ID: 915564504

View in Genome Browser
Species Human (GRCh38)
Location 1:156706173-156706195
Sequence AAGCAGGGTGGAGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1982
Summary {0: 1, 1: 2, 2: 14, 3: 200, 4: 1765}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564504_915564518 -2 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT 0: 1
1: 2
2: 14
3: 200
4: 1765
Right 915564518 1:156706194-156706216 TTCGGGCTCACGTAATGCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
915564504_915564517 -3 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT 0: 1
1: 2
2: 14
3: 200
4: 1765
Right 915564517 1:156706193-156706215 CTTCGGGCTCACGTAATGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 53
915564504_915564522 20 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT 0: 1
1: 2
2: 14
3: 200
4: 1765
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129
915564504_915564519 -1 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT 0: 1
1: 2
2: 14
3: 200
4: 1765
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564504_915564520 6 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT 0: 1
1: 2
2: 14
3: 200
4: 1765
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564504 Original CRISPR AAGCAGGGTGGAGGGGTGGG GGG (reversed) Intergenic
900204769 1:1427232-1427254 GAGCAGGGTGGAGCGGGGAGGGG - Intronic
900243282 1:1626792-1626814 CAGCAGGCTGCAGGTGTGGGGGG - Intronic
900246271 1:1637556-1637578 CACCCGGGTGCAGGGGTGGGTGG - Intronic
900291755 1:1926614-1926636 CACCGGGGTGGAGGTGTGGGCGG + Intronic
900385343 1:2408014-2408036 AGGCAGGGGCGAGGGGTGAGGGG + Intronic
900471996 1:2859595-2859617 AAGAAGGAAGGAGGGGTAGGAGG + Intergenic
900573343 1:3370875-3370897 ATGGATGGTGGATGGGTGGGTGG - Intronic
900573380 1:3371052-3371074 ATGGATGGTGGATGGGTGGGTGG - Intronic
900588382 1:3444993-3445015 GGGCGGGGTGGAAGGGTGGGTGG + Intergenic
900649503 1:3723989-3724011 CAGCAGGGTGGAGAGCCGGGAGG + Intronic
900780783 1:4615867-4615889 AAGCAGGGTGGAGCAGAGGGGGG + Intergenic
900806960 1:4773840-4773862 ATGCAGGGAGGTGGGGTGGGGGG + Intronic
900853506 1:5162472-5162494 CAGCAGAGTGGATGAGTGGGAGG + Intergenic
900869181 1:5289653-5289675 ATGAATGGTGGATGGGTGGGTGG + Intergenic
900902794 1:5528175-5528197 AAGTGGGGTAGAGGGGTGTGGGG - Intergenic
900993122 1:6106953-6106975 AGGAGGGGTGGAGGGGTGGAAGG + Intronic
900993154 1:6107067-6107089 AAGGATGATGGAGGGGTGGAAGG + Intronic
900998634 1:6136335-6136357 GAGCAGGGTGTTGGGGTGGGTGG - Intronic
901061801 1:6475192-6475214 AAGGAGGGTGGGGAGGAGGGCGG - Intronic
901129822 1:6955298-6955320 AAGAGGAGTGGAGGGGTGAGGGG - Intronic
901227241 1:7620923-7620945 AAGCAGGGAGGAGGTGTTGGAGG + Intronic
901497134 1:9628774-9628796 GGCCAGGGTGGAGGAGTGGGTGG + Intergenic
901722174 1:11208024-11208046 AAGCAGGGTGGACGGCTGCCTGG + Intronic
901751468 1:11412556-11412578 AGGATGGGTGGAGGGATGGGAGG + Intergenic
901752851 1:11422127-11422149 CAGCATGGCAGAGGGGTGGGAGG - Intergenic
901777353 1:11569527-11569549 CAGCTGGGTGGTGGGGCGGGAGG + Intergenic
901857313 1:12052723-12052745 ATCCAGGGTGGAGGGGGTGGAGG - Intergenic
901867683 1:12117843-12117865 TAGAAGGGTGAGGGGGTGGGAGG - Intronic
902053467 1:13582030-13582052 GATCAGGATGGAGGAGTGGGAGG - Intergenic
902586367 1:17440843-17440865 AAGTGGGGTGGAGAGGTGGAGGG - Intergenic
902754449 1:18540017-18540039 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
903014696 1:20354277-20354299 AGGCTGGGTGGAGGGAAGGGTGG + Intronic
903027928 1:20442841-20442863 TAGGAGGGTGGTGGGTTGGGAGG - Intergenic
903170060 1:21547244-21547266 AAACGGGGTGCTGGGGTGGGAGG - Intronic
903181047 1:21604986-21605008 TAGGTGGGTGGATGGGTGGGTGG + Intronic
903181057 1:21605018-21605040 TAGATGGGTGGATGGGTGGGTGG + Intronic
903220226 1:21865230-21865252 AGTCAGGGTGGAGGGTGGGGTGG + Intronic
903341698 1:22658880-22658902 CAGCAGGATGGAGGGATGGATGG + Intronic
903577149 1:24346114-24346136 AGGCGGGGTGGGGGGGTGGAAGG - Intronic
903662858 1:24989321-24989343 CAGCAGAGGGGAAGGGTGGGAGG + Intergenic
903855981 1:26337766-26337788 AAGGAGGTGGGAGGGCTGGGGGG - Intronic
903950081 1:26991579-26991601 AGGAAGGGTGGAGGGGTTGGGGG - Intergenic
904151945 1:28448859-28448881 AAGCGGGGGGCGGGGGTGGGGGG + Intronic
904391085 1:30186566-30186588 AAACATGATGGATGGGTGGGTGG - Intergenic
904473811 1:30751796-30751818 AAGCCGGGTGGAGGGCTAGCAGG - Intronic
904535771 1:31198617-31198639 AAGTAGGGTGGAGGGCAGGGGGG - Intronic
904754717 1:32761803-32761825 AAGAAGAGTGGGTGGGTGGGTGG + Intronic
904840465 1:33368864-33368886 AGGCTGGGTGCAGGGGTGGGTGG + Intronic
