ID: 915555253

View in Genome Browser
Species Human (GRCh38)
Location 1:156657597-156657619
Sequence CACCGCAGACCGCCCGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915555242_915555253 25 Left 915555242 1:156657549-156657571 CCCGACAAGGGCGGGTGCTGGAT 0: 1
1: 0
2: 0
3: 0
4: 72
Right 915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
915555243_915555253 24 Left 915555243 1:156657550-156657572 CCGACAAGGGCGGGTGCTGGATC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG 0: 1
1: 0
2: 1
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915555253 Original CRISPR CACCGCAGACCGCCCGGGAG CGG Intronic
901448385 1:9321803-9321825 CACCGCAGAGACCACGGGAGAGG + Intronic
904137185 1:28322253-28322275 TTCCCCAGACAGCCCGGGAGGGG + Intergenic
910967591 1:92823195-92823217 CACAGCAGACCAGCAGGGAGAGG + Intergenic
915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG + Intronic
921731274 1:218581171-218581193 CACCCCTGACCTCCTGGGAGAGG - Intergenic
922802746 1:228371697-228371719 CACCGCAGGCCTCCGAGGAGGGG - Exonic
923446892 1:234080096-234080118 CACCCCCGACCTCCAGGGAGAGG + Intronic
1069006273 10:63320932-63320954 CACCCCAGACCTCCAGGGAGAGG + Intronic
1072152584 10:92695817-92695839 CAAGGCAAACGGCCCGGGAGAGG - Intergenic
1074757242 10:116633098-116633120 CCCCGCAGACCCCCCAGGAGTGG + Intronic
1076608200 10:131702946-131702968 CACCGCAGAGCTCACGGGAAGGG + Intergenic
1076657852 10:132036587-132036609 CCGCGGGGACCGCCCGGGAGTGG + Intergenic
1076985500 11:233201-233223 CCCTGCAGATCGCCGGGGAGTGG - Exonic
1077302940 11:1855504-1855526 CCCCTCAGACTGCCCGGGACGGG + Intronic
1077416694 11:2427285-2427307 CACCGCTGACAGCCCAGGTGGGG - Intergenic
1081969096 11:47186123-47186145 TTCCGCAGGCCGCCCGGGGGAGG - Intronic
1083306556 11:61764811-61764833 CAGCGCAGAGGGCCCAGGAGAGG + Intronic
1101561569 12:105862414-105862436 CACTGCAGCCACCCCGGGAGTGG - Intergenic
1102472193 12:113165634-113165656 CCCCACTCACCGCCCGGGAGCGG + Exonic
1106776672 13:33016325-33016347 CAGCGGAGCCCGCCGGGGAGCGG + Intergenic
1110436153 13:75480939-75480961 CACCGCCGTCCTCCCGGGACGGG + Intronic
1112506982 13:99981362-99981384 CGCCGCAGAGCGCCGCGGAGAGG + Intergenic
1113838197 13:113343379-113343401 CCCCACAGAGCTCCCGGGAGTGG - Intronic
1114192996 14:20454821-20454843 CACCGCGGAACTCCCGCGAGCGG + Exonic
1115440616 14:33430539-33430561 CAGTGCAGACACCCCGGGAGTGG - Intronic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1132507090 16:316412-316434 CACAGCAGAGCGCCCGGAAGGGG - Intronic
1132692478 16:1187781-1187803 CTCCTCAGACCACCAGGGAGGGG - Intronic
1132759659 16:1502518-1502540 GGCCGCAGGCCCCCCGGGAGAGG - Intronic
1137608965 16:49806218-49806240 CACCCCAGCCCCCCAGGGAGGGG + Intronic
1139364985 16:66427487-66427509 CACCGCAGAGCGCGGGGGAATGG - Intronic
1141627305 16:85268090-85268112 CACAGCAGACCGCTCAGCAGTGG - Intergenic
1141642434 16:85349037-85349059 CACGGCAGATCGCGCGGGAGAGG - Intergenic
1141989447 16:87602147-87602169 CACCGCCCAGCTCCCGGGAGGGG + Intronic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1144653754 17:17022515-17022537 CACTGCTGACCACCAGGGAGGGG - Intergenic
1145282348 17:21477250-21477272 AACAGCAGAAGGCCCGGGAGGGG - Intergenic
1146816572 17:35947367-35947389 CACCGCCCACCGCCCAGGATAGG - Intergenic
1156502361 18:37567574-37567596 CCCCGCAGCCCGCGGGGGAGCGG - Intergenic
1160266162 18:77342066-77342088 CACTGCAGGCCGCACGGGAGGGG - Intergenic
