ID: 915564504

View in Genome Browser
Species Human (GRCh38)
Location 1:156706173-156706195
Sequence AAGCAGGGTGGAGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564504_915564517 -3 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT No data
Right 915564517 1:156706193-156706215 CTTCGGGCTCACGTAATGCCTGG No data
915564504_915564520 6 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT No data
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG No data
915564504_915564522 20 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT No data
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG No data
915564504_915564518 -2 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT No data
Right 915564518 1:156706194-156706216 TTCGGGCTCACGTAATGCCTGGG No data
915564504_915564519 -1 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564504 Original CRISPR AAGCAGGGTGGAGGGGTGGG GGG (reversed) Intergenic