904936043 1:34130463-34130485 AAGCATGCAGGAGTGGTGGGAGG + Intronic
904992484 1:34604356-34604378 ACCCAGGGTGGAGGAGAGGGAGG + Intergenic
905013489 1:34762142-34762164 TAGCAGGGTGGTGAGGAGGGTGG + Exonic
905029847 1:34874808-34874830 CAGCAGGCAGGAAGGGTGGGAGG + Intronic
905035514 1:34915701-34915723 AGGCAGAGCTGAGGGGTGGGAGG - Intronic
905171909 1:36114683-36114705 AGGCAGGAGGGAGGTGTGGGTGG - Intronic
905254554 1:36671837-36671859 AAGGAGGATGGAGGTGGGGGAGG - Intergenic
905278916 1:36836550-36836572 AAGCAGAGCGGATGTGTGGGTGG + Intronic
905420975 1:37843858-37843880 ATGGATGGGGGAGGGGTGGGAGG - Intronic
905629304 1:39510087-39510109 CAGCAGGGAGGCGGCGTGGGTGG - Intronic
905668454 1:39776106-39776128 CAGCAGGGAGGCGGCGTGGGTGG + Intronic
905670110 1:39785809-39785831 AGGCTGGGTGGGGCGGTGGGGGG - Intronic
905671519 1:39793648-39793670 AGGAAGGGAGGAGGGGAGGGAGG + Intergenic
905693928 1:39961327-39961349 AAGCGGGGGGGGGGGGGGGGGGG - Intronic
905834378 1:41104793-41104815 AAGCTGGGTGGAAGGGCAGGGGG + Intronic
905966377 1:42100874-42100896 AAGAAGGGAGGAGGGGAGAGGGG + Intergenic
906143770 1:43548315-43548337 GTGCTGGCTGGAGGGGTGGGTGG + Intronic
906282866 1:44566099-44566121 AAGCTAGGGGGAGGGATGGGAGG - Intronic
906780942 1:48572448-48572470 AAGAAGGGAGGTTGGGTGGGGGG + Intronic
907222945 1:52920994-52921016 GAGCGGGGACGAGGGGTGGGGGG - Intronic
907313532 1:53553405-53553427 ATGGATGGTGGATGGGTGGGTGG - Intronic
907316721 1:53577128-53577150 AAGAAGCATGGAGGGGGGGGAGG - Intronic
907411943 1:54289382-54289404 AAGGTGGGGGGTGGGGTGGGGGG + Intronic
907696033 1:56730304-56730326 AAGGAGAGGGGAGGGGAGGGAGG + Intronic
908434521 1:64092112-64092134 ATGCAGGGAGGAAGGGAGGGAGG - Intronic
908781927 1:67698836-67698858 AAGCAGGGTGTATGTGTGGAGGG + Intergenic
908817548 1:68049968-68049990 AAGGAGTGTGGAGGGGAGTGGGG - Intronic
909587691 1:77309071-77309093 CTGCAGGGTGGTGGGGTCGGGGG + Intronic
909897738 1:81094081-81094103 AAGAAGGGAGGAGGGGAGGGAGG + Intergenic
909931929 1:81506340-81506362 AATGAGGGTGGAGGGGTAGAGGG + Intronic
910038912 1:82823747-82823769 AAGCAGGGTGGAGTTGGGGCGGG - Intergenic
910174337 1:84412958-84412980 AAGATTGTTGGAGGGGTGGGGGG - Intronic
910697607 1:90037091-90037113 AAGAAGAGTGATGGGGTGGGGGG + Intergenic
910751818 1:90639053-90639075 AGGGAGGGTGGAAGGGAGGGAGG + Intergenic
910907493 1:92196540-92196562 AAAAAGGGTGGGGGGGGGGGTGG - Intergenic
911059199 1:93733337-93733359 AAGGTGGGTCGGGGGGTGGGGGG - Intronic
911644783 1:100326586-100326608 AGGAAGGGTGGAAGGGAGGGAGG - Intergenic
911685237 1:100768206-100768228 GGGAAGGGTGGAGGGATGGGGGG + Intergenic
911708586 1:101043032-101043054 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
911871627 1:103107377-103107399 AAGCGGAGGGGTGGGGTGGGGGG + Intronic
912065556 1:105736480-105736502 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
912089509 1:106054158-106054180 GAGCAGGGTGCAGAGGTGTGGGG + Intergenic
912503371 1:110137327-110137349 CAGCTGGGAGTAGGGGTGGGGGG - Intergenic
912801586 1:112722923-112722945 CAGCAGGGAGGAGGGGCTGGAGG + Intronic
913387991 1:118280411-118280433 GAATAGGGTGGAGGGATGGGAGG + Intergenic
913600272 1:120415382-120415404 AGGCGGGGTGGGGGGTTGGGAGG + Intergenic
914086787 1:144461281-144461303 AGGCGGGGTGGGGGGTTGGGAGG - Intronic
914134140 1:144883842-144883864 AGGCGGGGTGGGGGGGGGGGAGG + Intergenic
914134180 1:144883939-144883961 AGGCGGGGTGGGGGGGGGGGAGG + Intergenic
914192686 1:145425223-145425245 AGGCGGGGTGGGGGGTTGGGGGG - Intergenic
914362262 1:146945075-146945097 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
914444815 1:147740899-147740921 AAGCATGGAGCAGGGTTGGGTGG - Intergenic
914590594 1:149103171-149103193 AGGCGGGGTGGGGGGTTGGGAGG - Intronic
914855062 1:151344708-151344730 TCGGTGGGTGGAGGGGTGGGTGG - Exonic
914918329 1:151831621-151831643 AAGAAGTGAGGAGGGGAGGGAGG - Intronic
915326720 1:155084670-155084692 CAGCCGGGAGGAGGGATGGGAGG - Intronic
915328608 1:155094311-155094333 CAGCAGGGTGCAGGTGTGAGAGG - Intergenic
915536814 1:156541316-156541338 AAGCAGGGCTGAGTGGTGGCTGG - Intronic
915564504 1:156706173-156706195 AAGCAGGGTGGAGGGGTGGGGGG - Intergenic
915581569 1:156816152-156816174 AGCCTGGGAGGAGGGGTGGGAGG - Intronic
915662311 1:157414661-157414683 AGGCAGGGTCCAGGGGTTGGGGG - Intergenic
915734967 1:158078725-158078747 AAACTGGGGTGAGGGGTGGGAGG + Intronic
915773468 1:158455593-158455615 AGGCAGGATGGAAAGGTGGGAGG - Intergenic
915913690 1:159929144-159929166 CAACAAGGTGGAGGGGTGGAGGG + Intronic
915940250 1:160114327-160114349 AAGCAGAGAGGAAGGGAGGGAGG - Intergenic
915994641 1:160550406-160550428 ATCCAGGGTGGAGGGGAGGGAGG + Intronic
