ID: 915558647

View in Genome Browser
Species Human (GRCh38)
Location 1:156674126-156674148
Sequence TGGTGGCTTCACTGGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915558632_915558647 4 Left 915558632 1:156674099-156674121 CCTCGGGGCCCACCAGACCCTTC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 230
915558628_915558647 27 Left 915558628 1:156674076-156674098 CCTCAAAAAATAGCAGTTAAATT 0: 1
1: 0
2: 3
3: 52
4: 578
Right 915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 230
915558635_915558647 -5 Left 915558635 1:156674108-156674130 CCACCAGACCCTTCCCCTTGGTG 0: 1
1: 0
2: 4
3: 39
4: 327
Right 915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 230
915558634_915558647 -4 Left 915558634 1:156674107-156674129 CCCACCAGACCCTTCCCCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 219
Right 915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 230
915558637_915558647 -8 Left 915558637 1:156674111-156674133 CCAGACCCTTCCCCTTGGTGGCT 0: 1
1: 0
2: 6
3: 24
4: 273
Right 915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915558647 Original CRISPR TGGTGGCTTCACTGGGGGTC AGG Intronic
900485364 1:2920297-2920319 TGGGGGCTTCCCTGTGGGTGGGG + Intergenic
900589050 1:3451467-3451489 TGGTGGCCTCACTGGGCTACAGG - Intergenic
901491080 1:9596648-9596670 AGGTGGCTTCACTCGGCATCTGG + Intronic
902885829 1:19404003-19404025 CGGTGGCATCACTTGAGGTCGGG + Intronic
904131101 1:28275916-28275938 TGGTGGCATCACTGGAGTCCAGG + Intronic
904160725 1:28520341-28520363 TGGTGAGGTCACTGGAGGTCAGG + Intronic
905337235 1:37253455-37253477 TGGTGGGGTCAGTGGGGGTCTGG - Intergenic
910003739 1:82368631-82368653 TGGCGGCTTCACTACAGGTCTGG - Intergenic
910437177 1:87217046-87217068 TGGTGGCATGACTTGGGGTTTGG + Intergenic
910541896 1:88368878-88368900 AGGTGGATTCACTTGAGGTCAGG + Intergenic
910819314 1:91328960-91328982 TTTTGGCTTCACTGGCAGTCAGG - Intronic
915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG + Intronic
916681642 1:167110085-167110107 TGGTGGCTCCACTGGGTGGCTGG + Intronic
916818793 1:168378338-168378360 TGCTGTCTGCACAGGGGGTCTGG + Intergenic
917474359 1:175355592-175355614 TGGTGACTTCACTGGCTGTCAGG + Exonic
917837636 1:178953636-178953658 TGGTGCCTTCTCTGCGGGTGGGG - Intergenic
920022520 1:202966866-202966888 TGCTGGCCTCCCTGGGGGTGGGG - Exonic
921257113 1:213352458-213352480 TGGTGGCAAGACTGGGGATCTGG + Intergenic
923067944 1:230537592-230537614 TGGGGCCTTCACTGGGGTCCCGG - Intergenic
1066707611 10:38198565-38198587 TGGGGGGATCACTGGAGGTCAGG + Intergenic
1068241593 10:54308787-54308809 TGGGGGCCTGTCTGGGGGTCGGG - Intronic
1068351063 10:55845866-55845888 TGATGGCTACCCTGGGTGTCAGG + Intergenic
