567 ACAGAACACTGGATGATTCTGGG + Intronic
938009466 2:127817344-127817366 AGAGAACATTTCAGGCTTTGTGG - Intergenic
938382118 2:130842591-130842613 AGTGACTACTGGGTGCTTTGTGG - Intronic
938981271 2:136529501-136529523 AGGAAAGACTGGAGGCTTTGGGG + Intergenic
939099764 2:137881900-137881922 AGAGACCAGTGCATGATTTGAGG - Intergenic
940439464 2:153697178-153697200 AGAGACCACTGCTAGCTTTGAGG - Intergenic
941585279 2:167350864-167350886 AGAGATCAGTGCATGATTTGAGG - Intergenic
941951970 2:171165098-171165120 AGAGATCATTGGAAGCTTTCTGG + Intronic
943065764 2:183084491-183084513 AGAGAAAGGTGGATGCTTTCAGG + Intronic
943852951 2:192751390-192751412 AGAGAATAGTGGAAGTTTTGTGG - Intergenic
944015151 2:195026944-195026966 AGAGAAGAGTGGATGGATTGAGG + Intergenic
944054469 2:195509136-195509158 TGAGAACACTCAATGCTTTCAGG + Intergenic
947524534 2:230870164-230870186 CGAGATCACAGGCTGCTTTGAGG + Intronic
947564591 2:231185845-231185867 AGAGACCCCTGGATGCAGTGGGG + Intergenic
948162023 2:235832934-235832956 AGAGGATACTAGCTGCTTTGGGG - Intronic
948421288 2:237861892-237861914 AGAGTACACAGGATGCTCAGAGG - Intronic
1170373672 20:15677568-15677590 AGAGAACACTGGCCACTGTGTGG + Intronic
1173483810 20:43425260-43425282 TCAGAACAGTGGTTGCTTTGGGG + Intergenic
1173968158 20:47129632-47129654 AGAGCACTCTGGCTGCTGTGTGG + Intronic
1174257677 20:49270272-49270294 AGAGACAACTGCATACTTTGAGG - Exonic
1174680340 20:52400352-52400374 AGAGATAATTGGATGCTCTGAGG + Intergenic
1174933146 20:54837679-54837701 AGAGAACGATGGCTGCTCTGAGG + Intergenic
1174987716 20:55473975-55473997 AGATAACACTGTATTATTTGTGG + Intergenic
1175678047 20:60964008-60964030 AAAGAACACAGGATTCTTTGGGG + Intergenic
1180790855 22:18574755-18574777 TGAGAACCCTGGATGCCATGTGG - Intergenic
1180909667 22:19440552-19440574 AGAGACCTCTGGCTGCTGTGTGG - Intronic
1180977984 22:19860994-19861016 AGAGAACACTGGTTTCTAAGGGG - Intergenic
1181230882 22:21420559-21420581 TGAGAACCCTGGATGCCATGTGG + Intronic
1181247766 22:21514310-21514332 TGAGAACCCTGGATGCCATGTGG - Intergenic
1181640301 22:24192861-24192883 AGAGGACAGTGCATGATTTGGGG + Intergenic
1184799364 22:46750591-46750613 TGAAATCACTGCATGCTTTGAGG - Intergenic
950039187 3:9908887-9908909 ACAGAGCACTGGGTGCCTTGGGG + Intronic
950129898 3:10534820-10534842 AGAGGGCACTGGATGCTATAGGG + Intronic
951205268 3:19919595-19919617 AGAGAACAATAGATAGTTTGTGG + Intronic
953545380 3:43860493-43860515 TGAGAACACAGCATTCTTTGAGG + Intergenic
953845783 3:46425205-46425227 AAAGAACATTGTGTGCTTTGGGG - Intergenic
953871196 3:46629129-46629151 AGAAAACACTGGAAGCTTCCCGG - Intergenic
954118009 3:48477970-48477992 AGACCACACTGGCTGCTCTGTGG - Intronic
956235815 3:67069659-67069681 AGATAATTCTGGCTGCTTTGTGG + Intergenic