916058448 1:161083588-161083610 CTCCAGGGAGGAGGGGTGGGAGG - Intronic
916091400 1:161310120-161310142 AGTCTGGGTGGAGGGGTGGGGGG + Intergenic
916126883 1:161579635-161579657 AAGCAGGCTGGAGGGGAAAGAGG - Intergenic
916136802 1:161661439-161661461 AAGCAGGCTGGAGGGGAAAGAGG - Intronic
916152752 1:161811732-161811754 ATGGTGGGTGGATGGGTGGGTGG - Intronic
916429015 1:164709910-164709932 AAGCATGGAGATGGGGTGGGTGG + Intronic
916704894 1:167339177-167339199 AAGCAGGGTTGAGGGGAGGAGGG - Intronic
916706633 1:167357373-167357395 AAGAAGCGGGGGGGGGTGGGGGG - Intronic
916793704 1:168146206-168146228 GGGAAGGGTGGGGGGGTGGGGGG + Intergenic
917149908 1:171932079-171932101 AAGAAGGGAGGAAGGGAGGGAGG - Intronic
917465004 1:175268276-175268298 CAGCTGTGTGTAGGGGTGGGGGG + Intergenic
917720259 1:177780179-177780201 AGGGAGGGTAGAAGGGTGGGAGG + Intergenic
917980255 1:180264850-180264872 AAGAAGGGTGTTGGGGTGTGAGG - Intronic
918125799 1:181582301-181582323 CAGCAGGAAGGAGGGGAGGGAGG + Intronic
918197340 1:182234683-182234705 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
918273315 1:182924834-182924856 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
918352824 1:183675360-183675382 AAGAAGGGAGGGAGGGTGGGAGG - Intronic
918393754 1:184093336-184093358 AGGCAGGGTGGTGGAGTGGAAGG + Intergenic
919459237 1:197856892-197856914 AAGCTGGGGGCGGGGGTGGGGGG - Intergenic
919661407 1:200251544-200251566 AATGAGTGAGGAGGGGTGGGTGG - Intergenic
919728584 1:200899167-200899189 AAGAAGGGAGGAGGAGTGGGGGG + Intronic
919731965 1:200918787-200918809 GAGCAGGGAAGAGTGGTGGGAGG - Intergenic
919832560 1:201552338-201552360 TGGCAGGGTGGCGGGGTTGGGGG + Intergenic
920035821 1:203064797-203064819 AAGCAGGCTGGGGGGCTGGGAGG - Intronic
920344726 1:205298882-205298904 AAGCCAGGTGGAGGGAAGGGTGG - Intergenic
920422921 1:205847852-205847874 AATCAGGGGCAAGGGGTGGGTGG - Intronic
920423534 1:205853885-205853907 AATCAGGGGCAAGGGGTGGGTGG + Intergenic
920647072 1:207811659-207811681 AATTAGGGTGGGTGGGTGGGAGG - Intergenic
920914804 1:210251385-210251407 AAGCATGGGGGAGGGGAGGACGG + Intergenic
921600210 1:217098636-217098658 AAGGAGGGTGGAAGGGAGGGAGG + Intronic
921841896 1:219837115-219837137 CAAAAGGGTGGAGAGGTGGGAGG + Intronic
921850668 1:219929094-219929116 AATGAGGGTGGAGGGCTGAGTGG - Intronic
922110130 1:222548122-222548144 AAACAGGGTGGAGTAGGGGGAGG - Intergenic
922221040 1:223608971-223608993 GAGCAAGGTGGAGGGGTAGGAGG + Intronic
922246436 1:223803001-223803023 GAGAAGTGTGGAGGGGTGGAGGG - Intronic
922333884 1:224603068-224603090 AAGCAGGCTGGAGGGGAAAGAGG + Intronic
922445076 1:225690257-225690279 AAGCAAGGAGGATGTGTGGGTGG + Intergenic
922539871 1:226410509-226410531 GGGAAGGGGGGAGGGGTGGGAGG + Intergenic
922615249 1:226957284-226957306 AACCAGGGAGGTGGGGGGGGGGG - Intronic
922723274 1:227909768-227909790 AGGAAGGGAGGAGGGGAGGGAGG + Intergenic
922723337 1:227909936-227909958 ATGAAGGGAGGAGGGGAGGGAGG + Intergenic
923040525 1:230317039-230317061 AAGCAAGGTGGAGGGTCTGGGGG + Intergenic
923140255 1:231155882-231155904 AAAGAGGGTGGAAGGGTGGGGGG + Intergenic
923310405 1:232729420-232729442 AAAAAAGGTGGAGGGATGGGCGG - Intergenic
923354622 1:233142012-233142034 AAACAGGGAGGAAGAGTGGGAGG + Intronic
923400897 1:233614615-233614637 AAGGTGGGGGGTGGGGTGGGAGG - Intronic
923498420 1:234544528-234544550 AAGGAGGGTGCAGGAGAGGGAGG + Intergenic
923610576 1:235488939-235488961 TAGCAGGGTGGTGAGGTAGGAGG + Intronic
923706640 1:236349531-236349553 AAGCGGGGTGGCGGGGGTGGGGG + Intronic
923914702 1:238489015-238489037 AATCAGGGTGCTGAGGTGGGAGG - Intergenic
923938676 1:238794516-238794538 AAGAAGGGAGGGAGGGTGGGAGG + Intergenic
924035639 1:239933797-239933819 AAGAAGGGAGGAGGGGAGGGAGG + Intergenic
924108109 1:240669703-240669725 CAGAAGGGTGAAGGGGTGGAAGG - Intergenic
924583478 1:245341787-245341809 AAGCAGGCTGGTGGGCAGGGAGG + Intronic
924598591 1:245468063-245468085 AAGCAGGGTGGGGGTGGGGATGG + Intronic
924603469 1:245512263-245512285 AGGCAGGGTGGACAGGTGGGAGG - Intronic
924622248 1:245672265-245672287 GAGCAGGGAGCAGGGGTGGAAGG + Intronic
924724041 1:246651257-246651279 CAGCAGCGTGGAGGGGTGGAGGG - Intronic
924728707 1:246692727-246692749 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
924816088 1:247443336-247443358 AACCACGTTGGAGAGGTGGGAGG - Intronic
1062812531 10:477441-477463 GAGGAAGGTGGATGGGTGGGAGG + Intronic
1062812545 10:477475-477497 GAGGAAGGTGGATGGGTGGGAGG + Intronic
1062812588 10:477598-477620 GAGGAAGGTGGATGGGTGGGAGG + Intronic
1062812595 10:477617-477639 GAGGAAGGTGGATGGGTGGGAGG + Intronic