1069646319 10:70001079-70001101 TGGTGGTTTCACTGTGGGGCAGG - Intergenic
1071482220 10:86073479-86073501 TGGTGGGTTCCCTGGGGGTGTGG + Intronic
1075817647 10:125277676-125277698 TGGTGGCTGCACTCTGGGTATGG + Intergenic
1076992795 11:284485-284507 TGGAGCCCTCGCTGGGGGTCAGG - Exonic
1081967437 11:47178203-47178225 TGGTGGCTGCATTCAGGGTCTGG - Intronic
1083313109 11:61795940-61795962 TTTTGGCTTCACTGGCAGTCAGG - Exonic
1084013896 11:66367641-66367663 CAGTGTCTTCTCTGGGGGTCAGG + Intronic
1084127377 11:67108823-67108845 AGGTGGCCTCACTTGAGGTCAGG + Intergenic
1084793344 11:71488970-71488992 GGGTGGCTTTGCTGGGGGCCTGG + Intronic
1085174515 11:74474349-74474371 GGGTGTCTTTACTGGAGGTCTGG + Intergenic
1085518451 11:77124621-77124643 AGGTGGCGTCAGTGGGGGTGAGG + Exonic
1086743044 11:90391658-90391680 TCTGGGCTTCCCTGGGGGTCGGG - Intergenic
1087479459 11:98680852-98680874 TGCTGGCTTCTCTGTGGGACTGG - Intergenic
1088136744 11:106564621-106564643 TGATAGGTTCACTGTGGGTCAGG - Intergenic
1089197677 11:116704146-116704168 TGGGGGCATCACTTGAGGTCAGG + Intergenic
1089752051 11:120659116-120659138 TGCTGGCTTCACTGGGGTGAGGG - Intronic
1091290552 11:134437103-134437125 TTCTGTCTTCAGTGGGGGTCGGG + Intergenic
1091305114 11:134531672-134531694 AGGTGGCTGCACTGGAGGTGGGG - Intergenic
1092172538 12:6383171-6383193 TTGAGGCTTCACTGAGGCTCTGG - Intronic
1093658394 12:21724192-21724214 GGGTGGCCTCACCTGGGGTCAGG + Intronic
1094687404 12:32731564-32731586 TGGTGGTTTCACTGGGTGGAAGG + Intronic
1096299977 12:50418226-50418248 TGGTGGATCCACTTGAGGTCAGG - Intronic
1097053961 12:56239185-56239207 TGGTCGCTTCTCTAGGGGTTGGG + Exonic
1098086209 12:66846950-66846972 TAGTGGCTTCCCTGGTTGTCTGG + Intergenic
1099523180 12:83689186-83689208 TGGTGACTTTGCTGGGGGTGGGG - Intergenic
1099983885 12:89640404-89640426 TGGTTGCCTCACTGGGGGTGGGG + Intronic
1101427700 12:104601254-104601276 TGGTGGCTTCAATGTTGGTGGGG + Intronic
1102226859 12:111234944-111234966 TGGGGGCATCACTTGAGGTCAGG - Intronic
1102571480 12:113829608-113829630 TGGGGGCCACACTGGGGCTCAGG + Intronic
1104933543 12:132352907-132352929 TGGTGCCTTCTCTGGGTTTCCGG + Intergenic
1106269373 13:28138737-28138759 TGGTGGCCCCGCCGGGGGTCGGG + Exonic
1106415201 13:29540593-29540615 TAATGGCTTCCCTGGGGGCCAGG + Intronic
1107811847 13:44208013-44208035 TGAAGGCTTGACTGGGGCTCAGG + Intergenic
1108039177 13:46323610-46323632 TGGTGTCTTCACTGGGTTGCTGG + Intergenic
1108118814 13:47160756-47160778 TGGTGGCATCACTGGTTGTTGGG + Intergenic
1113120577 13:106919842-106919864 TGCTGTCTGCACTGGGGGCCTGG - Intergenic
1114485901 14:23061512-23061534 TGGTGGCTGGACCGGGGGTGGGG + Exonic
1115435246 14:33364780-33364802 TGTTGTCTTCAGTGGGGGTGTGG - Intronic
