ID: 915563770

View in Genome Browser
Species Human (GRCh38)
Location 1:156702686-156702708
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915563765_915563770 8 Left 915563765 1:156702655-156702677 CCAGCTGCTCGGGAGGCTGAGGC 0: 2560
1: 104770
2: 266022
3: 219174
4: 198698
Right 915563770 1:156702686-156702708 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
915563761_915563770 17 Left 915563761 1:156702646-156702668 CCTCTACTCCCAGCTGCTCGGGA 0: 2
1: 47
2: 4511
3: 123408
4: 314072
Right 915563770 1:156702686-156702708 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
915563763_915563770 9 Left 915563763 1:156702654-156702676 CCCAGCTGCTCGGGAGGCTGAGG 0: 2765
1: 111227
2: 293718
3: 226548
4: 225970
Right 915563770 1:156702686-156702708 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915563770 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intronic
Too many off-targets to display for this crispr