1062844116 10:690965-690987 AAGCGGGGTGGGGGGGTGGTGGG - Intergenic
1062928411 10:1335454-1335476 AAACAGGGAAGAAGGGTGGGGGG + Intronic
1062940163 10:1414938-1414960 ATGGATGGTGGATGGGTGGGTGG + Intronic
1063216820 10:3932520-3932542 GGGCAGAGGGGAGGGGTGGGGGG + Intergenic
1063242011 10:4180235-4180257 AATCAGAGTCGAGGGCTGGGGGG + Intergenic
1063415517 10:5869764-5869786 TTGCTGGGGGGAGGGGTGGGTGG + Intronic
1063542227 10:6945380-6945402 AAGGAGGGTGGGAGAGTGGGAGG - Intergenic
1063958049 10:11283870-11283892 ATGATGGATGGAGGGGTGGGTGG + Intronic
1063958125 10:11284228-11284250 ATGAGGGATGGAGGGGTGGGTGG + Intronic
1064001886 10:11670614-11670636 AAGTGGGAGGGAGGGGTGGGAGG - Intergenic
1064121532 10:12623392-12623414 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1064154064 10:12888987-12889009 TAGTAGGATGGATGGGTGGGTGG + Intergenic
1064172691 10:13047942-13047964 AAGCAGGCTGGAGGGAAAGGAGG + Intronic
1064563865 10:16620362-16620384 AAACAGTGAGGAGGGGAGGGAGG + Intronic
1064998480 10:21316600-21316622 AAGCGGGTGGGAGGGATGGGAGG - Intergenic
1065111600 10:22445325-22445347 ACGCAGGGTGGTGGGGGCGGGGG - Intronic
1065129862 10:22609829-22609851 AAGGAGGGTGGGTTGGTGGGTGG - Intronic
1065341526 10:24711135-24711157 AAGGAGGGAGGGAGGGTGGGAGG + Intronic
1065367792 10:24952466-24952488 AAGCAGGGTGCCAGGGAGGGAGG + Intronic
1065441441 10:25756551-25756573 GAGCAGGGTGGGGTGGGGGGGGG - Intergenic
1065534005 10:26700248-26700270 AAGCGGGGTGGGGGGGAGGGGGG - Intronic
1065633150 10:27702770-27702792 AACCAAAGTGGAGGGGTGGGCGG + Intronic
1065921445 10:30396854-30396876 CAGCAGGGTGCAGTGGTGGGAGG - Intergenic
1066021059 10:31302707-31302729 AAGAAGGGAGGATGGGAGGGAGG - Intergenic
1066023033 10:31320480-31320502 AAGGAGGGTGGGGGAGGGGGCGG + Intronic
1066443511 10:35460994-35461016 GAGCAGTGGGCAGGGGTGGGAGG + Intronic
1066622203 10:37368519-37368541 CAGAAGTGTGGAAGGGTGGGAGG - Intronic
1067065393 10:43101445-43101467 AGCCAGGGTGCAGGGGAGGGAGG + Intronic
1067188473 10:44050108-44050130 AAGCAGTGCTGAAGGGTGGGTGG - Intergenic
1067210967 10:44260391-44260413 AATCAGAGTGGAGGTGTTGGGGG + Intergenic
1067343277 10:45420917-45420939 AAGTAGGGGCGAGGGGTGGGGGG + Intronic
1067545433 10:47189402-47189424 AAGCAGGGAGAAGGGGTGGAGGG + Intergenic
1067744732 10:48927219-48927241 AAGCAGGGGGGAGGGTTCGGGGG - Intronic
1068693311 10:59940200-59940222 TAGCAGGGTGCAGTGGTGGTGGG - Intergenic
1068702325 10:60033266-60033288 AAGCCGGGGGCAGGGGAGGGGGG + Intronic
1069273984 10:66566916-66566938 AAGAGAGGTGGAGAGGTGGGAGG + Intronic
1069329898 10:67279468-67279490 AAGCGGGCTGGAGGGGAAGGAGG + Intronic
1069354891 10:67573713-67573735 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1069422811 10:68261657-68261679 AAGGTGGGTGTAGGGGTGTGGGG + Intergenic
1069635983 10:69925190-69925212 AAGCAGGCTGGAGGGGAAAGAGG + Intronic
1070123405 10:73600311-73600333 AAGAAAGGTGTAGGGGTGGAAGG + Intronic
1070531273 10:77339529-77339551 AAGCTGGGTGGTGGGGAGGTGGG - Intronic
1070538458 10:77397765-77397787 CAGAATGGTGGAAGGGTGGGAGG - Intronic
1071258475 10:83896704-83896726 AGGCAGGATGGAAAGGTGGGAGG - Intergenic
1071339046 10:84625792-84625814 AAACAGGGCGGGGGGGGGGGCGG - Intergenic
1071361674 10:84852252-84852274 AAGAAGGGTGGTGGGGAGGGTGG - Intergenic
1071444891 10:85736269-85736291 AAGGAGGGAGGAGGGGAGAGAGG + Intronic
1071825598 10:89322566-89322588 AAGCACGGTGGTGGGGTCGGGGG - Intronic
1072060836 10:91809260-91809282 AAGCTGGGAATAGGGGTGGGAGG + Intronic
1072190023 10:93071247-93071269 AATTAGGCTGGATGGGTGGGGGG + Intergenic
1072641382 10:97213681-97213703 AAGTAAGGTGGAAGGGTGGGTGG - Intronic
1072803090 10:98407052-98407074 AAGGAAGGTGAAAGGGTGGGGGG + Intronic
1073019575 10:100431843-100431865 AGGCCGGGTGGGGGGGGGGGGGG - Intergenic
1073097271 10:100987471-100987493 AAGCAGCGAGGAGAGGGGGGCGG + Exonic
1073104951 10:101027249-101027271 GGGGAGGGTGGAGGGGAGGGCGG - Intronic
1073167388 10:101468393-101468415 AAGGCGGGGGGTGGGGTGGGAGG + Intronic
1073339282 10:102732818-102732840 AAGCTGAGGGGAGGGCTGGGAGG - Intronic
1073496503 10:103896344-103896366 AAACAGGGTGTAAGGGTGAGGGG + Intronic
1074609197 10:115004615-115004637 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1074875098 10:117607568-117607590 AAGCAGGGAGATGGGATGGGGGG - Intergenic
1074925250 10:118062443-118062465 TAGTAGGGAGGAGGGGTGAGGGG - Intergenic
1075006260 10:118832282-118832304 AAGCAGGGCGGGGTGGGGGGTGG + Intergenic
1075023869 10:118969608-118969630 AAGAAGGGGCGAGGGGTGAGGGG + Intergenic
1075907199 10:126091926-126091948 AGGAAGGGTGGATGGGTGGATGG + Intronic
1076011466 10:126992618-126992640 AACCTGGGTGGAGGGGTTTGAGG + Intronic
