ID: 915553488

View in Genome Browser
Species Human (GRCh38)
Location 1:156648205-156648227
Sequence CTGAGTTTAAGGGGGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915553474_915553488 20 Left 915553474 1:156648162-156648184 CCATAGGTCCTCCCGGGGCCTCT 0: 1
1: 0
2: 0
3: 15
4: 178
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553468_915553488 30 Left 915553468 1:156648152-156648174 CCCATGCTGCCCATAGGTCCTCC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553479_915553488 2 Left 915553479 1:156648180-156648202 CCTCTGCAGGACCTTACTATCCC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553476_915553488 12 Left 915553476 1:156648170-156648192 CCTCCCGGGGCCTCTGCAGGACC 0: 1
1: 0
2: 10
3: 39
4: 315
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553473_915553488 21 Left 915553473 1:156648161-156648183 CCCATAGGTCCTCCCGGGGCCTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553477_915553488 9 Left 915553477 1:156648173-156648195 CCCGGGGCCTCTGCAGGACCTTA 0: 1
1: 0
2: 0
3: 30
4: 268
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553480_915553488 -9 Left 915553480 1:156648191-156648213 CCTTACTATCCCTCCTGAGTTTA 0: 1
1: 0
2: 0
3: 8
4: 129
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553478_915553488 8 Left 915553478 1:156648174-156648196 CCGGGGCCTCTGCAGGACCTTAC 0: 1
1: 0
2: 2
3: 21
4: 206
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
915553469_915553488 29 Left 915553469 1:156648153-156648175 CCATGCTGCCCATAGGTCCTCCC 0: 1
1: 0
2: 0
3: 20
4: 200
Right 915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915553488 Original CRISPR CTGAGTTTAAGGGGGCAAGC AGG Intronic
904606238 1:31699406-31699428 CTGAGGTTGAAGAGGCAAGCAGG + Intronic
904693185 1:32310278-32310300 GTGAGTGTAAGGGGGTGAGCAGG + Intronic
904882746 1:33713136-33713158 CTGAGGTTAAGGGGGTTTGCTGG + Intronic
906519800 1:46460278-46460300 CTGAGTCTGAGGGTGCAGGCTGG + Intergenic
907799571 1:57751350-57751372 CTGAGTTCAAGGGAGCAAGCAGG + Intronic
908364039 1:63399227-63399249 CTGACTTTAAAGAAGCAAGCTGG - Intronic
911744002 1:101419194-101419216 CTCAGTTTAAGAGGGCAGGGTGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG + Intronic
915994626 1:160550363-160550385 CAGACTTTAAGGAGGCAGGCTGG + Intronic
917678644 1:177343920-177343942 AGGAGGTTAAGGGGGCAAGGAGG - Intergenic
923759432 1:236827234-236827256 CTGAGTTGAAGGCGTCAGGCAGG - Intronic
924029912 1:239875917-239875939 CTACCTTTAAGGGGGGAAGCTGG - Intronic
924145767 1:241073051-241073073 CTGAGTTCCATGGGGCAAACTGG + Intronic
924337472 1:242998329-242998351 CTGTGTTTAGGTGGGCATGCTGG + Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1065306976 10:24378426-24378448 CTGAGTTTAAAGGGGCATCAGGG - Intronic
1065880745 10:30035819-30035841 ATGAGTTCAATGGGACAAGCAGG + Intronic
1067308862 10:45093368-45093390 CTGAGTTACAGGGTCCAAGCTGG - Intergenic
1069207471 10:65709697-65709719 CTGACTTTAAGTGGGCATGAGGG + Intergenic
1070035778 10:72722371-72722393 CTGAGGTTAAGGGGAAAAGGTGG - Intronic
1070318519 10:75336851-75336873 CTGAGATTAAGGGGGCCACATGG - Intergenic
1070975788 10:80604516-80604538 CTGAGGTTAAAGGAGCAGGCAGG - Intronic
1073307764 10:102516531-102516553 TTGAGTTTAACTGGGCCAGCTGG - Intronic
1073610096 10:104934691-104934713 CTGAGCATAAGGAGGCAGGCTGG - Intronic
1073940364 10:108691138-108691160 GGGAGTTTGAGGGGGCTAGCTGG + Intergenic
1074099796 10:110345785-110345807 GTGAGTTACAGGAGGCAAGCTGG + Intergenic
1074234622 10:111572939-111572961 CTGGGTTTAAGGGGGGAAAAAGG + Intergenic
1076118417 10:127917219-127917241 CTGAGTTTGAGGGTGCCAGAGGG + Intronic