1117827654 14:59720226-59720248 TGGTGGCTTCACTGAGTGGTGGG - Intronic
1119894951 14:78212193-78212215 TGGTGGTTTCACAGTGTGTCTGG + Intergenic
1120063100 14:80008162-80008184 TGGTGACCTCACTGTGTGTCAGG + Intergenic
1121224535 14:92311549-92311571 TGATGCCTTTAGTGGGGGTCTGG - Intergenic
1122277846 14:100604354-100604376 CGGTGGCTTCATTGGGGTTGGGG - Intergenic
1122956436 14:105073651-105073673 TGGGGGCTGCAGTGGGGGCCTGG + Intergenic
1124351025 15:28955780-28955802 TGGTGGGTTCCCTGAGGGTCGGG + Intronic
1125060682 15:35419205-35419227 TGGTGTGTTCAGTGGGAGTCTGG - Intronic
1125593796 15:40872073-40872095 TGGGGGCTGGACTGGGGGTGGGG - Intergenic
1127460578 15:59194859-59194881 TGCAGGCTTCACTGGAAGTCAGG + Intronic
1128863509 15:71094290-71094312 TAGGGTCTTCACTGGGGGTGGGG + Intergenic
1129148749 15:73673372-73673394 TGGTGGCTTCAGTCGTGGTGGGG + Intergenic
1129549899 15:76437099-76437121 TGGTGTCTTCTCTGAGGGTTGGG + Intronic
1130143833 15:81256569-81256591 TGGGGGGTTCACTGGAGTTCAGG - Intronic
1130297619 15:82658345-82658367 TGGTGGGTGCAGTGGGGGTCAGG - Intergenic
1130885300 15:88087670-88087692 TGGTGACATCTCTGGGGCTCTGG - Intronic
1130935177 15:88464079-88464101 TGGTTACTGCACTGGGGGTGGGG + Intronic
1131313185 15:91309268-91309290 TAGTGGCTTCTCTGGTAGTCGGG - Intergenic
1131454250 15:92570917-92570939 TGGTGGCTGTGCTGGGGGTGGGG - Intergenic
1132617463 16:848833-848855 TGGCGGGTTCACTGGGCATCAGG + Intergenic
1132654545 16:1036426-1036448 TGGCTGCTCCTCTGGGGGTCTGG + Intergenic
1133517338 16:6522247-6522269 TGATCTCTTCACTGGGGGTAGGG - Intronic
1136108934 16:28052616-28052638 TGGTGACCTCACTGGGGACCTGG - Intronic
1138206239 16:55127221-55127243 TGAAGGCTTCACTGGGGCTGGGG + Intergenic
1140892318 16:79295739-79295761 TGGGGGCTTCCCTGTGTGTCAGG + Intergenic
1141037613 16:80642213-80642235 TGGGTGCTTCACTTGAGGTCAGG + Intronic
1141652780 16:85402440-85402462 TGGTGGTTTCTCTGAGGGCCGGG + Intergenic
1142515980 17:429303-429325 TGGGGGCATCACTTGAGGTCAGG - Intergenic
1142849136 17:2695900-2695922 TGGTGGCATGGCTGGGGGACGGG - Intronic
1142978283 17:3657846-3657868 TGGGGGCTGCACTGGGGTTGTGG - Intronic
1143523064 17:7456523-7456545 GGGGGGTTTCCCTGGGGGTCTGG + Intronic
1144585264 17:16483714-16483736 GGCTGGCTTCACTGGGAGCCAGG - Intronic
1144829565 17:18123704-18123726 ATGTGGCATCCCTGGGGGTCAGG + Intronic
1147171886 17:38625391-38625413 TGGGGGCATCACTTGAGGTCAGG - Intergenic
1150207460 17:63419882-63419904 TGGTGGCGTCTGTGGGAGTCTGG - Intronic
1150594750 17:66594114-66594136 TGGTGGTTTCCCTGAAGGTCTGG + Intronic
1150601490 17:66654715-66654737 TGTTGGCACCACTGGGGGTGAGG + Intronic
1150782196 17:68133369-68133391 TGGAGGCTTCGCTGGGCCTCAGG + Intergenic
