ID: 915552180

View in Genome Browser
Species Human (GRCh38)
Location 1:156641758-156641780
Sequence TGTTCAAAGAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 1, 2: 4, 3: 59, 4: 566}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915552180 Original CRISPR TGTTCAAAGAAGAAGGAGGA GGG (reversed) Intronic
900459312 1:2793954-2793976 TGTCCACAGAAGAAGAAGGAGGG - Intronic
900489049 1:2937240-2937262 TGTGCAGAGGAGAGGGAGGAAGG + Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
902331762 1:15734352-15734374 TGTTCAAACACGAACAAGGATGG - Exonic
903046018 1:20564718-20564740 TATTCAAAGAAGAATGAGCTGGG - Intergenic
903565535 1:24262549-24262571 TGTTCTTTGAAGATGGAGGAAGG - Intergenic
903790371 1:25888831-25888853 TGTTCCAGGAAAAAGGAGGATGG + Intronic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904480250 1:30788842-30788864 TGTGCAGAGCAGAAGGAGGAGGG + Intergenic
904982903 1:34521849-34521871 TGGTCACAGAGGTAGGAGGAGGG + Intergenic
904987432 1:34563450-34563472 TGTCTAAAAAAGAAGTAGGATGG + Intergenic
905192726 1:36248174-36248196 TATTAAAAGATGAAGGAGGCTGG - Intronic
905430961 1:37923064-37923086 TGCTCAAAGAGGAAGGGGGCAGG + Intronic
905485192 1:38291162-38291184 TGTTAAAAAAAGAAAAAGGAAGG - Intergenic
908981420 1:69963584-69963606 TGTAGATAGAAGATGGAGGAAGG + Intronic
909061018 1:70879546-70879568 TGATCAAAAAAGAAAGAGGGAGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909550132 1:76889399-76889421 TATTTCAAGAAGAAGGATGATGG - Intronic
911729624 1:101279375-101279397 AGTTCAAAAAAGCAGGAGGCAGG - Intergenic
911891042 1:103372187-103372209 TGCTTAAATAAGAGGGAGGAAGG - Intergenic
913061564 1:115213156-115213178 TGTTCAAGAAAGAGAGAGGATGG - Intergenic
914938748 1:152003640-152003662 TGATCAAAGGAGAAGGAGGCTGG - Intergenic
915027705 1:152847693-152847715 TGTCTAAATAAGAAGGAGGGAGG + Intergenic
915552180 1:156641758-156641780 TGTTCAAAGAAGAAGGAGGAGGG - Intronic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
917594302 1:176513573-176513595 GGTTCACAGAAGAACTAGGATGG - Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918056450 1:181025647-181025669 TGATGAAAGAAGAGGGAGGAAGG + Intergenic
918362062 1:183769906-183769928 TGTTTAAAGAAAAAGTGGGATGG - Intronic
918448269 1:184635358-184635380 GGGAGAAAGAAGAAGGAGGAAGG - Intergenic
919086967 1:192932038-192932060 TGTACATAGAAGATGGAGGAAGG - Intergenic
920207377 1:204302415-204302437 TGTTCAAGCCAGAAGGAAGAAGG - Intronic
920992177 1:210950081-210950103 TGTTCAGAGAAGAATGAAGGTGG - Intronic
921063709 1:211608003-211608025 TTTTGAAAGAAGAAGTAGGTCGG - Intergenic
921333004 1:214058652-214058674 TGATCAAAGAGGAAGGAAAATGG + Intergenic
921562219 1:216672578-216672600 TGTTAAAATAAGAAGTAAGATGG + Intronic
922107793 1:222527383-222527405 TGTTCACAGAGGAAAGAGGTGGG - Intronic
922190753 1:223316554-223316576 TCTTCAGAGAAGGAGGAGGCAGG - Intronic
922850730 1:228731662-228731684 AGTTCATGGAAGAAGGAGGAAGG + Intergenic
922866063 1:228862653-228862675 TCTTCTTAGAAAAAGGAGGAGGG - Intergenic
923809044 1:237292045-237292067 TGTTCACAGCAAAAGTAGGAAGG - Intronic
923911581 1:238452244-238452266 TTTTCATAGAAGAAGTAGGTTGG + Intergenic
924286286 1:242490900-242490922 TTTACAAAGAGGAAGCAGGAAGG - Intronic
1062789006 10:289643-289665 TGTACCAAGAAGGAGGATGAGGG + Intronic
1064061859 10:12144747-12144769 TGTTCAAAGATCATTGAGGAGGG + Intronic
1064268982 10:13848462-13848484 TGGTCCAGGAAGAAGGGGGAGGG + Intronic
1064549172 10:16481324-16481346 AGTTCACAGAACAAGGAAGAAGG - Intronic
1064733900 10:18361021-18361043 TGCTCAGAGAAGTAGGAGGCAGG - Intronic
1064934846 10:20668199-20668221 TTTTCAAAGAGTAAGTAGGATGG + Intergenic
1065182728 10:23143214-23143236 AGTTAAAATAAGGAGGAGGATGG + Intergenic
1065760987 10:28983273-28983295 TGTTCTAAGAAGGAGGCAGAGGG - Intergenic
1066310905 10:34195656-34195678 TGTTCCGAGAAGAATGAGAAGGG + Intronic
1067508878 10:46878495-46878517 TGTTTTAGGAAGAATGAGGAGGG + Intergenic
1067653371 10:48173355-48173377 TGTTTTAGGAAGAACGAGGAGGG - Intronic
1068079771 10:52305974-52305996 TGAACAAAAAAGAAGAAGGAAGG + Intergenic
1068172659 10:53416225-53416247 TGTAGAAAGAAGAAGGAAGCTGG - Intergenic
1069087728 10:64160735-64160757 TTTTCAAAGAAGAAGGAGCCTGG - Intergenic
1070226518 10:74513869-74513891 TGTACAAAGGAGAAGGAGAAAGG - Intronic
1070389782 10:75959328-75959350 TTCTCACACAAGAAGGAGGAAGG - Intronic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1071361480 10:84850612-84850634 TGTTCAAATAAGTAGGAGTTTGG + Intergenic
1071403866 10:85308646-85308668 TGTTCAAAGAAGAAATCTGAAGG - Intergenic
1071914632 10:90278759-90278781 TGTTCAAAGAAGAAAACTGATGG - Intergenic
1071930192 10:90460922-90460944 AGAACAAAGAAGAATGAGGAAGG + Intergenic
1071971009 10:90906764-90906786 TGTTTAAAAGAGAAGGATGAGGG + Intronic
1072277376 10:93836338-93836360 TGTTGAAAGAAAAAAGAAGAAGG - Intergenic
1072294831 10:93998899-93998921 TGTTCTTAGAAGAAGGAGACAGG + Intronic
1072524990 10:96263651-96263673 TGGTGAAATAAGGAGGAGGAGGG + Intronic
1073068740 10:100780216-100780238 GGCTCAAAGAATGAGGAGGATGG - Intronic
1073280815 10:102352673-102352695 TGAGCAAGGGAGAAGGAGGAGGG + Intronic
1073580898 10:104664751-104664773 TATTCAAATATGAATGAGGAAGG + Intronic
1075765858 10:124892309-124892331 TACTCACAAAAGAAGGAGGAAGG - Intergenic
1076443513 10:130496282-130496304 TGATCAAAGGAGGATGAGGATGG + Intergenic