1076024506 10:127100681-127100703 AAGGAGGGTGGAGAGGCAGGTGG + Intronic
1076253378 10:129000383-129000405 AGGCAGGGTGGAGGTGGGTGGGG - Intergenic
1076358273 10:129868638-129868660 AAGGAGGGTGCAGGGGGGAGGGG + Intronic
1076359446 10:129876888-129876910 TAGCTGGGTGGGGGGGGGGGGGG - Intronic
1076748723 10:132529048-132529070 AACCCGGGGCGAGGGGTGGGCGG - Intergenic
1076824843 10:132961691-132961713 CAGCAGGGGTGAGGGGTGGGGGG - Intergenic
1076837498 10:133028518-133028540 TAGATGGGTGGATGGGTGGGTGG + Intergenic
1076844992 10:133065601-133065623 ATGGATGGTGGATGGGTGGGTGG + Intergenic
1076845007 10:133065662-133065684 ATGGAGGGTGGATGGGTGGATGG + Intergenic
1076845057 10:133065825-133065847 ATGGAGGGTGGACGGGTGGATGG + Intergenic
1076845129 10:133066069-133066091 ATGGAGGGTGGATGGGTGGATGG + Intergenic
1076845168 10:133066178-133066200 AGGAGGGGTGGAGGGGTAGGTGG + Intergenic
1076869353 10:133185877-133185899 GAGGAGAGGGGAGGGGTGGGAGG + Intronic
1077045785 11:544655-544677 AAGGAGGGTGCAGAGGTGGGCGG + Intronic
1077188546 11:1246185-1246207 CAGCACTGTGGAGGTGTGGGTGG - Exonic
1077189508 11:1249956-1249978 CAGCACTGTGGAGGTGTGGGTGG - Exonic
1077189819 11:1251237-1251259 CAGCACTGTGGAGGTGTGGGTGG - Exonic
1077248550 11:1550757-1550779 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248618 11:1551001-1551023 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248656 11:1551131-1551153 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248674 11:1551196-1551218 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248746 11:1551444-1551466 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077248811 11:1551679-1551701 GAGTGGGGTGGATGGGTGGGTGG - Intergenic
1077318646 11:1930182-1930204 AAGGAGGGAGGAGAGGTGGGTGG + Intronic
1077338195 11:2014675-2014697 AAACAGGGCGAGGGGGTGGGTGG - Intergenic
1077339260 11:2018722-2018744 AAGCAGAGGTGAGGGGTGGCAGG - Intergenic
1077391423 11:2302257-2302279 GAGCAGGGGTGAGGGGTGGCAGG + Intronic
1077507832 11:2940354-2940376 AAGGCGGGTGCAGGGCTGGGAGG - Intergenic
1077537614 11:3131973-3131995 AGGGTGGGTGGATGGGTGGGTGG - Intronic
1077924422 11:6666684-6666706 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1078108192 11:8371826-8371848 AAGGAGGAAGGAAGGGTGGGAGG - Intergenic
1078395413 11:10977080-10977102 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1078484005 11:11705345-11705367 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1079425113 11:20333050-20333072 GAGCAGGGTGGAGAGGTGTGTGG - Intergenic
1080043683 11:27785894-27785916 AATCGGGGGGGGGGGGTGGGTGG + Intergenic
1080504135 11:32895331-32895353 AAGCAGGCTGGCGGGGGAGGGGG - Intronic
1080556393 11:33421235-33421257 AAGAAAGGGGGATGGGTGGGTGG + Intergenic
1080877151 11:36286448-36286470 AATCAGCCTGGAGGGGTGGTGGG + Intronic
1080927859 11:36776953-36776975 AAGCATGGCAGTGGGGTGGGGGG + Intergenic
1081301541 11:41458536-41458558 AAGCGTGGTGGGGGGGAGGGGGG + Intronic
1081626487 11:44659036-44659058 AGGAAGCATGGAGGGGTGGGTGG + Intergenic
1081675125 11:44964157-44964179 AGGCAGAGTGGAGGGGAGGGAGG - Intergenic
1081883780 11:46477154-46477176 GAGAAAGGTGGAAGGGTGGGAGG + Intronic
1081906626 11:46674425-46674447 AAGTAGGTTGGAGAGGTTGGAGG - Intronic
1081910174 11:46695330-46695352 CATTAGGGTGGAGGGGTAGGAGG + Intronic
1082079405 11:48000575-48000597 TCGGAGGGTGGAGGGGAGGGAGG - Intronic
1082807535 11:57460370-57460392 AAGCGGGGGGGAGGGGGGCGGGG + Intergenic
1082928879 11:58579132-58579154 GAGCCGGGCGGAGGGGAGGGGGG + Exonic
1083190533 11:61048730-61048752 AGCCAGGAGGGAGGGGTGGGGGG - Intergenic
1083224590 11:61276866-61276888 AAGGAGAGAGGAGGGATGGGGGG + Intronic
1083243818 11:61410090-61410112 AGGTAGGGAGGAGGGGCGGGTGG - Intronic
1083247633 11:61441870-61441892 AAAAAGGGAGGAGTGGTGGGGGG - Intronic
1083296599 11:61718612-61718634 GAGCATGGTGGTGGGGTGGCTGG - Intronic
1083409150 11:62480018-62480040 AATCAGGGGTGAGGGGTGTGAGG - Intronic
1083436528 11:62647135-62647157 AGGGAGGGTGGAGGTGAGGGTGG - Exonic
1083619338 11:64041335-64041357 ACGGGGGGTGGAGGGGTGGGGGG - Intronic
1083637043 11:64126356-64126378 ACGGAGGGTGGAGTGGTGTGTGG + Intronic
1083721606 11:64606440-64606462 GAGCAGGGGTGGGGGGTGGGAGG - Exonic
1083740180 11:64705774-64705796 AAGTTTGGTGGAGGGGTGAGAGG - Intronic
1083855735 11:65392207-65392229 AGGCTGGATGCAGGGGTGGGTGG + Intronic
1083913055 11:65721034-65721056 AGGCAGGGAGGAGGGGGAGGGGG - Intergenic
1084230698 11:67750643-67750665 AAATGGGGTGGACGGGTGGGGGG - Intergenic
1084286972 11:68138143-68138165 AAGCAGGCTGGAGGGGAAGGAGG + Intergenic