1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG + Intronic
1079274824 11:19025498-19025520 CTTAATTTAAAGAGGCAAGCTGG - Intergenic
1081283000 11:41233881-41233903 CTTAGATTAAGGGGGCAGGAGGG + Intronic
1081503188 11:43687517-43687539 TTGAGTGTAAGTGAGCAAGCTGG + Intronic
1088227791 11:107640726-107640748 CTGATTTTAATGGGGCACTCAGG - Intronic
1094275030 12:28664728-28664750 CAGAGTTTAAGGAGGACAGCAGG + Intergenic
1096837070 12:54357788-54357810 CTGAGCTTAAGGGGACAGGGGGG + Intergenic
1098899655 12:76099812-76099834 CTTTGTTTAAAGGGGGAAGCTGG + Intergenic
1102579078 12:113874599-113874621 CTGAGTTCAAGGGCTGAAGCTGG - Intronic
1104340767 12:127946469-127946491 CAGCGTGTAAGGGGGAAAGCAGG + Intergenic
1105759076 13:23496648-23496670 CAGAGTTTAAGCGAACAAGCTGG - Intergenic
1109004920 13:56861035-56861057 CTGCTTTGAAGGGGCCAAGCTGG + Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1112322045 13:98416732-98416754 CTGAGTGCAAGGTGGCCAGCTGG + Intronic
1112641755 13:101283230-101283252 CTGATATTTAGGGGGCAAGGAGG + Intronic
1114335582 14:21686047-21686069 GAGAGTTTAAGGGAGCAACCAGG - Intergenic
1116681294 14:47973422-47973444 CTGATCTTAGGGGAGCAAGCTGG - Intergenic
1119934562 14:78579557-78579579 CAAAGTGTAAGGAGGCAAGCTGG + Intronic
1124696214 15:31866839-31866861 CTGATTTCAAGGGGGCAAATGGG - Intronic
1125980330 15:43995428-43995450 CTGAGTTTGTGGGGGCAGGCTGG + Intronic
1127109242 15:55650053-55650075 CTAAATTTAAGGGAGAAAGCTGG + Intronic
1128973216 15:72127502-72127524 CTGGGTCTTAGTGGGCAAGCAGG + Intronic
1130436091 15:83901357-83901379 AGGAGTTTAAGGAGGCAAGGAGG + Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1137968968 16:52964783-52964805 CACAGTTTAAGAGGGAAAGCTGG - Intergenic
1138160063 16:54745110-54745132 CTGAGGTTGAGGGAGCATGCTGG + Intergenic
1138444594 16:57055405-57055427 CGGAGGTAAAGGGGACAAGCAGG - Intronic
1139997539 16:70995098-70995120 CTGTGGCTCAGGGGGCAAGCAGG - Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1142601432 17:1054784-1054806 CTGAGTTCCTGGGGGCAAACTGG - Intronic
1144057990 17:11558695-11558717 CTGGGTTTGAAGGGGCCAGCGGG + Exonic
1146659058 17:34652543-34652565 CTGAGAACAAGAGGGCAAGCAGG - Intergenic
1146797686 17:35794681-35794703 CTGAACTTAAGGGGGCAGGAAGG - Intronic
1147006193 17:37406405-37406427 CTGATTTTAAGGGGTGAAGAGGG - Intronic
1150043130 17:61884713-61884735 TTGCGTTTTAGGGGGCAGGCTGG + Intronic
1150244594 17:63664904-63664926 CTCAATTTAAGGGGGCAAAAGGG - Intronic
1150494234 17:65594848-65594870 CTGAGTTTAAGGGAGGCAGCCGG + Intronic
1152337187 17:79705646-79705668 CTGAGTGTAAGGAGGAAATCAGG + Intergenic
1157385616 18:47257669-47257691 CTGAGTTAAAGTGTGCAGGCAGG - Intergenic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
1167747812 19:51363123-51363145 GTGATTTTAAGGAGGCAAGCAGG + Intronic
936550303 2:113432505-113432527 CTGAGTTTAAAAGAGCAAGGAGG + Intergenic
938923874 2:136021048-136021070 CTGAGGTTAAGAGTGCAATCTGG - Intergenic
941925492 2:170890106-170890128 CTGTGTTTCAAGGGACAAGCTGG - Intergenic
942661118 2:178266176-178266198 CTGAGATTCACGGGGCATGCTGG + Intronic
943740277 2:191399882-191399904 CTGATTTTATGGGGGCCAGGAGG - Intronic
946661858 2:222009334-222009356 CTGACTTTACAGGAGCAAGCTGG + Intergenic
1169130237 20:3163065-3163087 CTGAGTTTTGGGGGGCAAGGTGG - Exonic
1170071979 20:12379135-12379157 ATAATTTTAAGGGGGAAAGCTGG + Intergenic
1170914106 20:20605957-20605979 CAGAGTGTAAGGGGGCAACAGGG - Intronic
1172327686 20:34049436-34049458 GTCAGTTTAATGAGGCAAGCAGG + Intronic
1174626432 20:51918510-51918532 CTAAGTTTCAGAGGGCAATCAGG - Intergenic
1174855268 20:54038657-54038679 TTCAGTTTAAAGGGGAAAGCAGG + Intronic