1077231980 11:1461822-1461844 TGTAGAAAGAAGCAGGAGCAAGG - Intronic
1077765486 11:5155431-5155453 TTTTGAAAGAAAAAGAAGGAAGG - Intronic
1078248817 11:9600559-9600581 TGTACAATGGAGAAGGAAGAAGG - Intergenic
1078740445 11:14060994-14061016 GGTTTAAAGGAGAAGGAAGAAGG + Intronic
1079089608 11:17471363-17471385 AGTTCAACAGAGAAGGAGGAAGG + Intronic
1079698660 11:23516779-23516801 GTTTCACAGAAGAAGCAGGATGG - Intergenic
1079885637 11:25985151-25985173 TTTTCAGAGAGGAAGCAGGAGGG + Intergenic
1080846222 11:36029364-36029386 TGTTAAAGGGAGCAGGAGGAGGG + Intronic
1081284588 11:41252162-41252184 TGTTGAAACAAAAAGCAGGAGGG + Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081803284 11:45874459-45874481 TGATCAAAGAGGAAAGAGAAGGG + Intronic
1083049941 11:59768113-59768135 TTTTTATAGAAGAAGGAGGCAGG + Intronic
1083396422 11:62395702-62395724 TGTGCAAAGATGAAGGCTGATGG - Intergenic
1084203343 11:67576796-67576818 TGTTCAAGGAGGAAGGTGGGGGG + Intergenic
1084694477 11:70745463-70745485 TTTTCAAGGCAGCAGGAGGAGGG - Intronic
1085691369 11:78666900-78666922 TGTACAAAGGAAAAGGGGGAGGG + Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086766895 11:90706732-90706754 TGTCCAAAGTAGTAGCAGGAAGG - Intergenic
1086948098 11:92864182-92864204 TATTCAAAGAGGTAGGAGGTGGG + Intronic
1087323812 11:96697022-96697044 TGTTCTAAGAAAAAGGAGGTGGG + Intergenic
1087386091 11:97471058-97471080 TGTGCATTGAAGAAGTAGGAAGG + Intergenic
1087591784 11:100198528-100198550 TAGTCAAAGAAGAAAAAGGAAGG + Intronic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1090080418 11:123608880-123608902 TGTGGAAAGAAGAATAAGGAAGG - Intronic
1090609783 11:128460557-128460579 AGTTGAAAGGATAAGGAGGAGGG - Exonic
1091182488 11:133619251-133619273 TGTTCATAGAAGATGGAAGGGGG + Intergenic
1092324491 12:7515435-7515457 TGTTCAGGGAAGAAAGACGAAGG + Intergenic
1092629911 12:10365980-10366002 TGTCAAAAGAATAAGGAGAATGG + Intergenic
1092815678 12:12310517-12310539 TGTTAACAGAAGAAAGGGGAAGG + Intergenic
1092830613 12:12441007-12441029 AGATCAAAGATGAAGGAGAAAGG + Intronic
1092899799 12:13047687-13047709 TTTTCAAAGAATAAGGGAGAGGG - Intronic
1094361300 12:29634197-29634219 TGTTTAAAAAAAAAGGAGGTTGG - Intronic
1095133388 12:38569048-38569070 TGAACAAAGAGGAAGAAGGAAGG - Intergenic
1095383374 12:41620981-41621003 TGTTCACTGAAGAATGGGGAAGG - Intergenic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095595859 12:43957337-43957359 TATTCAAAGAAAAAGGAGCTAGG + Intronic
1095748315 12:45683917-45683939 TGAACAAAGAAGAAGGAGCAAGG - Intergenic
1096668671 12:53184497-53184519 TGTTGAGGGAGGAAGGAGGAAGG + Intronic
1096957308 12:55539744-55539766 TGTACAGAGACAAAGGAGGAGGG + Intergenic
1097812542 12:64034274-64034296 TGTCCAGAGAAGGAGGAAGAGGG - Intronic
1098362718 12:69670577-69670599 TCCTGAAAGTAGAAGGAGGAGGG + Intronic
1098503728 12:71224946-71224968 AATTCAAAGAATAAAGAGGAAGG - Intronic
1100045025 12:90369207-90369229 TTTTCAAAGAAGATAGAAGAGGG + Intergenic
1100065855 12:90643235-90643257 TATTCAAAGTAAAAGGAGAAAGG + Intergenic
1100394518 12:94173068-94173090 TGTTCCGAAAAGAAGCAGGATGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101148197 12:101861549-101861571 TGTTCAATAAAGAAATAGGAAGG - Intergenic
1101403621 12:104409689-104409711 TGTTAGCAGAAAAAGGAGGAAGG - Intergenic
1101495904 12:105253959-105253981 TGTTACCAGAAGAAGGGGGATGG + Intronic
1101925955 12:108971544-108971566 TTTGCAAACAAGAAGGAAGAGGG - Intronic
1102225624 12:111226247-111226269 TTATCAAAGAGGAGGGAGGATGG - Intronic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1102893913 12:116583057-116583079 GGGTCAAAGAAGGAGGAGGAGGG + Intergenic
1103132279 12:118479658-118479680 TGTTCTTAGGAGAAGAAGGAGGG + Intergenic
1104370239 12:128217907-128217929 TGTTTAAAGAGAAAGGAGAAGGG - Intergenic
1104409523 12:128546685-128546707 TGTTCAAAGAGGAGGGCGGGTGG + Intronic
1104508195 12:129352372-129352394 TCTTGAAAGTAAAAGGAGGAAGG - Intronic
1106277617 13:28228021-28228043 TGACTAAAGAAGAAGGTGGAAGG - Intronic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1107246695 13:38305323-38305345 AGTTTAAAGAAGAAAGAGGCTGG - Intergenic
1108877538 13:55065239-55065261 TATTCAAAGAAATAGTAGGAAGG + Intergenic
1110522696 13:76499298-76499320 TGTCCAAAGGAGAGGGAGGGAGG + Intergenic
1110768380 13:79306296-79306318 TCTGCAAAGAAGAAGTAGAAGGG - Intergenic
1110927167 13:81168320-81168342 TGTTAAAAAAAAAAGAAGGAAGG - Intergenic
1111684921 13:91489952-91489974 TATTAAAAGAAAAAGGCGGAGGG + Intronic
1112207302 13:97337429-97337451 TGGGCAAAGGAGACGGAGGAAGG - Intronic
1112536553 13:100262705-100262727 TGTGAAAAAAAGAAGGAAGAAGG - Intronic
1112672376 13:101654936-101654958 TGTTCAGAGAAGAAGGTGTATGG + Intronic
1113163787 13:107414347-107414369 TGTGCAAAGAGGAGGGAGGGAGG - Intronic
1113570085 13:111347331-111347353 TGATGAAAGCAGAAGCAGGAGGG - Intergenic
1114346708 14:21804090-21804112 TGGTGAAAGAAGAGGAAGGATGG - Intergenic
1114447820 14:22802960-22802982 TGTTGAATGAAGAAGGGGGCAGG - Intronic
1114476855 14:23001758-23001780 TATTTAAAGAAGAAGGAGCTGGG - Intronic
1114537505 14:23432340-23432362 TGGTCAGAGAAGAAGGAGATGGG + Intronic
1115694370 14:35880973-35880995 TGTTGAGAGAACGAGGAGGAAGG + Intronic
1116801626 14:49450182-49450204 TGTTCAGTGGAGAAAGAGGAAGG + Intergenic
1117279221 14:54220848-54220870 TGTTCAATGAACAAGGAGCTAGG + Intergenic