1160760807 19:783218-783240 CACCGCAGACAGCCCAGGCGCGG - Intergenic
1160952439 19:1674195-1674217 AATGGCAGACCGCCAGGGAGGGG + Intergenic
1161089879 19:2354399-2354421 CACCACAGACAGCCAGGGTGCGG - Intronic
1161208968 19:3056542-3056564 CATCCCAGCCCGCCCTGGAGAGG + Intronic
1161272687 19:3398694-3398716 CCCCACAGACAGCCCGGGACAGG + Intronic
1162200351 19:9015467-9015489 CACCGCACCCGGCCAGGGAGTGG + Intergenic
1162817814 19:13207204-13207226 CAGCACAGAGGGCCCGGGAGAGG - Exonic
1163775200 19:19213258-19213280 CACCCCAGACAGGCAGGGAGGGG + Intronic
1164692635 19:30222597-30222619 CCCCGCAGACGGCCGGGCAGGGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1166830854 19:45638953-45638975 CATCGGAGACCTCCGGGGAGCGG - Intronic
1167310605 19:48735495-48735517 CACCCGACGCCGCCCGGGAGCGG + Exonic
1167619976 19:50555335-50555357 CACCGCAGCTGCCCCGGGAGAGG + Intronic
1167650927 19:50728233-50728255 CTCCGCAGAGAGCCAGGGAGAGG - Intergenic
1168276972 19:55284127-55284149 CACCTCAGACCCCCCCGGCGGGG + Intronic
926691000 2:15733335-15733357 AACCGCACACCGGCCGGGCGCGG - Intronic
937282917 2:120732679-120732701 CAGCACAGACCGCCAGGCAGCGG + Intergenic
938236083 2:129708358-129708380 CACCGCAGAGCACCAGGCAGGGG + Intergenic
940651027 2:156440997-156441019 CACTCCAGACCTCCGGGGAGAGG + Intronic
946329903 2:219003090-219003112 CCGCGCAGACCGCGCGAGAGGGG - Intronic
1172194494 20:33083027-33083049 CCAAGCAGACCGCCCAGGAGAGG - Intronic
1180156857 21:45982169-45982191 GACCGCAGGCAGCTCGGGAGGGG + Intronic
1184680856 22:46071520-46071542 CCGCGGAGACCGCCCGAGAGCGG - Intronic
1185044899 22:48523903-48523925 CACCACAGGCCGCCCAGGCGAGG + Intronic
1185271965 22:49933953-49933975 CACAGCAGACCCCCGGGGATGGG + Intergenic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
952301346 3:32106805-32106827 CAGCCCTCACCGCCCGGGAGAGG - Intronic
954375977 3:50194326-50194348 CTCCTCAGGCCGCCCGGGACAGG - Intronic
961464338 3:127072281-127072303 CAGTGCAGACCCCCGGGGAGTGG + Intergenic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
968884920 4:3323189-3323211 CACGGCACCCCTCCCGGGAGAGG - Intronic
974069404 4:57110343-57110365 CACCGCACCCCGCCATGGAGCGG - Exonic
975485784 4:74933220-74933242 CACCGCAGCCCACCCGGCAGAGG + Exonic
975666798 4:76741106-76741128 CCCCGCACACGCCCCGGGAGCGG + Exonic
983249380 4:165327455-165327477 CACCGCGGAGCGCCCGGAGGCGG - Intergenic
988891272 5:35619392-35619414 CACCGCACCCGGCCCGGGTGTGG - Intronic
990545094 5:56815122-56815144 CACCGCGGAGCTCGCGGGAGGGG - Intergenic
1002445624 5:179288308-179288330 CAGGGCTGCCCGCCCGGGAGTGG - Intronic
1002462707 5:179383533-179383555 CACCACAGCCCGGCCGGGCGCGG - Intergenic
1016004768 6:139078400-139078422 CACAACAGACCGGCCAGGAGTGG + Intergenic
1018730342 6:166645548-166645570 CAGGGCAGACCTCCCAGGAGTGG - Intronic
1020272973 7:6607859-6607881 CCCCGCACCCCGCCCAGGAGAGG - Intronic
1022528489 7:31052949-31052971 CGCCGCAGACTGCCGGGGTGGGG + Intronic
1023862616 7:44225345-44225367 CACCGCAGAGCCTCTGGGAGTGG - Intronic
1024220518 7:47282977-47282999 CACAGCAGACAGGCCGGCAGGGG - Intronic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049310608 8:141931866-141931888 CACCCCTTACCGCCCAGGAGGGG + Intergenic
1057025898 9:91733581-91733603 CCCCGCACACCACCCTGGAGAGG + Intronic
1061044945 9:128160056-128160078 CCCCGCCCAGCGCCCGGGAGAGG + Intergenic
1061222113 9:129258415-129258437 CACTGCGGACCGCCCGGGGTCGG + Intergenic
1189534609 X:41923534-41923556 CGCCACCGCCCGCCCGGGAGTGG + Intergenic