1084400081 11:68938381-68938403 AAACAGTGGGGAGGGGTGGTGGG + Intronic
1084448871 11:69220826-69220848 AGGCAGGGTGGAGGCCAGGGTGG - Intergenic
1084590411 11:70086802-70086824 GAGTAGGGTGAAGGGGAGGGAGG - Intronic
1084599668 11:70137411-70137433 ATGGCGGGTGGGGGGGTGGGGGG - Intronic
1084713561 11:70859387-70859409 AAGATGGGTAGATGGGTGGGTGG + Intronic
1084758482 11:71253139-71253161 AAGCCAGGGGGTGGGGTGGGGGG + Intergenic
1084785750 11:71440716-71440738 TAGGGGGGTGGATGGGTGGGTGG + Intronic
1084844548 11:71888855-71888877 GAGCAAGGTGGCGGGGTGGAGGG - Intronic
1084904472 11:72335122-72335144 AAGTAGTGTGGGGGGGTGGGTGG + Intronic
1084928683 11:72535946-72535968 AAGGAGGGTGGAAGGGAGGAAGG + Intergenic
1085026871 11:73241497-73241519 GAGCAGGGAGCATGGGTGGGAGG - Intergenic
1085051243 11:73381395-73381417 CAGCAGGCTGGTGGTGTGGGTGG - Intronic
1085248992 11:75129302-75129324 AGGCAAGGTGGAGGGGAGGAGGG + Intronic
1085276541 11:75303698-75303720 AAGCACAGTGGGAGGGTGGGAGG + Intronic
1085299525 11:75450093-75450115 GAGCAGGGCAGAGGGGAGGGAGG + Intronic
1085329849 11:75639140-75639162 CAGAAGGGTGGCAGGGTGGGAGG + Intronic
1085427288 11:76415843-76415865 AGGCAGGGAGAGGGGGTGGGTGG - Intergenic
1085509932 11:77083063-77083085 AGGCAGGGAGAATGGGTGGGAGG + Intronic
1085527052 11:77170376-77170398 AAGGAGGCTGGAGGGGCTGGAGG + Intronic
1085777872 11:79382646-79382668 AAGCAGGGAGAAGGGATGGAGGG + Intronic
1086847687 11:91772639-91772661 AAGTGGGGTGGGGGGGAGGGTGG - Intergenic
1087138685 11:94744563-94744585 TGGCAGGGTGGAGGGGTAGTAGG + Intronic
1087410759 11:97787694-97787716 TGGAAGGGTGGAGGGGAGGGAGG - Intergenic
1087666319 11:101053504-101053526 AAGGAGGGAGAAGGGGAGGGAGG - Intronic
1088098986 11:106132922-106132944 AAGGAAGGTGGAAGGGTGGAGGG + Intergenic
1088136298 11:106559822-106559844 AGGATGGGTGGAGGGTTGGGGGG - Intergenic
1088248277 11:107840199-107840221 AAGGTGGGTGCTGGGGTGGGAGG + Intronic
1088600114 11:111466588-111466610 CAGGAGGATGGATGGGTGGGTGG + Intergenic
1088645176 11:111912060-111912082 AAGCAGGCACGCGGGGTGGGGGG + Intronic
1088716378 11:112553310-112553332 AAGCAGGGGGGAAGAGGGGGCGG + Intergenic
1088883946 11:113992802-113992824 AAGCTGGGGGGAGGTGGGGGAGG - Intergenic
1089125828 11:116175844-116175866 AGGGAGGGAGGAGGGGAGGGAGG - Intergenic
1089517341 11:119041648-119041670 AAAAAGGGTGGGGAGGTGGGGGG - Intergenic
1089563388 11:119357116-119357138 GGGGAGGGTGGAGGAGTGGGGGG + Intronic
1089593090 11:119557399-119557421 ACAGAGGGTGGAGAGGTGGGAGG + Intergenic
1089597455 11:119589883-119589905 AAGGAGGGTGGAGGAGGGGCAGG + Intergenic
1089682320 11:120125560-120125582 AGGAAGGGTGGGTGGGTGGGTGG + Intronic
1089869199 11:121657201-121657223 AGGCAGGGGGAAGGGGTGTGGGG - Intergenic
1089956303 11:122574504-122574526 AAGCAGGCAGGATGGGTTGGAGG - Intergenic
1089988768 11:122838006-122838028 AAGATGGGTGGATGGGTGGGTGG + Intergenic
1090073279 11:123562222-123562244 AAGCAGGGAGGGGGTGTGGGAGG - Intronic
1090252663 11:125262602-125262624 AGGGAGGGAGGAAGGGTGGGAGG - Intronic
1090514983 11:127415575-127415597 AAGAAGGGTGGGGGGTTGGGGGG - Intergenic
1090931543 11:131302003-131302025 AAACAGGGTTGTGGGTTGGGTGG + Intergenic
1091168743 11:133502326-133502348 AGGCAGGGTGGCAGGGTGGCTGG + Intronic
1091187328 11:133658370-133658392 TAGAAGGGTGGATGGATGGGAGG + Intergenic
1091187339 11:133658398-133658420 TGGAAGGGTGGATGGGTGGGTGG + Intergenic
1091240340 11:134047778-134047800 TAGGAGGGTGGATGGGTGGGAGG - Intergenic
1202821179 11_KI270721v1_random:69857-69879 AAACAGGGCGAGGGGGTGGGTGG - Intergenic
1202822244 11_KI270721v1_random:73904-73926 AAGCAGAGGTGAGGGGTGGCAGG - Intergenic
1091703570 12:2679417-2679439 AGGCAAGAAGGAGGGGTGGGTGG - Intronic
1091752334 12:3030801-3030823 TAGCAGGGAGGAGTGCTGGGTGG + Intronic
1091966012 12:4742598-4742620 AAGCACGGTGTGGGGGTGTGGGG + Intronic
1091986185 12:4911351-4911373 AAGCCGGGCGCGGGGGTGGGAGG - Exonic
1092047802 12:5444628-5444650 CAGTATGGTGGAGAGGTGGGCGG + Intronic
1092134662 12:6138337-6138359 AAGCGGGGGTGAAGGGTGGGAGG - Intergenic
1092157702 12:6295170-6295192 CAGCAGGGTTGGGGGGTGGGGGG - Intergenic
1092169509 12:6364215-6364237 GAGGAGGGAGGCGGGGTGGGTGG - Intronic
1092298202 12:7219336-7219358 AGGAAGGGTAGTGGGGTGGGTGG - Intergenic
1092460467 12:8681613-8681635 AAGCAGGCTGGAGAGGGGGCTGG + Intronic
1092843243 12:12562558-12562580 AGGCGGGGGGGTGGGGTGGGGGG + Intergenic
1093693044 12:22128744-22128766 AAGTAGGGTTGAGAGCTGGGAGG + Intronic
1094166884 12:27452341-27452363 CAGGAGGGTGAAGGAGTGGGAGG - Intergenic
1094299654 12:28948496-28948518 AAGCAGAGTGGTGGGGTGCTTGG - Intergenic