956672927 3:71708295-71708317 TGAGAATAGTGGTTGCTTTGGGG + Intronic
957180199 3:76867825-76867847 AGAGAACATTGTTTTCTTTGTGG + Intronic
960813153 3:121644698-121644720 ACAGGACAGTGGATGCTGTGAGG - Intronic
961301368 3:125924213-125924235 AGGGAACAATGGATGCTATCGGG + Intergenic
961887119 3:130103646-130103668 AGGGAACAGTGGATGCTGTCGGG - Intronic
963008532 3:140748798-140748820 AGAGAACACTGGAGAGTGTGTGG + Intergenic
963359561 3:144253287-144253309 AGATAACACTGTATTCTATGAGG + Intergenic
964676598 3:159289205-159289227 AGTTCACACTGGGTGCTTTGTGG - Intronic
968996258 4:3947647-3947669 AGGGAACAATGGATGCTGTCAGG - Intergenic
969757723 4:9161043-9161065 AGGGAACAATGGATGCTGTCGGG + Intergenic
969951906 4:10845583-10845605 AGAAACCACTGGTTGCTTTTAGG - Intergenic
970113201 4:12662016-12662038 AGAGAAAAGTGGATGGTTTGAGG - Intergenic
972699601 4:41481519-41481541 AAAGATCCCTGGATGCTGTGTGG + Intronic
976886735 4:89994300-89994322 ATACAAAACTGGAAGCTTTGAGG + Intergenic
978340589 4:107718267-107718289 AGAGAAGACTTGATTCTATGGGG - Intronic
978907700 4:114027544-114027566 AGATCACACTTGCTGCTTTGTGG - Intergenic
980904886 4:138938689-138938711 AGAGAACTGTGGATGTTTTAAGG + Intergenic
980992713 4:139751832-139751854 AGATAAGAATGGATACTTTGCGG - Intronic
981518811 4:145639096-145639118 AGAAAACACTGGATGCGTTTTGG - Exonic
982048499 4:151474726-151474748 AGATAAAACTGGATGCTTCAGGG - Intronic
982264922 4:153529549-153529571 AGAGAAAACTGAATCCTTGGGGG + Intronic
982422139 4:155209883-155209905 AGAGACCAGTTCATGCTTTGAGG - Intronic
982753399 4:159190283-159190305 AAAGATCTCTGGAAGCTTTGTGG + Intronic
983638873 4:169925712-169925734 AGATAACCGTGGATGCCTTGGGG + Intergenic
985819476 5:2149843-2149865 AGAGGACACTGGGTGCTTGCAGG - Intergenic
985931714 5:3063629-3063651 AGAGAACCCTTGATTCTTTCAGG - Intergenic
987191311 5:15481224-15481246 AGAGAACATAGGATGACTTGGGG + Intergenic
988625953 5:32874793-32874815 AGAGAATACTGGGTACTTGGTGG - Intergenic
988628504 5:32902498-32902520 TGAGAATACTTTATGCTTTGTGG - Intergenic
989168046 5:38449557-38449579 AGAGACCACTAGGTGGTTTGGGG + Intronic
990516362 5:56534556-56534578 AGAGAACATGGGATTATTTGTGG - Intronic
991437923 5:66615278-66615300 AGAGGACACTGGCTACTTGGTGG + Intronic
992157720 5:73971447-73971469 AGAGTACAATGGCTGCTTGGTGG - Intergenic
993549127 5:89251528-89251550 AGAGAAAACTGTATAATTTGGGG + Intergenic
993852526 5:93028767-93028789 AGAAAACATTGGATGCAGTGAGG - Intergenic
994203070 5:97000928-97000950 AGATAACACTGGATCCTTGCTGG - Intronic
994468782 5:100175516-100175538 AGAGCACAATGAATGCTGTGAGG + Intergenic
994884467 5:105541722-105541744 TGAGACCACTGGGTGCCTTGGGG - Intergenic
995311886 5:110722543-110722565 AGAGCACACAGGAAGCTCTGAGG - Intronic