1117321441 14:54627687-54627709 GGTTTAAAGGAGCAGGAGGAGGG - Intronic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119171077 14:72536875-72536897 AGTTCTAAGGAGGAGGAGGAAGG - Intronic
1119203066 14:72772912-72772934 TGTGGGAAGAAGAAGTAGGAAGG + Intronic
1119211759 14:72837194-72837216 AGTGCAAAGAAGAATGAGGGTGG + Intronic
1120230125 14:81832948-81832970 AGTTTCTAGAAGAAGGAGGAAGG - Intergenic
1120242663 14:81967208-81967230 TCTTCAAGGGAGAAGGATGAGGG - Intergenic
1120788998 14:88562461-88562483 TGTTCAGAGAAGCAGGAGGATGG + Intergenic
1120940790 14:89947110-89947132 AGTGCAAAGGAGAAGGAAGATGG + Intronic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121843176 14:97151406-97151428 TCTTTAAAGAATAAGGAGGCTGG - Intergenic
1122020164 14:98831316-98831338 TTTTCAAAGAACAAGAAGAATGG - Intergenic
1123016615 14:105378765-105378787 TGTACGAAGAAAAAGGAGGAAGG - Intronic
1123173355 14:106395429-106395451 GGTTTAAAGAAAAATGAGGAGGG + Intergenic
1123428306 15:20191433-20191455 TTTGCAAAGAAGACAGAGGAAGG - Intergenic
1123796803 15:23780849-23780871 TGTTCAGTGAAGAATGTGGATGG - Intergenic
1124018181 15:25896198-25896220 TTATCAAAGAAAAAGAAGGAGGG - Intergenic
1124049342 15:26180439-26180461 TGATAAAGGAAGAAGGATGAGGG + Intergenic
1124723306 15:32132378-32132400 AGTTCAGAGAAGAAGGCAGAAGG - Intronic
1125281205 15:38044292-38044314 TTTTTAAAGAAAAAGAAGGAAGG + Intergenic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125860587 15:42995814-42995836 TGTTATAAAATGAAGGAGGAGGG + Intronic
1126296993 15:47150804-47150826 TGGTGAAAGCAGAAGCAGGAGGG + Intergenic
1127137639 15:55941249-55941271 TCTTTAAAGAAAAAGAAGGAAGG - Intronic
1127406856 15:58658440-58658462 TTTTCAAAAAAGAACAAGGATGG - Intronic
1127489334 15:59447677-59447699 TGGTAAAAGAAGGAGGAAGAGGG - Intronic
1127975539 15:63994400-63994422 TGTTAAAAGAAAAGGAAGGAAGG + Intronic
1128155465 15:65389047-65389069 TGTTCCATGAAGGAGGAAGAAGG - Intronic
1129227460 15:74178454-74178476 TGTTCCAAGAAGAGGAAGGAAGG - Intergenic
1129640826 15:77376094-77376116 TGTTCAAAAAAGTTGGAGAAAGG - Intronic
1129670098 15:77602926-77602948 TGTTCAATGAATAAGTGGGAAGG + Intergenic
1130369943 15:83276669-83276691 TGTTCCAAGAAAGAGGAAGAGGG - Intronic
1130925736 15:88384321-88384343 TGTGCAAAAAAGTAGAAGGAAGG + Intergenic
1131513589 15:93063288-93063310 CGTTCAAAGGAGGTGGAGGAGGG + Intronic
1134433910 16:14237356-14237378 TGTTTCAAGAAGAAGGGAGAGGG + Intronic
1135716602 16:24775465-24775487 TGTTCAGAGAAGAAAGAAAATGG + Intronic
1136108451 16:28048915-28048937 TTTTTAAAAAAGATGGAGGAGGG + Intronic
1136856012 16:33658318-33658340 TTTGCAAAGAAGACAGAGGAAGG + Intergenic
1137273804 16:46920184-46920206 TGTTCAAACAACAGGAAGGATGG + Intronic
1137715114 16:50593903-50593925 TGTTCCCAGAAGAAGGAGGAAGG + Intronic
1138727196 16:59152707-59152729 TTTACAAAGAAAAAGGAAGATGG + Intergenic
1139019275 16:62726909-62726931 CGTTGAAAAAAGAAGGAGCAAGG - Intergenic
1140255654 16:73334084-73334106 TGCTGAAAGAGGAAGGAGAAAGG + Intergenic
1140433369 16:74923859-74923881 TGTTCCAAAAAGAAGGAGCCCGG - Intronic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141601684 16:85130587-85130609 ACTTCAGAGAAGGAGGAGGAGGG + Intergenic
1142436949 16:90065933-90065955 AGTTCTAAGAAGAATCAGGAAGG + Intronic
1203117598 16_KI270728v1_random:1506797-1506819 TTTGCAAAGAAGACAGAGGAAGG + Intergenic
1142510548 17:389928-389950 GGATCAAAGCAGAAGGATGACGG + Intergenic
1142681782 17:1554111-1554133 TTCTCAGAGAAGAAGGCGGAAGG - Intronic
1142937110 17:3343945-3343967 TCATCAAAGAAGCAGAAGGAGGG + Intergenic
1143015263 17:3888261-3888283 TGTTCAAGGGTAAAGGAGGATGG - Intronic
1143301695 17:5915364-5915386 TGGCCAAAGAAGAAGCAGGCTGG - Intronic
1143487705 17:7263534-7263556 TGACCAAAGATGAAGGAGGAAGG - Intronic
1143989493 17:10944595-10944617 TGTGCACAGAAGAGGGTGGAGGG + Intergenic
1144250692 17:13413803-13413825 TGTACCATGAAGAAGGAGAAAGG + Intergenic
1144294956 17:13865448-13865470 TGTTTATAGCAGAAGCAGGATGG - Intergenic
1144511822 17:15883539-15883561 TATTCAGAGAAGAAGGTGGATGG + Intergenic
1144632037 17:16878820-16878842 TGCTCAAAAAAGAAGGAACAAGG - Intergenic
1144899143 17:18568326-18568348 CGTTCAAAGGAGGTGGAGGAGGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146304798 17:31722712-31722734 TGTTCCAAGAAGAGGGCAGAGGG + Intergenic
1146479251 17:33191515-33191537 TGTTAAAAGAAGAAGAAGAAGGG + Intronic
1146575182 17:33984779-33984801 TGCTGAAAGGAGATGGAGGAAGG + Intronic
1146639671 17:34530774-34530796 TGTTGAAAGAGGAAGGAAGCAGG - Intergenic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146795196 17:35775442-35775464 AGTTCAAAAAGGAAGGGGGAAGG + Intronic
1146801498 17:35827402-35827424 TATTAAAAGAAGAAGGGGCATGG + Intronic
1147303208 17:39546095-39546117 TGTTCCATAAAAAAGGAGGAAGG - Intronic
1148540314 17:48475079-48475101 TTTTTAAAGAAAAAGGTGGAGGG - Intergenic
1148988937 17:51648597-51648619 AGTGCAAAGTTGAAGGAGGAAGG - Intronic
1149299894 17:55295557-55295579 TGTTTAAAGAAGATGTTGGAAGG + Intronic
1150118919 17:62582794-62582816 GGTTCCAAGGACAAGGAGGAGGG - Intronic
1150703714 17:67469298-67469320 TGTGCAGAGAAGGGGGAGGATGG - Intronic
1151042734 17:70882640-70882662 TCTTCCAAGAGGGAGGAGGAGGG + Intergenic