1151671088 17:75572011-75572033 TGGTGGCTTCCCTGCATGTCAGG - Exonic
1152549015 17:81020002-81020024 TGGGGGCTAGGCTGGGGGTCAGG + Intergenic
1152619905 17:81357929-81357951 TGGTTTCTTCACTTGGGGTGGGG + Intergenic
1152654474 17:81513398-81513420 TGGTGGCTGCGCTTGGGGACGGG - Intronic
1153818821 18:8814721-8814743 TGATGGCCTCACTGGGGTACAGG - Intronic
1153885897 18:9465622-9465644 TGGTGGTTTCAGTGGGGGCTAGG - Intergenic
1156016501 18:32552904-32552926 TGGTGGCTCTGCTGGGGCTCAGG - Intergenic
1156879776 18:42062908-42062930 TGATGGTTTCAATGGAGGTCAGG - Intronic
1158616293 18:58990848-58990870 TCCTGGCTTCACTGTGGCTCTGG - Intergenic
1160179124 18:76619145-76619167 TCGTGGGTTCACTGGGGCACAGG + Intergenic
1160572687 18:79829715-79829737 TGGGGGCTCCACTTGGGCTCAGG + Intergenic
1160949952 19:1661365-1661387 TGGTGGTTACTCTGGGGGTGGGG + Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162071268 19:8153675-8153697 TGGGGGCTCCAATGGGGATCTGG + Intronic
1163695494 19:18761394-18761416 TGGGGGATGCACTGGGGGTGGGG + Intronic
1163695660 19:18762095-18762117 TGGTGGCTTCTATGCGGGGCAGG - Intronic
1163833972 19:19562352-19562374 TAGTGGCTTCCCTGGGGCTTAGG + Intronic
1164854841 19:31512803-31512825 TGGTGGCTGGACAGAGGGTCTGG - Intergenic
1164904599 19:31956785-31956807 TGGTTGATGCACTGGGGATCTGG + Intergenic
1164916589 19:32057266-32057288 TGGGGGCTTCACTGGGTGCAGGG - Intergenic
1165658357 19:37552718-37552740 TGGTGGGATCACTTGGAGTCAGG + Intronic
1165867167 19:38945963-38945985 TGGTCTCTTCCCTGGGGCTCTGG - Intronic
1166219691 19:41356422-41356444 TGGTGCCACCACTGGGGGACTGG + Intronic
1166351482 19:42200566-42200588 TGCTGGCTCTACTGGGAGTCAGG + Intronic
1166423080 19:42653373-42653395 TGGTGGCTGAGCTGGGGTTCAGG - Intronic
1167164796 19:47791132-47791154 TGGTTGGATCACTGGAGGTCAGG + Intergenic
1167241519 19:48346317-48346339 TGGTTGCATCACTTGAGGTCAGG - Intronic
1168289762 19:55351885-55351907 TGGCGGCTGCAGAGGGGGTCGGG + Intronic
926118709 2:10229326-10229348 GGGGGGCTCCACAGGGGGTCAGG + Intergenic
928887951 2:36171496-36171518 TGGAGGCTTAACTGGGGTTCTGG - Intergenic
929942646 2:46346772-46346794 GTGTGGCTGCACTGGGGGTTGGG + Intronic
934167464 2:89307248-89307270 TCGCAGCTACACTGGGGGTCAGG + Intergenic
934199811 2:89875196-89875218 TCGCAGCTACACTGGGGGTCAGG - Intergenic
934984707 2:98876004-98876026 TTGTGGCTTAACCTGGGGTCCGG - Intronic
937909542 2:127068803-127068825 AGGTGGCTGAACTGGGGGTGGGG - Intronic
938086420 2:128405044-128405066 TGGTGGCTGTGCTGGGGCTCTGG + Intergenic
938113790 2:128589912-128589934 AAGTGGCTTGACTGGGGTTCTGG + Intergenic
938905976 2:135836572-135836594 TGTGGGCATCACTGAGGGTCTGG + Exonic