1094388180 12:29918172-29918194 AAGCAAGGAGGAAGGGAGGGAGG + Intergenic
1094565926 12:31598363-31598385 AAGCAAGGTGGCGGGGGTGGGGG + Intergenic
1094615099 12:32029314-32029336 AGGCAGGGAGGAAGGGAGGGAGG + Intergenic
1095409805 12:41909271-41909293 ACGCGGGGTGGGGTGGTGGGGGG - Intergenic
1095884798 12:47177599-47177621 CAGCCTGGTGGTGGGGTGGGGGG + Intronic
1095954217 12:47797298-47797320 GAGGAGTGTGCAGGGGTGGGCGG - Intronic
1096114708 12:49049062-49049084 AAGCATGGTTGGGGGATGGGAGG + Intronic
1096215633 12:49796280-49796302 TAGCAGGGTGAAGGGCTGGTGGG + Exonic
1096385930 12:51195568-51195590 GTGCAGAGTGGAGGGGTGGAGGG + Intronic
1096514527 12:52148657-52148679 AAGCAGGGTGGTGCAGGGGGTGG - Intergenic
1096608838 12:52787922-52787944 GAGGTGAGTGGAGGGGTGGGAGG - Intergenic
1096625489 12:52892881-52892903 AGGCAGGGTGGAGGGAAGTGGGG + Intergenic
1096972745 12:55681083-55681105 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1096977177 12:55706207-55706229 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
1097019196 12:56007819-56007841 AAGGAGGGGGGAGACGTGGGCGG + Intronic
1097173160 12:57128601-57128623 AGGCGGGGAGGGGGGGTGGGGGG - Exonic
1097241064 12:57575535-57575557 TAGCAGGAGGGAGGGCTGGGAGG + Intronic
1097320840 12:58224389-58224411 CAGAAGCCTGGAGGGGTGGGGGG - Intergenic
1097712771 12:62934254-62934276 ATGGGTGGTGGAGGGGTGGGTGG - Intronic
1097755046 12:63399474-63399496 CACAAGGGTGGGGGGGTGGGGGG + Intergenic
1097914767 12:65009170-65009192 AAGCAGTGAAGAGGGGAGGGAGG - Intergenic
1098470122 12:70833352-70833374 AGGTAGGCTGGAGTGGTGGGTGG + Intronic
1099711552 12:86232150-86232172 AAGGAGGGGGGCGGGTTGGGGGG + Intronic
1099927649 12:89037761-89037783 AACCAGGGTGAAGAGGTGGGAGG - Intergenic
1099956193 12:89353993-89354015 AAGCCGGATGGAGGCGTGGCCGG + Intergenic
1099974314 12:89530389-89530411 ATGCAGGGTGGACAGGTGGAGGG - Intergenic
1100090220 12:90958836-90958858 ACGCCGTGTGGAGGGGTTGGGGG + Intergenic
1100243946 12:92737726-92737748 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
1100293208 12:93236593-93236615 AAGCAGGGTGGGGTGGAGGTAGG - Intergenic
1100329199 12:93569785-93569807 GAGGAAGGGGGAGGGGTGGGAGG - Intergenic
1100385570 12:94102071-94102093 CAGCAGTGAGGAGGCGTGGGCGG - Intergenic
1100403155 12:94249922-94249944 CACCAGTGTGGGGGGGTGGGGGG + Intronic
1100885804 12:99068680-99068702 ATGCAGGTGGGAGGGGTGGGGGG + Intronic
1100966519 12:100019180-100019202 AAGCAGGCTGGAGGGGAAGGAGG + Intergenic
1101027179 12:100621850-100621872 ATGAAGGGTGGTGGGGAGGGAGG + Intronic
1101432066 12:104634939-104634961 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
1101709227 12:107249335-107249357 AAGCAGCGAGGAGGGCTGTGTGG - Intergenic
1101960905 12:109249187-109249209 AAGCAGGCTGGAGGGGAAAGAGG + Intronic
1101973587 12:109335301-109335323 GAGCAGGGAGCAGGTGTGGGGGG + Intergenic
1102019338 12:109670822-109670844 AAGGAGGGTGGGGCGCTGGGCGG - Intergenic
1102120243 12:110434649-110434671 ATACTGGGAGGAGGGGTGGGAGG + Intergenic
1102168523 12:110824642-110824664 AAGAAGGATGGAAGGGAGGGAGG + Intergenic
1102316876 12:111895521-111895543 CAGCAGGGTGGGGGGTGGGGGGG - Intronic
1102479121 12:113208721-113208743 AAGAAGGGTGGCGGTGGGGGAGG + Intronic
1102634929 12:114314730-114314752 AAGCAGGGTTGAGGTGTGACAGG - Intergenic
1102679211 12:114679219-114679241 AAGAGGGGGGGAGGAGTGGGTGG + Intronic
1102838229 12:116088147-116088169 AAGGGGGGTGGAGGGGTAGGTGG - Intronic
1102920629 12:116789111-116789133 AAGGAGAGTGGATGGGTGGATGG + Intronic
1102920792 12:116789811-116789833 AAGGAGAGTGGATGGGTGGATGG + Intronic
1102920825 12:116789941-116789963 ATGGATGGTGGATGGGTGGGTGG + Intronic
1103056584 12:117825948-117825970 CAGGTGGGTGGATGGGTGGGTGG + Intronic
1103056597 12:117825984-117826006 CAGGTGGGTGGATGGGTGGGTGG + Intronic
1103068567 12:117920782-117920804 CAACAGGGTGGAGGGGAGGAAGG + Intronic
1103245122 12:119450254-119450276 AGGAAGGGTGGGAGGGTGGGAGG + Intronic
1103255933 12:119541321-119541343 CAGATGGGTGGATGGGTGGGTGG + Intergenic
1103846393 12:123904506-123904528 ATCCAAGGTGGAGGAGTGGGGGG + Intronic
1103908428 12:124339221-124339243 TAGCTGGGTGGGTGGGTGGGTGG - Intronic
1103908488 12:124339477-124339499 TAGCTGGGTGGATGGATGGGTGG - Intronic
1103956157 12:124578008-124578030 AGGCAGGGAGGCCGGGTGGGAGG + Intergenic
1103964049 12:124626720-124626742 GAGCAGGGTAGGGGGTTGGGTGG + Intergenic
1103976677 12:124707242-124707264 AAGGAGGGAGGAAGGGTAGGAGG + Intergenic
1103987017 12:124774174-124774196 CTGTAGAGTGGAGGGGTGGGGGG - Intergenic
1103987677 12:124778512-124778534 AAGCGGGGTGTAGGGGCTGGGGG + Exonic
1104092305 12:125526974-125526996 TAGAAGGGTGGATGGGTGGTTGG - Intronic