1151092519 17:71459216-71459238 TGTTCAAAGTCTAATGAGGAAGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151272457 17:73007523-73007545 TGGTGAAAGCAAAAGGAGGAAGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151783140 17:76260940-76260962 TGTTGAGAGGAGAAGGAGAATGG - Intergenic
1153021772 18:635731-635753 CGTTCAGAGAAAAGGGAGGATGG + Intronic
1153170541 18:2311250-2311272 TGTACAGAGACAAAGGAGGAGGG - Intergenic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153726505 18:7962203-7962225 TGTTCACAGAAGAACAAGGCAGG - Intronic
1153810951 18:8751003-8751025 TGCTCCAAGGAGGAGGAGGATGG + Intronic
1153912006 18:9712635-9712657 TGTGGCAAGAAGCAGGAGGAAGG + Intronic
1153929129 18:9863258-9863280 TTTTCAAAGAGGAAGGGGAATGG + Intergenic
1154008645 18:10557020-10557042 TGTTCTAGGAAGAGGGAGAAAGG - Intergenic
1154012015 18:10582368-10582390 TGTTCACAGAGGAAGAAGGCAGG + Intergenic
1154442545 18:14404917-14404939 TGTTTGAAAAACAAGGAGGATGG - Intergenic
1155281800 18:24247847-24247869 TGCTCAAAAAAGGAGGAGAAAGG + Intronic
1155631658 18:27901308-27901330 TGTTCACAGAAGAATGCGAATGG - Intergenic
1155925905 18:31654991-31655013 TATTCAAAGAAGGAGGGAGAAGG + Intronic
1156956849 18:42976950-42976972 TGAGAAAACAAGAAGGAGGAAGG + Intronic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157299381 18:46468589-46468611 TGTTGCAAGATGAAAGAGGATGG + Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158524948 18:58204806-58204828 TGTTTAAAAAAGAAGCAAGAAGG + Intronic
1158629478 18:59099809-59099831 TGTTCTTAGAAGAAGGATGGGGG - Intergenic
1158918820 18:62166348-62166370 GGATCAAGGAAGATGGAGGAGGG - Intronic
1159042683 18:63339618-63339640 TGTTCACAGAAGAAAGAGAGAGG - Intronic
1160197508 18:76768383-76768405 TCTCCAAAGAAGACAGAGGATGG - Intergenic
1160448604 18:78946910-78946932 TGGTGAAAGATGAGGGAGGAGGG + Intergenic
1161195438 19:2983752-2983774 AGGACAGAGAAGAAGGAGGAGGG + Intronic
1162280576 19:9693870-9693892 TGTTCACTGGAGAATGAGGAAGG + Intronic
1163062217 19:14768890-14768912 TGTCCAGAAATGAAGGAGGAGGG - Intronic
1163096495 19:15061783-15061805 TGTTCAAAGAAAAAAGGTGAAGG + Intergenic
1163284263 19:16336608-16336630 TGTTTAAAGAAAAAGGAGGGGGG - Intergenic
1163387241 19:17007379-17007401 AGAAGAAAGAAGAAGGAGGAAGG + Intronic
1163481884 19:17561433-17561455 ACTTCCAAGAAGCAGGAGGAAGG + Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1165341180 19:35213324-35213346 ATATCAAAGAAGAAGGAAGAGGG + Intergenic
1166040956 19:40202531-40202553 TGTTCAAAGAAGGAACAGAATGG - Intronic
1166590117 19:43990095-43990117 TGTTCAAAGATTATGGAGGTAGG + Exonic
1166991537 19:46695719-46695741 TGTCAAAAGAGGAAGGAGGGAGG + Intronic
1167072245 19:47227990-47228012 TGTTGCAAGAAGCAGGAAGACGG - Intronic
1167191596 19:47993804-47993826 TGTTCAAACAAGAAGGAAAGAGG - Intergenic
1167396494 19:49232912-49232934 TGTGCAGAGAAGCAGGAGGAAGG - Intergenic
1167857950 19:52257830-52257852 TGCTTAAAGAACATGGAGGATGG - Intergenic
1168596173 19:57679473-57679495 TCTTGAAAGAAGATGGAGGTGGG + Intergenic
925732928 2:6935095-6935117 GGCTCAGAGAAGAAGGAAGAGGG - Intronic
926283235 2:11466884-11466906 TCGTCAAACAGGAAGGAGGAAGG - Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926934447 2:18073063-18073085 TGGTCAAGGAGGCAGGAGGAAGG + Intronic
927091136 2:19713586-19713608 TGTTCCAGGAAGAAAGAGGAGGG + Intergenic
927530587 2:23795079-23795101 TATTCACAGAGGAAGGAGAAAGG - Intronic
928561573 2:32493761-32493783 TGAACAAATAAGCAGGAGGACGG + Intronic
928791220 2:34956480-34956502 TGTGTAAAGAAGAAAGAGGGAGG - Intergenic
929017957 2:37519307-37519329 TGTTAAAAGAAGAACAAGGTTGG - Intergenic
929220372 2:39458150-39458172 TATACAAATAAAAAGGAGGAAGG + Intergenic
930389337 2:50740759-50740781 AGTTAAAAGGACAAGGAGGAAGG + Intronic
930391142 2:50763085-50763107 TGTTCAAAGAAAATGAAGGGAGG - Intronic
932082259 2:68725773-68725795 TGTTCACAGCAAAAGGAGGAAGG - Intronic
932134924 2:69219906-69219928 TGTTCAAAAAAAAATCAGGAAGG - Intronic
932811757 2:74832157-74832179 AGTTCAGAGAAGAGGGTGGAGGG + Intergenic
933072856 2:77883163-77883185 TGGTCAGGAAAGAAGGAGGAAGG - Intergenic
933209416 2:79549849-79549871 TTTTGAAAGAACTAGGAGGAGGG + Intronic
933831492 2:86213655-86213677 TGTTCAGAGAAGAAAAATGATGG + Exonic
934079921 2:88458981-88459003 AGTCTAATGAAGAAGGAGGAGGG - Intergenic
934636588 2:95994771-95994793 TGTTCAAGGAAGACAGAGGGAGG - Intergenic
935085656 2:99842115-99842137 TGTCCTTAGAAGTAGGAGGATGG + Intronic
935448496 2:103182207-103182229 TGTTCAAAAAGAAAGAAGGAAGG + Intergenic
935497875 2:103804058-103804080 TCTTCAAACCAGAAGGTGGATGG - Intergenic
935833723 2:107026933-107026955 TGTTCAAAGAACAAGGTTCATGG + Intergenic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937446420 2:121962564-121962586 TCATCCAGGAAGAAGGAGGAAGG + Intergenic
937484473 2:122300228-122300250 GGATGAAAGAAGAAGGAAGAAGG - Intergenic
937976607 2:127586298-127586320 TGTGCCAAGAAAAACGAGGAAGG + Intronic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938828080 2:135026495-135026517 TTTTGAAAAAAAAAGGAGGAGGG - Intronic
939888724 2:147710060-147710082 TATTCAAAGAAAATGGAAGAAGG - Intergenic
940755964 2:157683821-157683843 TGTTTAAAGAAGAATTTGGATGG + Intergenic
940939208 2:159538455-159538477 TTTGCCAAGAAGCAGGAGGAAGG - Intronic
941481119 2:166014670-166014692 TGTTTGAAGAAAAAGGAGAAAGG + Intronic
941640398 2:167981834-167981856 GGATCAGAGAAGAAGGATGATGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943043681 2:182832690-182832712 TGTTCAAAGAACAAAGAGAAAGG + Intergenic