998046190 5:138989015-138989037 TGACAACACTGGTTGCCTTGAGG + Intronic
998462008 5:142316808-142316830 AGAAAAGACTGGATGCTTTTTGG - Intronic
998654587 5:144162696-144162718 AAAGAACTCTGGATGATTTTAGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000361302 5:160450140-160450162 AGAGAAAAGTAGATGCATTGGGG + Intergenic
1000874729 5:166621890-166621912 AGAGCATACTGGCTGCTTTGGGG + Intergenic
1003844459 6:10158585-10158607 TGGAAACACTGGTTGCTTTGGGG - Intronic
1004585453 6:16995231-16995253 AGAGAACACTGGCTGCAATGTGG - Intergenic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1005827501 6:29643260-29643282 AGAGACCCCTGGGTGCCTTGAGG - Intergenic
1005939226 6:30548213-30548235 GGAGAAAACTGGAAGCCTTGGGG + Intronic
1006694196 6:35917239-35917261 AGAGACCTCTGGATGCTTGGGGG - Intronic
1007203064 6:40127080-40127102 AGAAAACACAGGATGCTTCTTGG + Intergenic
1007640682 6:43337163-43337185 TGTGAACACTGGATTCTGTGTGG + Exonic
1009280224 6:61740754-61740776 AGAAAACACTTAATGCTTTTTGG - Intronic
1012831483 6:104208880-104208902 AGAGCAAACTGGAAGCTTTGAGG + Intergenic
1015103381 6:129507342-129507364 AGAGAACCCAGGCAGCTTTGGGG + Intronic
1016612878 6:146012521-146012543 AGAGGACACTGGAAGCTGAGAGG - Intergenic
1016878358 6:148885868-148885890 AGAGAACAGTAGATGATTGGGGG - Intronic
1017553874 6:155542208-155542230 AGAAAAGACTGAAAGCTTTGTGG - Intergenic
1018794611 6:167176136-167176158 AGAGAACAATGGAAGCTGTAGGG - Intronic
1018821709 6:167378931-167378953 AGAGAACAATGGAAGCTGTAGGG + Intronic
1018999157 6:168733561-168733583 AAAGAATACTGTATGCTTTCTGG + Intergenic
1020414419 7:7929662-7929684 AGAGAAGACTGGAGTCTCTGAGG + Intronic
1022560414 7:31342733-31342755 AGACAGCACTGGCTGCTTTGTGG - Intergenic
1022938195 7:35202614-35202636 AGAGAACCCTGGATGGGGTGAGG + Exonic
1025211827 7:57023796-57023818 AGAGAACACTTCATTTTTTGTGG - Intergenic
1025660128 7:63553032-63553054 AGAGAACACTTCATTTTTTGTGG + Intergenic
1027369745 7:77495426-77495448 AAGGATCACTGGATGCTCTGTGG + Intergenic
1029581120 7:101437187-101437209 AGAGAAGTCTGGGTACTTTGAGG + Intronic
1037764803 8:21766063-21766085 AGAAACCACTGGAGGCATTGAGG - Intronic
1037885101 8:22591724-22591746 ACAGGGCACTGGATGCTTTCAGG + Intronic
1042738565 8:72017068-72017090 ACAGAAAACTTGATGCTTGGAGG + Intronic
1044334473 8:90962910-90962932 TGAAAAAACAGGATGCTTTGAGG + Intronic
1044857317 8:96490014-96490036 AGAGAACAGTGGAAAGTTTGAGG + Intergenic
1045504149 8:102766900-102766922 ACAGTACACTGGCTTCTTTGAGG + Intergenic
1045553077 8:103190005-103190027 AGAGAACAAAGGGTGATTTGAGG + Intronic
1045582718 8:103499092-103499114 AGCGACCACTGGAGGCTGTGAGG - Intergenic
1046929621 8:119829077-119829099 AGACAACAGTGGATGCGTTGGGG + Intronic