940574560 2:155484511-155484533 TGGTGACTCCACTGGGAATCAGG + Intergenic
940638708 2:156327403-156327425 TGGGGGCCTGTCTGGGGGTCAGG - Intronic
944206158 2:197160778-197160800 TGGGAGCTTCCCTGGGGGTTTGG + Intronic
946192257 2:218013741-218013763 GGGGGGCTATACTGGGGGTCTGG + Intergenic
946362745 2:219229086-219229108 TGGTGACTTCCCTGAGGGGCAGG - Exonic
946967617 2:225054499-225054521 TGGGGGAATCACTGGAGGTCAGG + Intergenic
947358855 2:229325942-229325964 TGGTGGCATCACCTGAGGTCTGG + Intergenic
947590852 2:231384276-231384298 AGGTGTCTTCACTGTGGGTGAGG - Intergenic
948240592 2:236429770-236429792 GGGTGGCTCCAGTGGGGGACAGG + Intronic
948429702 2:237911731-237911753 TGGTGACGGCACTGGTGGTCTGG + Exonic
948663848 2:239522615-239522637 TGGGGGCTGCACTGGGGGCCTGG - Intergenic
1170429583 20:16264060-16264082 TGCTGGCATCTCTGAGGGTCAGG - Intergenic
1172990873 20:39035644-39035666 TGGTGGCATCACAGGGGCTTAGG + Intronic
1173252848 20:41373808-41373830 TGGTGGCTAATCTGGGGCTCTGG + Intergenic
1173822531 20:46028804-46028826 CGGCTGCTTGACTGGGGGTCTGG - Intronic
1175307961 20:57991002-57991024 TGGTGGGTGCAGTGGGGGTAGGG - Intergenic
1176019418 20:62954854-62954876 TGCTGGCCTCAATGGGGGTGAGG + Intronic
1179044567 21:37832758-37832780 TGGGGGCTCCACTGGGAGCCTGG + Intronic
1179966251 21:44807826-44807848 CTGGGGCTTGACTGGGGGTCAGG - Intronic
1180185351 21:46136602-46136624 TGTGGGCTGCACTGGGTGTCTGG + Intronic
1184601827 22:45548516-45548538 TGGGGGCTGCACTGGGGCCCGGG - Intronic
949786073 3:7743427-7743449 TAATGGATTCACTGGGGGGCTGG - Intergenic
952024088 3:29057699-29057721 TTGTGGCTGCTCTGGGGGTTGGG - Intergenic
953146832 3:40285049-40285071 TGGTGGGATCACTTGAGGTCAGG - Intergenic
954337493 3:49928321-49928343 TTGTGGCTCCAATGGGGGTTGGG - Intronic
954371054 3:50169783-50169805 AGGTGGCATCAGTGGGGGCCAGG - Intronic
956302441 3:67787093-67787115 TTGTTGCTTCACTGTGGGTAGGG + Intergenic
961119506 3:124361796-124361818 TGGTGGCAGCAGTGGGGGTGGGG + Intronic
961119515 3:124361827-124361849 TGGTGGCAGCAGTGGGGGTGGGG + Intronic
961415322 3:126752651-126752673 TTGTGGCTGCCCTGGGGGACAGG + Intronic
961477810 3:127159478-127159500 TGGAGGCTTCTGTGGGGGTGTGG - Intergenic
966084589 3:176054218-176054240 TAGTTGCTTCTCTGGGGTTCTGG + Intergenic
968614500 4:1571252-1571274 TGGCCGCCTCACTGAGGGTCTGG + Intergenic
968952465 4:3702069-3702091 TGGTGGGTTCCCTGGGGGAAGGG + Intergenic
969321962 4:6417816-6417838 TGATGGCTGCTCTGGGTGTCTGG - Intronic
969423771 4:7111992-7112014 TTGTGGCTACCCTGGGGGTCAGG - Intergenic
975614072 4:76229619-76229641 TGGTAGCTGCACTGGGTGGCTGG - Intronic
977332710 4:95657776-95657798 TGGTTGCTTCACTGGGTCTGCGG + Intergenic
979577745 4:122315216-122315238 TGGTGGATCAACTTGGGGTCAGG + Intronic