943166767 2:184338465-184338487 TATATAAAGAAGAAGGAGAAAGG - Intergenic
943336758 2:186624446-186624468 GGTGCAAAGAAGCAGGAGTAAGG + Intronic
943777039 2:191777090-191777112 TGAACACAGAAGATGGAGGATGG + Intergenic
944105231 2:196072483-196072505 TGTAAAAGGAAGAAGAAGGAAGG + Intergenic
944150637 2:196554520-196554542 TAATCAAAGAATGAGGAGGATGG + Intronic
944920815 2:204411318-204411340 TGTACAAAGAAGAAGGAGAGAGG + Intergenic
945692843 2:213063223-213063245 TGAACAGAGAAGAAAGAGGATGG - Intronic
945754797 2:213832556-213832578 TCTTCAAGGAAGAAGGGAGAAGG - Intronic
945805290 2:214482986-214483008 TGGTCAAAGGAGAGGGAGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945939193 2:215931599-215931621 TGTTCACAGGAGAAGGACGCAGG + Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946525750 2:220518153-220518175 TGTTCTAAGGGGAAGGAAGATGG - Intergenic
947428878 2:230008150-230008172 TGTTTAAATAAGCAGGAGGCTGG + Intronic
947931140 2:233966202-233966224 AGTTCAAATGAGATGGAGGAAGG + Intronic
948056527 2:235012813-235012835 TGGTCCAAGGAGCAGGAGGAAGG + Intronic
1168849920 20:969512-969534 TGTTCAAAGAGGAATGGGAAGGG - Intronic
1168929953 20:1613373-1613395 TGTGCTTATAAGAAGGAGGAAGG - Intronic
1169055939 20:2621060-2621082 TGTTCTTATAAGAAGGAGGGAGG + Intronic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1170053604 20:12174501-12174523 AGTTCTAAGAGGAAGCAGGAGGG - Intergenic
1170096567 20:12651820-12651842 TTTTTATAGAAGAAGGAAGAAGG + Intergenic
1170522168 20:17197903-17197925 TGCTCTAAAAAGAAGGAGCAGGG + Intergenic
1171080217 20:22174024-22174046 TGTTCTATGAAGAATGATGATGG + Intergenic
1171568250 20:26216939-26216961 TGTTTAAAGAAGGAGAAGGAAGG + Intergenic
1172105433 20:32514556-32514578 TCTTAAAAAAAGGAGGAGGAGGG - Intronic
1172450715 20:35020727-35020749 AGTTCCAAGACGGAGGAGGAGGG - Intronic
1172941081 20:38655185-38655207 TCTTCTGAGAGGAAGGAGGATGG + Intergenic
1173219901 20:41123879-41123901 TGTTCACAGAAAAAGCATGATGG + Exonic
1173460625 20:43240381-43240403 TGTTTCCAGAAGAAGAAGGAGGG - Intergenic
1174727138 20:52874832-52874854 TGTGCAAAAAAGAAGGTGGTGGG + Intergenic
1175238483 20:57528776-57528798 TGTTCAGAAAAGTAGGAGGTAGG + Intergenic
1175425281 20:58861037-58861059 TCTAAAAAGAAGAAGGAGCATGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1177232674 21:18342697-18342719 GGATCAAAGAAGAAGAAAGAAGG + Intronic
1177390798 21:20468987-20469009 TGCTCAAAAAAGTAGAAGGAAGG + Intergenic
1177657123 21:24032262-24032284 TGTTAAAAGAAGAAGGTTAATGG + Intergenic
1177768400 21:25486078-25486100 TGTTCAAAGGAGAGAGAGTAGGG + Intergenic
1178564289 21:33668860-33668882 TTTTCAAAGAAGCAGGACGGAGG - Intronic
1178626197 21:34220852-34220874 GGTTCTTCGAAGAAGGAGGATGG + Intergenic
1178792960 21:35717134-35717156 TTTGCAAAGGAGAAGGATGATGG - Intronic
1178971114 21:37177676-37177698 TGCCCAAAGGAGAAGCAGGAGGG - Intronic
1179182970 21:39061239-39061261 GGCTCATAGAAGCAGGAGGACGG + Intergenic
1179317555 21:40257897-40257919 TGTGAAAAGAATAAGGAGAAAGG - Intronic
1179327956 21:40368178-40368200 TGTTCAGAAAAGAAAGGGGAAGG - Intronic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181743501 22:24939814-24939836 TGTGCCATGAAGAAGGTGGAGGG - Intronic
1182025509 22:27115060-27115082 TGATGAAAGATGAAGGTGGAAGG + Intergenic
1182440556 22:30361454-30361476 GCTTCAGAGAAGAAGGATGAGGG + Intronic
1184121201 22:42451678-42451700 TGTACCTAGAAGAGGGAGGAGGG - Intergenic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
1185063200 22:48617785-48617807 TGTTCTGAGAAGACGGAGCAGGG + Intronic
949254849 3:2033787-2033809 TGTTAAAAGAAAAAAGAGGTTGG + Intergenic
949313353 3:2724872-2724894 TGTTTAGATGAGAAGGAGGATGG + Intronic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
951050513 3:18088291-18088313 TGTGCACAGAAGGAGGGGGATGG + Intronic
951110730 3:18800927-18800949 TATTCAAGAAAGAAAGAGGAAGG - Intergenic
951287245 3:20828278-20828300 TGTTCAAGGTAACAGGAGGAAGG - Intergenic
951621833 3:24610258-24610280 TGTGTGAAGAAGGAGGAGGATGG + Intergenic
951778728 3:26339730-26339752 TGGCCAGAGAAGAAGGAAGAGGG + Intergenic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952080900 3:29756329-29756351 TCTTCATAGAAGTATGAGGATGG - Intronic
952401576 3:32968316-32968338 TGTCAAAAGAATAAGGAGAATGG + Intergenic
952541557 3:34372863-34372885 TGTGGGAAGAAGAAGGAAGATGG + Intergenic
953502785 3:43454189-43454211 TGTTCAAGGAACACAGAGGAAGG + Intronic
954035770 3:47850250-47850272 TCCCCAAAGAGGAAGGAGGAAGG + Intergenic
954159647 3:48711818-48711840 TACTCAAGGAAGAAAGAGGAGGG - Intronic
954876105 3:53804157-53804179 GGTTCAGAGAAGAGGGTGGAGGG - Intronic
955834824 3:63043407-63043429 TTTTCAGAGAAGAAGGATAATGG - Intergenic
956482159 3:69684052-69684074 TGTTTAAAGAAGAAAGGAGAAGG + Intergenic
956567281 3:70652959-70652981 TTTTCAAAGTAGAAGCTGGAAGG - Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957110603 3:75951399-75951421 TGTTTAAAGAAGGAGAAGGAAGG - Intronic
957219496 3:77363745-77363767 TCTTCAAGGAAGAAGGGAGAAGG + Intronic
957287076 3:78230761-78230783 GCTTCAGAGGAGAAGGAGGATGG + Intergenic
957597491 3:82287143-82287165 TGTTGAAAAAAGTAAGAGGAGGG + Intergenic
958159823 3:89804354-89804376 TGCTCTAACAAGAAGGAGGTAGG - Intergenic
959172306 3:102858162-102858184 TGTCAGAAGAAGAAGGAAGAAGG - Intergenic