1047453483 8:124988202-124988224 AGTGACCACAGGATGGTTTGGGG - Intergenic
1047521112 8:125596065-125596087 AAAGAGCACTGGACTCTTTGGGG - Intergenic
1053245935 9:36534814-36534836 AAAAAACACTGAATGCTTTTGGG - Intergenic
1054992152 9:71340881-71340903 AGAGAACCCTGGATGATTTGGGG + Intronic
1055006985 9:71518837-71518859 AGAGAACAATTGCTCCTTTGAGG - Intergenic
1055357372 9:75451285-75451307 AGGGAACACAGGATGATGTGGGG - Intergenic
1056101525 9:83304742-83304764 AAAGCACACTGGACGCATTGAGG - Intronic
1056345896 9:85694475-85694497 AGTGACCACAGGATGCTTTTGGG - Intronic
1056993048 9:91428326-91428348 AGAGAAAAGTGGATGTTTGGGGG - Intergenic
1058580646 9:106452858-106452880 TCAGAATACTGGTTGCTTTGTGG - Intergenic
1059843666 9:118246815-118246837 AGAGACCACTACATGATTTGAGG + Intergenic
1061428948 9:130519092-130519114 AGAGGACAGTGGAAGCTTTGGGG - Intergenic
1061768324 9:132897008-132897030 AGAGATCACTGGGCGTTTTGAGG + Intronic
1185533228 X:838731-838753 AGAGAACACTGCTTGCCTTCAGG - Intergenic
1186325736 X:8474915-8474937 AGAGACCACTTCATGCTGTGGGG - Intergenic
1186922377 X:14296279-14296301 TGAGAGCACTGGATGTTTTTAGG + Intergenic
1186953906 X:14659046-14659068 AGAGGACACTGGAGCCTTTAAGG - Intronic
1187539129 X:20174134-20174156 AGATAATACTTGAGGCTTTGTGG - Intronic
1187993490 X:24900943-24900965 AGAGATCATTTTATGCTTTGAGG + Intronic
1189206581 X:39244777-39244799 AGAAAGCAATGCATGCTTTGAGG + Intergenic
1191656643 X:63605642-63605664 AGGAAACAATAGATGCTTTGAGG + Intergenic
1192700919 X:73471441-73471463 AGAGAAAAATGTATACTTTGTGG + Intergenic
1193292427 X:79791002-79791024 TGCAAACACTGAATGCTTTGTGG - Intergenic
1193424047 X:81319164-81319186 AGTAAACACTGGATGCTTGGAGG + Intergenic
1194007558 X:88515317-88515339 AGAGGACACTTGCTGCTTGGTGG - Intergenic
1194577900 X:95636990-95637012 ATAGAGCACTGGCTACTTTGTGG + Intergenic
1195502822 X:105622530-105622552 AGAGTACATAGGATTCTTTGAGG + Intronic
1196002516 X:110801958-110801980 AGGGAACTGTGGATGCTTTGAGG - Intergenic
1196049638 X:111291191-111291213 AGAGAGAACTGAATGCTTTCAGG + Intergenic
1198716285 X:139561007-139561029 AAAGAACTATGGATGCTTGGAGG - Intronic
1199120366 X:144045626-144045648 AGAGAACACTGGAATCTATAAGG - Intergenic
1199661054 X:150051643-150051665 ACAGAACAGGGGTTGCTTTGTGG - Intergenic
1199882404 X:151984921-151984943 TGAGAACAGTGGATACTTTAAGG + Intergenic
1200276986 X:154742678-154742700 AAAGTACACTGGCTGCTGTGGGG + Intronic
1200869839 Y:8085711-8085733 AGAGAATATTGGATTATTTGTGG - Intergenic
1201436153 Y:13960758-13960780 AGAGACCACTTCATGCTGTGGGG + Intergenic
1201664904 Y:16439970-16439992 AGAGAACATGGAATGATTTGTGG - Intergenic
1201984771 Y:19953951-19953973 ATACACCACTGGATGCTCTGTGG - Intergenic