985638520 5:1052242-1052264 GGGCGGCATCACTGGGGGACAGG + Exonic
988210971 5:28202706-28202728 AAGTGGCTTTACTGGGGTTCAGG + Intergenic
989355634 5:40540831-40540853 TGGTAGTTTCTCTGGTGGTCTGG - Intergenic
993629122 5:90262691-90262713 AGGTGGCTTCACTGGGAAACAGG + Intergenic
994181774 5:96775634-96775656 TAGTGGCCTCAGTGGGAGTCTGG - Intronic
994615783 5:102102133-102102155 TGGTTGCTTCACTGGGGAGAAGG + Intergenic
995546452 5:113236846-113236868 GGGTGGCTTCGCTGGGAGGCTGG + Intronic
996581706 5:125038602-125038624 AGGTGCCTTCACTGGCAGTCAGG - Intergenic
997716672 5:136047844-136047866 TGGTGGCTTCTCTGCTGTTCTGG - Intronic
997949714 5:138232534-138232556 TGGGGGCATCACTTGAGGTCAGG + Intergenic
998169195 5:139862300-139862322 TGGTGGGGTCACTGAGGGCCTGG + Intronic
998413322 5:141927645-141927667 GGGTGGCTTCACTGGGGGAATGG + Intronic
1001946724 5:175785139-175785161 TGGTGGCATCATTGAGTGTCTGG - Intergenic
1003778721 6:9398830-9398852 TGCTGACTTCACTGGGAGGCAGG + Intergenic
1005357123 6:24995398-24995420 GGGTGGCATCACTGGGGGAAGGG + Intronic
1005851273 6:29824564-29824586 TGAGGGCTTCACTGGGGCTAGGG - Intergenic
1005858651 6:29884498-29884520 TGAGGGCTTCACTGGGGCTGAGG - Intergenic
1005863793 6:29923024-29923046 TGAGGGCTTCACTGGGGCTGAGG - Intergenic
1006168448 6:32079539-32079561 TGGTGGGTTCTGTGGGGGTGAGG + Intronic
1006306682 6:33225634-33225656 TGGTGGCTGCACAGGGGCTAGGG + Intergenic
1007839843 6:44706808-44706830 TGGTGGGGTCACTGGTGGGCAGG - Intergenic
1010076880 6:71808981-71809003 GTGTGGCTTCCCTGGGGGTGGGG - Intergenic
1013158895 6:107522410-107522432 TGGTGGCTTCACTGGGATTGAGG + Intronic
1013737790 6:113248284-113248306 TCCTGGCGTCACTGGGGGCCAGG - Intergenic
1014570237 6:122998080-122998102 GGATGGCTTCCCTGGGGGCCTGG + Exonic
1015286195 6:131489102-131489124 AGGTGGGATCACTGGAGGTCAGG + Intergenic
1015909865 6:138160375-138160397 TGATGGCTTCACTGGGCGTGAGG + Intergenic
1018097769 6:160407080-160407102 TGTTGGCGTCACTGGGGTTGTGG + Exonic
1020101755 7:5397737-5397759 TGGAGGCTTCTCTGGGGCCCAGG - Intronic
1022074878 7:26958202-26958224 TGTTGACTCCACTAGGGGTCAGG - Intronic
1023210522 7:37799140-37799162 TGGTGCCTTCACTGGAAGTCTGG - Intronic
1023983476 7:45082442-45082464 TGGGGGCTCCAGTGGGGGTAGGG + Exonic
1025004478 7:55343756-55343778 TTGGGGCCTCACTGGGGGTCTGG - Intergenic
1027048622 7:75007650-75007672 GGGTGGCTCCAGTGTGGGTCAGG - Intronic
1027928471 7:84499010-84499032 TGTTGGCTTCACTAGCGGTAAGG + Intergenic
1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG + Intergenic
1029384385 7:100233999-100234021 GGGTGGCTCCAGTGTGGGTCAGG + Intronic
1031963551 7:128010861-128010883 TGGCGGCTCCACAGGGGCTCTGG - Intronic