960245109 3:115391715-115391737 TGTTAAAGGAAGAAGAAGGAAGG - Intergenic
960753833 3:120986126-120986148 TGATCAAAGAAGAAATATGAAGG - Intronic
961922089 3:130437778-130437800 AATTCAAAGAAGAGGGAAGATGG - Intronic
961942565 3:130653508-130653530 TGTTTAGAGAAGAAAGAGTAAGG + Intronic
962107944 3:132413046-132413068 TTTTCAAAGATGGATGAGGAGGG - Intergenic
962269496 3:133967730-133967752 TGTGCAAGGAAGGAGGAGAAAGG - Intronic
962629902 3:137265178-137265200 TCTTCAAATAAGAAAGAGGGGGG + Intergenic
962797343 3:138860894-138860916 TCTTCAAAGAACAAAGAGGAAGG + Intergenic
963323499 3:143835696-143835718 TGTTCACAGAAGAAGGAAAGAGG + Intronic
963988160 3:151621368-151621390 GTTTCAAAGAATAAGGAGAAAGG + Intergenic
964704779 3:159606593-159606615 AGTTCAAGGAATAAGAAGGATGG + Intronic
964762781 3:160150344-160150366 TGATCAAAAAAGAAAGAGCAAGG + Intergenic
965565452 3:170111708-170111730 TGTTCAAATAAGAAGTAAAACGG + Intronic
967145957 3:186606250-186606272 TCTTCAGACAAGAAGGAAGATGG - Intergenic
967295136 3:187957079-187957101 TTATCATAGAAGGAGGAGGAAGG + Intergenic
967516338 3:190373157-190373179 TTTTCAAAGTATAAGGAGAAAGG - Intronic
967734103 3:192934003-192934025 TGGTTAAAGAAGGTGGAGGAAGG - Intergenic
967877472 3:194277012-194277034 TGTTAAAAGATGAAGGAAGCTGG - Intergenic
970209702 4:13696598-13696620 TTTTGAAGGAAGGAGGAGGATGG + Intergenic
970229704 4:13897186-13897208 TGATCAAGGAAGAGAGAGGAGGG - Intergenic
970484668 4:16513032-16513054 TTTTCACAGAAGAAGGTGCATGG - Intronic
972158576 4:36196287-36196309 TGTCCACAGAAAAAGGAGGAGGG + Intronic
972169213 4:36324277-36324299 AGTTGAAGGAGGAAGGAGGAGGG - Intronic
972285901 4:37648043-37648065 TGTTTCAATAAGAACGAGGAAGG + Intronic
972742138 4:41897372-41897394 TATGCAAAGTAGATGGAGGATGG - Intergenic
973155335 4:46944608-46944630 TGTGCAAAGAACCAGAAGGAAGG - Intronic
973863896 4:55092716-55092738 TGTCCAAAGAGGCAGGAGGATGG + Intronic
973895177 4:55405059-55405081 TATTCAAAGAAGGTGGAGGGAGG - Intronic
974093502 4:57336829-57336851 TTTTCAGAGCAGCAGGAGGATGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974229977 4:59099327-59099349 TACTCAGAGAAGAAGAAGGAAGG + Intergenic
974421931 4:61687424-61687446 TATACATAGAAGATGGAGGAAGG + Intronic
974476310 4:62386731-62386753 TTTTCAAATAAGCAGAAGGATGG - Intergenic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
975157085 4:71084047-71084069 TGTTCAAAAAGGGATGAGGAGGG + Intergenic
975436411 4:74357601-74357623 TTCTCAAAGGAGAAGGAGGTGGG - Intergenic
975956990 4:79852916-79852938 TGATGATAGAACAAGGAGGAAGG - Intergenic
976209740 4:82655654-82655676 TGATCAAAGAGGAAGGAACAGGG + Intronic
977249708 4:94676224-94676246 TGTACAAATAAAAAGGAGGCCGG - Intergenic
977399968 4:96520506-96520528 TGTCCAAGGAAGGAGGAGGCAGG + Intergenic
977466376 4:97387043-97387065 TGATGAATGATGAAGGAGGAAGG + Intronic
977938001 4:102827708-102827730 TGTTCCGAGAAGAAGGAAAAGGG - Intronic
978835840 4:113148834-113148856 TGATCAAAGAAGAGGACGGATGG + Intronic
979452067 4:120884720-120884742 TGTTCTTTGAAGGAGGAGGATGG - Intronic
979604430 4:122622837-122622859 TGATCAGAGAAGGAGGAGAATGG + Intergenic
979981331 4:127258885-127258907 AGTTCAAAGAGGAAGCAGGAGGG - Intergenic
980218956 4:129889994-129890016 TTTTTAAAAAAGAAGGAAGAGGG - Intergenic
981864559 4:149400248-149400270 TGTTCTAAGCAGAAGGATGTAGG - Intergenic
984420343 4:179513338-179513360 TCTTCAAAGAGGAAAGAGGCAGG + Intergenic
984479072 4:180275715-180275737 GGGACAGAGAAGAAGGAGGAAGG + Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985230096 4:187806350-187806372 TGTCCAAAGAAGAAGTTAGAAGG + Intergenic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
987382677 5:17300384-17300406 TGATCAAAGGAAGAGGAGGAAGG - Intergenic
989108086 5:37882043-37882065 TGCTCCAAGAGGAAGAAGGAAGG - Intergenic
989126068 5:38053412-38053434 TGTTCAAGGAAGAAGGATCAAGG + Intergenic
989404626 5:41046404-41046426 TGTTCAAAGAAGAAGGACATGGG - Intronic
989751346 5:44897583-44897605 TGTTGAAAGAAAAGAGAGGAAGG - Intergenic
989973344 5:50551799-50551821 TGTTCAAAGACAGAGGAGGAAGG + Intergenic
990555190 5:56926707-56926729 TGTCCAAATACGAAGGAGTAAGG - Intronic
990855896 5:60266015-60266037 TGTCCACAGTAGAAGGAAGAAGG + Intronic
991043479 5:62198509-62198531 AGTTTAAAGAAGCAGTAGGAGGG + Intergenic
991045833 5:62221766-62221788 TTTGCAAAGAAGACAGAGGAAGG - Intergenic
991071720 5:62490425-62490447 TATGCAAAGATGAGGGAGGATGG + Intronic
991149989 5:63356494-63356516 TCTTCAAAAATGAAGGAGGCTGG - Intergenic
991254138 5:64596243-64596265 TGGTCAAAGGAGATGGAGGTGGG + Intronic
991503308 5:67299069-67299091 TGTTCTAGAAACAAGGAGGAAGG - Intergenic
991603828 5:68380375-68380397 TATTGAAAGAAGAATTAGGAAGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992325934 5:75659812-75659834 TGTCTAAAAAGGAAGGAGGAAGG - Intronic
993064037 5:83076835-83076857 AGTTAAGAGAAGAAGGTGGAAGG + Intronic
993728877 5:91398982-91399004 CGTTTACAGAAGAAGGAGAATGG + Intergenic
993772905 5:91953243-91953265 TTTGCAAAGAAAAAGGAAGAAGG + Intergenic
994803998 5:104419704-104419726 TGGTCAAAGATGTAGGTGGAGGG + Intergenic
995234080 5:109806127-109806149 TGTTCAGAGAGGCAGGGGGAGGG + Intronic
995327775 5:110911083-110911105 TGAGGAAAGAAGAAAGAGGAGGG + Intergenic
995739090 5:115335652-115335674 TGTTCAAAGAAGTCTGAGGGTGG + Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997203653 5:132027884-132027906 ACTTGAAAGAAGAAGAAGGAGGG - Intergenic