1175277133 20:57779828-57779850 CTGAGGTTATGGGGGCAAAGGGG + Intergenic
1177400029 21:20592185-20592207 CCTAGTTTATGGAGGCAAGCAGG - Intergenic
1179392326 21:41005003-41005025 CTCAGTTGAGGGGGGCAAGATGG + Intergenic
1179675330 21:42977276-42977298 CTTAGTTTCAAAGGGCAAGCTGG - Intronic
1181944185 22:26503018-26503040 TTGAATTTATGGGGGAAAGCAGG - Intronic
1182459697 22:30475073-30475095 CTGGGGTTTAGGGGGCAGGCTGG - Intergenic
1185106178 22:48871249-48871271 CTTAGTGTGAGGGGGCGAGCTGG + Intergenic
950099259 3:10347083-10347105 CTGAGACCAAGGGGGGAAGCAGG - Intronic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
953226209 3:41024042-41024064 TGGAGTTTAAGGGGCCAAGTGGG - Intergenic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
963918755 3:150885806-150885828 CTCAGTTTAACGGGGCAATGAGG - Intronic
964754166 3:160079289-160079311 CTGAGTTTAAGTGGGTAAAGAGG - Intergenic
966441642 3:179951525-179951547 CTGAGTTCGAGGCAGCAAGCAGG - Intronic
967293805 3:187946705-187946727 GTGAGTTTAGGGAGGCAGGCAGG + Intergenic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
987051845 5:14153671-14153693 CAGAGTCAAATGGGGCAAGCAGG - Intronic
988676511 5:33438926-33438948 CTGATTACAAGGGGACAAGCGGG - Intergenic
988888771 5:35590435-35590457 CTGACTTTTAGGGTGCAATCTGG - Intergenic
988909130 5:35822118-35822140 CTGAGCTACAGGGGGCCAGCTGG - Intergenic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
997978447 5:138454088-138454110 CTGTGTTGCACGGGGCAAGCGGG - Intergenic
998045687 5:138984824-138984846 CTGAGTCTAAGCTGGAAAGCAGG + Intronic
1002004902 5:176224282-176224304 CTGAATTTCAGGGAGCAAGTGGG + Intergenic
1002221470 5:177686343-177686365 CTGAATTTCAGGGAGCAAGTGGG - Intergenic
1003169563 6:3710446-3710468 CTGAGTTAAAGGCAGCAAGGAGG + Intergenic
1006876684 6:37303676-37303698 TTGAGTTTAAGGGGCGAAGCAGG - Intronic
1008327575 6:50202791-50202813 ATGAGTTTTAGGGGGCAAGTAGG - Intergenic
1014003335 6:116389323-116389345 CAGTGTTTGAGGGTGCAAGCTGG - Intronic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1018380916 6:163257281-163257303 CTGTGTTAAAGGGGGCATTCTGG + Intronic
1025145020 7:56494750-56494772 GTCAGTTTAAGGTGGCAATCTGG + Intergenic
1026888632 7:73969350-73969372 CTGATTTCAAGGGGGCACACAGG + Intergenic
1027883107 7:83868186-83868208 CTCAGTTGATGGGAGCAAGCTGG - Intergenic
1032967169 7:137111751-137111773 ATGAGCTTAAGGGAGCAAGAAGG - Intergenic
1034436314 7:151064362-151064384 TTGAGTGTGAGGGGGCAGGCAGG + Exonic
1038634574 8:29275288-29275310 CTGAGCTTAAGGGAGCATGTAGG - Intergenic
1042221527 8:66479085-66479107 CTGAGTATCTGGGGGCATGCAGG - Intronic
1042361785 8:67891971-67891993 CTGAGTTCCATGGGACAAGCTGG - Intergenic
1045366568 8:101481795-101481817 CTGTGTTTAAGGCAGCAAGAAGG - Intergenic
1045632924 8:104147730-104147752 CTAGGTTTATGGGGGCTAGCTGG + Intronic
1048074478 8:131054058-131054080 GGGAGTTTAGGGGGGCAAGATGG + Intergenic
1048266259 8:132989922-132989944 CTCACTTTACTGGGGCAAGCAGG - Intronic
1049902635 9:184315-184337 CTGAGTTTAAAAGAGCAAGGAGG - Intergenic
1053745659 9:41194601-41194623 CTGAGTTTAAAAGAGCAAGGAGG - Intronic
1054481612 9:65670613-65670635 CTGAGTTTAAAAGAGCAAGGAGG + Intronic
1054682683 9:68236670-68236692 CTGAGTTTAAAAGAGCAAGGAGG + Intronic
1054910614 9:70451970-70451992 CTGAGCTTAAGTGTGGAAGCTGG + Intergenic
1059887243 9:118759750-118759772 GTGACCTTAAGGGGGCATGCAGG - Intergenic
1060535743 9:124386372-124386394 CTGAGATTCAGGGGTCAAGGGGG + Intronic
1061008304 9:127941060-127941082 CTGAGCTCAAGGGGACAAGAGGG + Exonic
1202781792 9_KI270718v1_random:5382-5404 CTGAGTTTAAAAGAGCAAGGAGG - Intergenic
1190006380 X:46743381-46743403 CTGAGTTTCAGAAGGAAAGCAGG - Intronic