1032286630 7:130542501-130542523 TGGTGTCATCAGTGGGGGGCAGG + Intronic
1035238392 7:157514936-157514958 TGGGGTCTGCCCTGGGGGTCAGG + Intergenic
1035271363 7:157722029-157722051 TGGTGGCTGCTCCGGGGGTGGGG - Intronic
1036691271 8:10946293-10946315 GGGTGACTTCACTTTGGGTCGGG - Intronic
1038573375 8:28682669-28682691 TGGGGGCATCACTTGAGGTCAGG - Intronic
1042604745 8:70534197-70534219 TGGGGGCTCCACTGGGGATCAGG - Intergenic
1044904082 8:96980768-96980790 TGGTGGCTACACTGGGGTGAAGG - Intronic
1047049887 8:121099001-121099023 AGCAGGCTTCAGTGGGGGTCAGG + Intergenic
1048211009 8:132454163-132454185 TGGTAGCTCCACTGGAGCTCAGG + Intronic
1048328798 8:133458412-133458434 TGGGGCTGTCACTGGGGGTCTGG - Exonic
1049170083 8:141154444-141154466 TGGTGCCCTCACTGGAGTTCTGG + Intronic
1049354212 8:142179660-142179682 TGCTGGCTTCAGAGAGGGTCCGG - Intergenic
1049574114 8:143382593-143382615 AGCTGGCTTCACTGGGGCACAGG - Exonic
1050414369 9:5399760-5399782 GGGTGGATTCACTGGAAGTCAGG + Intronic
1050880973 9:10700304-10700326 TGGTGGCTTCACTCAAGGTTAGG - Intergenic
1056738986 9:89236420-89236442 TGGTGTCTTCCCCGAGGGTCTGG - Intergenic
1056759207 9:89403200-89403222 TGATGGCTACACTGTGGGTCTGG - Intronic
1056832055 9:89925049-89925071 TGGTGCCTTCACGGGGAGTGGGG - Intergenic
1058064672 9:100535541-100535563 TGGGGGAATCACTTGGGGTCAGG + Intronic
1058795309 9:108492171-108492193 TGGGGGCATCACTTGAGGTCAGG - Intergenic
1060198717 9:121639600-121639622 TGGGGGCCTCACTGTGGGTCAGG + Intronic
1060539501 9:124419997-124420019 TGGTGGCTTCACTGGTGAGTTGG - Intergenic
1062084930 9:134643554-134643576 TGGGGGCTGCCCTGGGGCTCTGG + Intronic
1062497947 9:136840452-136840474 TGGAGGCTTTCCTGGGGGGCGGG + Exonic
1062589259 9:137266103-137266125 TGCTGGCTGCTCTGGTGGTCGGG + Intronic
1185839298 X:3373761-3373783 AGGTGACTTCACTGTGTGTCTGG - Intergenic
1186777590 X:12880997-12881019 TGGGTGGTTCACTTGGGGTCAGG + Intronic
1187050698 X:15692843-15692865 TGGTGGCTTTACTTTGGGTGAGG + Intronic
1187059678 X:15774182-15774204 TGGTGGCTTTACTTTGGGTGAGG + Intronic
1189303379 X:39969166-39969188 TGATGGCTTCACGGGAGGCCTGG - Intergenic
1190883487 X:54510490-54510512 TGGTGGCTTCACAGAGGGGAGGG - Intergenic
1190928672 X:54930522-54930544 TGCTGGCTTCAGTGGCGGACTGG + Exonic
1192552413 X:72064884-72064906 TGGTGTCTTCACTTGGAGTTTGG - Intergenic
1193618379 X:83718892-83718914 CTGGGGCTTCTCTGGGGGTCGGG - Intergenic
1195657640 X:107347707-107347729 TGGTGGCTTGGCTTGGGGTCAGG - Intergenic
1198171502 X:134110140-134110162 TGGTGGCTGCCCAGGGGCTCGGG - Intergenic
1198497868 X:137211824-137211846 TTATGGCTTCTCTTGGGGTCTGG + Intergenic
1201236508 Y:11917079-11917101 AGGTGGCTTCACTGTGTATCTGG + Intergenic