997412734 5:133702563-133702585 TGTTGAAGGATGATGGAGGATGG - Intergenic
997743198 5:136275884-136275906 TGTTGAAAGCAGAAAGAGAATGG + Intronic
997976775 5:138445659-138445681 TGTGGAAAGAAGGAGGAAGATGG - Intronic
998451149 5:142235597-142235619 TGGGCAAAGGAGCAGGAGGAGGG - Intergenic
998474399 5:142408357-142408379 TGTCCAAAGAGGAAGGAGCATGG + Intergenic
998514470 5:142740128-142740150 AGATAAAAGAAGAAAGAGGAAGG - Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000719784 5:164692540-164692562 TGTTCTTTGAAGATGGAGGAGGG + Intergenic
1000787052 5:165558359-165558381 TGTTCAAAGAAGCAACAGTAAGG - Intergenic
1001034085 5:168284547-168284569 AGTGCAAAGAAGAAGGCAGATGG + Intergenic
1001426537 5:171626162-171626184 TTTTCTAAGAAGAAGAAGAAAGG - Intergenic
1001663846 5:173416301-173416323 TGTACACAGAAGAATAAGGAAGG + Intergenic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002080942 5:176737102-176737124 TGCTCAAAGCAGACCGAGGAAGG + Intergenic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1003150558 6:3545198-3545220 TGATCAAAGAAGGAAGAGGCAGG - Intergenic
1004702085 6:18088766-18088788 TGCTGACAGAAGCAGGAGGAGGG - Intergenic
1004784744 6:18955127-18955149 AGTACAATGAAGAAGGAGAAGGG - Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005078715 6:21934996-21935018 TGTTTAAAGAAGTAAGAGGCCGG - Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1005530937 6:26705214-26705236 TCTGCAAAGAAGGAGGAGAAAGG - Intergenic
1005539859 6:26796422-26796444 TCTGCAAAGAAGGAGGAGAAAGG + Intergenic
1006019801 6:31111431-31111453 TGTTCCAAGAAGAGCCAGGAGGG + Exonic
1006068078 6:31476878-31476900 AGTTGAAAGAACAAGGAAGAGGG - Intergenic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007520231 6:42446308-42446330 TGGTCAAGGATGAAGGAGGGAGG - Intronic
1007636701 6:43304014-43304036 TGTTCAGAGAAAGAGGATGAGGG - Intronic
1007724739 6:43908527-43908549 TTTTCAAAGAAGATGGACTAGGG - Intergenic
1007806658 6:44455378-44455400 TGGTGGAAGAAAAAGGAGGATGG + Intergenic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1008482589 6:52001725-52001747 TTTTTAAAAAAGAAGGAGGCTGG - Intronic
1008558805 6:52703051-52703073 GATTCAAAGATGAAGGAGCAGGG - Intergenic
1009010676 6:57838563-57838585 TCTGCAAAGAAGGAGGAGAAAGG + Intergenic
1009705738 6:67248965-67248987 TGTTCCAAAAAGCAGGAAGAGGG + Intergenic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010830540 6:80523275-80523297 TTTTCAAAGAAAAAGGAAGGAGG - Intergenic
1011052073 6:83163136-83163158 TTTTTAAAGAAGAAAAAGGAAGG + Intronic
1011984090 6:93419816-93419838 TGTTCAGAGGAGAACGAGGATGG + Intergenic
1013458517 6:110354707-110354729 TGTTCCCAGAAGTGGGAGGATGG + Intronic
1013769718 6:113614173-113614195 TGTTCAAGGAGGAAGCAGGGAGG - Intergenic
1013852121 6:114528597-114528619 TGTTCTAAGCAGAGGGACGAAGG - Intergenic
1014005415 6:116412354-116412376 TGTTCAAAGTAGAGGGCAGATGG - Intronic
1014206395 6:118660496-118660518 TGTTCAAGTAAGTAGGAGTATGG - Intronic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1015059874 6:128950295-128950317 TGTTCAAAGCAGAAGGGTAAAGG + Intronic
1015648664 6:135427502-135427524 GGTAGAAAGTAGAAGGAGGAGGG - Intronic
1015944476 6:138486096-138486118 TGTTCTCTGAAGAAGCAGGAAGG - Intronic
1017122378 6:151036803-151036825 TGTTCACTGAAGAAGCAAGAAGG - Intronic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1018730835 6:166649247-166649269 TGATCTAAGAAGAAGGAAGAGGG - Intronic
1019642469 7:2111465-2111487 AGATCAATGAAAAAGGAGGAAGG + Intronic
1021243475 7:18233701-18233723 GGGTCAAGAAAGAAGGAGGAAGG - Intronic
1021668874 7:23014726-23014748 TGTTCAGAGAAAAAGTAGGGAGG - Intergenic
1022051712 7:26680849-26680871 TGTTAAAAAGGGAAGGAGGAAGG + Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023601435 7:41885340-41885362 TAGTCAAATAAGAAAGAGGAAGG + Intergenic
1023732047 7:43201410-43201432 TGTTAACACAAAAAGGAGGAAGG + Intronic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1027955516 7:84874523-84874545 AGCCCAAAGAAGAAGGAAGATGG - Intergenic
1028287402 7:89020114-89020136 TGTACAAAAAAGAAAGAGAAAGG - Intronic
1028425048 7:90676857-90676879 TCTTCAGAGAAGAAAGAGCAGGG + Intronic
1028896235 7:96045163-96045185 AGATCAAAGAACAAGGATGAAGG + Intronic
1029236860 7:99127316-99127338 TGTTAAAAGAAAAAGAGGGAGGG + Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1030665306 7:112271336-112271358 ACTTCAAAGAGGAAGGATGAGGG - Intronic
1031364228 7:120884904-120884926 TGTGCACAGAAGGAGGAGGTAGG - Intergenic
1031403708 7:121357052-121357074 TGGTCAAAGAAGTTTGAGGATGG - Intronic
1031458143 7:122010325-122010347 TTTTCAAAGGAGGAGGAAGAGGG + Exonic
1032750629 7:134836859-134836881 TGTTAATAGAAGAATGAGGGTGG - Intronic
1032962037 7:137046853-137046875 TAAACACAGAAGAAGGAGGAGGG + Intergenic
1033504885 7:141989965-141989987 TGTTCCATGTAGGAGGAGGAAGG + Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033646756 7:143310851-143310873 TGCTTAAAGAATAAGGAGGCTGG + Intergenic
1033672027 7:143502436-143502458 TGTTTAAAGAAGAAGAAGTGTGG + Intergenic
1035140302 7:156752938-156752960 TGTGCAAGGAAGTAGGGGGATGG + Intronic
1036108979 8:5876846-5876868 TGCTCAAAAAAGGAGGAGTATGG - Intergenic
1037023062 8:13998033-13998055 TATTCACAGAAGAAGGAGAGTGG - Intergenic
1037307390 8:17519887-17519909 GGTTCACAGAAGAAGAAGCAGGG - Intronic
1037851518 8:22333906-22333928 TTTCCAGAGAATAAGGAGGAAGG + Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038076082 8:24076644-24076666 AGAAGAAAGAAGAAGGAGGAAGG - Intergenic
1038783167 8:30586132-30586154 TGTTAAAGGAAAAGGGAGGAAGG - Intronic
1039591886 8:38756866-38756888 TGTTCAGAGAAGCAGCAGGAGGG - Intronic
1040533367 8:48283716-48283738 TGCTGGAAGAAGAAGCAGGAGGG + Intergenic
1040839249 8:51767280-51767302 TTTTCACAGAGAAAGGAGGAGGG - Intronic
1041107251 8:54455190-54455212 TGTTATAAGAAGTAGGGGGAGGG + Intergenic
1042818770 8:72907468-72907490 TATGCAAAGAAGAAGATGGATGG + Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043934750 8:86130628-86130650 AGTTCCAGGAAGGAGGAGGAAGG + Intronic
1044256988 8:90075401-90075423 TGTTCAAAGGGAAAGGAAGATGG - Intronic
1044539887 8:93396678-93396700 TGTTCAAAGAAGTAAGAGTTTGG - Intergenic
1044894268 8:96873027-96873049 AGTGCAAGGAAGAAGGAAGATGG - Intronic
1045108580 8:98918126-98918148 TCTTCACAGAAAAAGGGGGAGGG - Intronic
1045733374 8:105267220-105267242 TGTGGAAAGAAGAGGGAAGAGGG - Intronic
1047011790 8:120680572-120680594 TGTCAAAAGAAGAAAGAGCAGGG + Intronic
1047298742 8:123594424-123594446 TCTACCAAGAAGAAGCAGGATGG - Intergenic
1047455935 8:125011604-125011626 TCTTCACTGATGAAGGAGGAAGG - Exonic
1047790882 8:128202466-128202488 TGTTAACACAAGAAGGAGGAAGG + Intergenic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1050475915 9:6040960-6040982 AGAAGAAAGAAGAAGGAGGAAGG - Intergenic
1050485607 9:6131528-6131550 TCTTCAAATAAGAATGAGGTTGG - Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050760958 9:9070388-9070410 TGCTCAAAGAAAAATGAGAATGG - Intronic
1052968141 9:34357875-34357897 TGAAGAAGGAAGAAGGAGGAAGG - Intergenic
1053046559 9:34924913-34924935 TATACAAAGAAGAAAGAGAAAGG - Intergenic
1053107787 9:35427137-35427159 TGAAGAAAGAAGAAGGAGAAAGG - Intergenic
1053683768 9:40502969-40502991 TGTTCACTGAAGAAGCAAGAAGG - Intergenic
1053933743 9:43131255-43131277 TGTTCACTGAAGAAGCAAGAAGG - Intergenic
1054279951 9:63121983-63122005 TGTTCACTGAAGAAGCAAGAAGG + Intergenic
1054296865 9:63338435-63338457 TGTTCACTGAAGAAGCAAGAAGG - Intergenic
1054394883 9:64642941-64642963 TGTTCACTGAAGAAGCAAGAAGG - Intergenic
1054429530 9:65148141-65148163 TGTTCACTGAAGAAGCAAGAAGG - Intergenic
1054500851 9:65873390-65873412 TGTTCACTGAAGAAGCAAGAAGG + Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1055275653 9:74612479-74612501 TGTTCAGGAAAGAAGGAGGATGG - Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056341238 9:85634418-85634440 TGTTCAAAGAACAGCAAGGATGG + Intronic
1056443166 9:86640322-86640344 TGGGCAAACAAGAAGGAGGGAGG + Intergenic
1057107687 9:92435571-92435593 GGTTTAAAGATGAAGGGGGAAGG - Intronic
1057205447 9:93169329-93169351 TGATCCCAGAAGAAGGGGGAAGG - Intergenic
1058154064 9:101492497-101492519 TGTGCAAAGAAAAAGAAGCATGG - Intronic
1059398302 9:114052709-114052731 TGCTCCAAGTAGAGGGAGGATGG - Exonic
1059431824 9:114255034-114255056 TGTCCAAAGAATCATGAGGATGG - Intronic
1059876946 9:118645443-118645465 TGTTGAAGAAAGAAGAAGGAAGG - Intergenic
1060161190 9:121366698-121366720 TGTTCAAAGAAAAAGGAAGCAGG - Intronic
1060527866 9:124330657-124330679 TGCTCAAGGAAGAAGAAGGAAGG - Intronic
1060698372 9:125729554-125729576 TTTTCAAAGAAGGAAGAGAAAGG - Intergenic
1060845760 9:126836489-126836511 TGTTCAGAGAGGCAGGAGAAGGG + Exonic
1061074652 9:128333721-128333743 TGTTCAAAGAAGAGGAACAAAGG - Exonic
1061617378 9:131789231-131789253 TGTCAAAAAAAGAAGAAGGAAGG - Intergenic
1062638348 9:137503377-137503399 TTTCCAAAAAAGAAGAAGGAAGG + Intronic
1186107524 X:6223550-6223572 TGCTCCAAGAAAAATGAGGAAGG + Intronic
1186442532 X:9598593-9598615 TGGTCAGTGAAGAAAGAGGAAGG + Intronic
1186641855 X:11463944-11463966 TGTGCTAGGAAGATGGAGGAGGG + Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188542308 X:31264607-31264629 TGTAGAAAGAAGAAGGAGAGGGG - Intronic
1188864538 X:35299389-35299411 TGTTGCCAGAAGATGGAGGAGGG - Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190006909 X:46749052-46749074 TGTTTAAGGAAGGAGGATGAAGG - Intronic
1190759198 X:53425689-53425711 TTTTGAAAGAAGAAGGAGTGAGG + Intronic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1192276307 X:69634613-69634635 GGTTCAAAAAATAAGGAGGCCGG - Intronic
1195401785 X:104468585-104468607 TGTGCAAAGAGGGAGGAGGATGG + Intergenic
1196173533 X:112616128-112616150 TCTTCATAGAAGCATGAGGATGG + Intergenic
1196342339 X:114609901-114609923 ACTACAAAGAAGCAGGAGGATGG + Intronic
1196744256 X:119055413-119055435 TGTTCATGGAAGAAGGAGCATGG + Intergenic
1197250273 X:124208903-124208925 TGTGGAAAGAGGAAGGAAGAGGG + Intronic
1197423960 X:126272710-126272732 AGTTCCCAGAGGAAGGAGGAGGG - Intergenic
1197433302 X:126393522-126393544 GGTCCACAGAAGAAGGAGGAAGG + Intergenic
1197976643 X:132172604-132172626 TGCTAAAACAACAAGGAGGAGGG - Intergenic
1199049868 X:143224474-143224496 ATTTCAAAGAGAAAGGAGGAGGG + Intergenic
1199779306 X:151043839-151043861 TGTTGTCAGAAGAAGGAGGAAGG + Intergenic
1202275538 Y:23115562-23115584 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202290490 Y:23305129-23305151 TGTTAAAATTAAAAGGAGGAAGG - Intergenic
1202428530 Y:24749281-24749303 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202442261 Y:24920808-24920830 TGTTAAAATTAAAAGGAGGAAGG - Intergenic