1104192286 12:126493612-126493634 AAACAGGGTGGAGGAGGGGTGGG + Intergenic
1104437196 12:128765753-128765775 AAGGAGGGTGGAGTGGCTGGGGG - Intergenic
1104508546 12:129355416-129355438 GGGTAAGGTGGAGGGGTGGGTGG + Intronic
1104841302 12:131827350-131827372 AAGCGGGGGGGGGGGGGGGGGGG + Intergenic
1104896092 12:132164556-132164578 TGGCTGGGTGGATGGGTGGGTGG - Intergenic
1104954645 12:132458122-132458144 CAGGTGGGTGGACGGGTGGGTGG + Intergenic
1105074272 12:133261980-133262002 GAGCAGGGTGGAAGGTAGGGAGG - Intergenic
1105344809 13:19561899-19561921 CAGCAGGGAGGAGGGCAGGGCGG - Intergenic
1106257257 13:28032727-28032749 GAGAAGGGCAGAGGGGTGGGAGG + Intronic
1106358278 13:29005520-29005542 AAGCAGGGTGGAGAGGAGTCGGG + Intronic
1107741407 13:43454223-43454245 AAGCAGGAAGGAGGAGTGGTAGG - Intronic
1107835841 13:44411908-44411930 AGGGAGGGGGGAGGGGAGGGAGG + Intergenic
1107918040 13:45172879-45172901 AAGAAAGGTGGAGGGTTGGAGGG - Intronic
1108035973 13:46291038-46291060 AAGCAGGGGTGAGGCATGGGAGG - Intergenic
1108825400 13:54407407-54407429 ATACATGGTGGAGGGGAGGGAGG + Intergenic
1109693805 13:65927478-65927500 ATGCAGGGTGGAGGGGTCATGGG + Intergenic
1110015281 13:70392473-70392495 AAGCAGGGTGGTGGGATAGAAGG - Intergenic
1110067332 13:71125077-71125099 TAGCAGGGTGTGGTGGTGGGTGG + Intergenic
1110384582 13:74893994-74894016 TGTCAGGGTGGAGGGATGGGAGG - Intergenic
1110717390 13:78721569-78721591 AAGCAGGGTGCATGGGCTGGAGG - Intergenic
1110843979 13:80173153-80173175 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1110879379 13:80552594-80552616 AAGGAGGGTGGGAGGGAGGGAGG + Intergenic
1112287157 13:98114326-98114348 AAGCTGGGTGGGGGAGTGCGGGG + Intergenic
1112343979 13:98576204-98576226 AGGCAGGGTGGAGTGGAGGAAGG - Intronic
1112357068 13:98682441-98682463 TAGCCAGGTGGAGGGGTTGGGGG + Intergenic
1112441457 13:99427213-99427235 AGGGAGGATGGAGGGGAGGGTGG + Intergenic
1112559605 13:100501362-100501384 CAGAAGGGTGACGGGGTGGGAGG - Intronic
1112666989 13:101586182-101586204 AAACAGGGAAGAGGGGTTGGAGG - Intronic
1113044890 13:106145418-106145440 AAGCAGGCCCAAGGGGTGGGAGG - Intergenic
1113287384 13:108867023-108867045 AAGATGGGTGGAGGGTGGGGTGG - Intronic
1113481527 13:110625460-110625482 CGGCGGGGTGGAGAGGTGGGTGG + Intronic
1113541019 13:111109566-111109588 AGGAAGGGTGGAGGGGAGCGAGG + Intergenic
1113632768 13:111899371-111899393 CAGCAGTGGGGCGGGGTGGGGGG - Intergenic
1113909594 13:113835890-113835912 CTGCTTGGTGGAGGGGTGGGGGG + Intronic
1113923423 13:113927397-113927419 AAAGAGGGTGGAGAGGGGGGAGG - Intergenic
1113945627 13:114042622-114042644 AGGCAGGGTGGCCGGGTAGGAGG - Intronic
1113992158 14:16036160-16036182 CAGCTGGGTGGAGGGTGGGGTGG - Intergenic
1114260817 14:21034833-21034855 AAGAGGGTTGGATGGGTGGGAGG + Intronic
1114265461 14:21070523-21070545 AAGAAGGGGGGATGGGAGGGAGG - Intronic
1114664527 14:24369868-24369890 AAGCAGGGGGCCAGGGTGGGGGG + Exonic
1115490012 14:33950228-33950250 GAGCTGGGGCGAGGGGTGGGGGG + Intronic
1115508816 14:34119762-34119784 AAGCAGGCTGAAGGGAAGGGGGG + Intronic
1115658294 14:35465248-35465270 AAGCAGGAAGGAGGTGGGGGAGG - Intergenic
1115739095 14:36368503-36368525 AAGCAGTGTGGTGGGGGTGGGGG + Intergenic
1115962521 14:38851764-38851786 AAGCAGGGGGGTGGGGTGGGGGG - Intergenic
1116147733 14:41097586-41097608 AAGCAGGGAGGGAGGGAGGGAGG + Intergenic
1116950694 14:50875951-50875973 AGGCAGGGTGGAGGTGAGTGAGG + Intronic
1116985373 14:51213766-51213788 TTGTAGGGTGGAGGGGAGGGGGG - Intergenic
1117145571 14:52833851-52833873 CGGCAGGGGGGAGGGGTGGGGGG - Intergenic
1117196114 14:53341587-53341609 AAGCAAGGTGGAGGGAGTGGAGG + Intergenic
1117502483 14:56367315-56367337 AAGAAGGGAGGAAGGTTGGGAGG - Intergenic
1117575700 14:57094962-57094984 AAACATGGTGGAAGGGTGGAAGG + Intergenic
1117907572 14:60606032-60606054 AAGCAGCTGGGAGGGGTTGGGGG + Intergenic
1117908164 14:60611724-60611746 AAGCAGCTGGGAGGGGTTGGGGG - Intergenic
1118051199 14:62030052-62030074 AAGAAGGTGGGAGGGATGGGTGG - Intronic
1118349496 14:64963525-64963547 AAGGAGGCTGGAGGAGTGAGTGG - Intronic
1118391261 14:65297812-65297834 AAGCAGAGTAGAGGAGGGGGAGG - Intergenic
1118408377 14:65450849-65450871 AAATAGGGTGGAAGGGTGGTAGG - Intronic
1118427019 14:65676594-65676616 AAGAAGGAAGGAGGGGTGGGGGG - Intronic
1118473603 14:66097172-66097194 CAGAAGAGTGGCGGGGTGGGGGG + Intergenic
1118503751 14:66388641-66388663 CAGCAGGATGGAGGTGGGGGAGG + Intergenic
1118555834 14:67019989-67020011 AAGTGGGGTGGAGGGTGGGGAGG + Intronic
1118772671 14:68952594-68952616 CAGCAGGGATGGGGGGTGGGCGG - Intronic
1119087316 14:71750333-71750355 AATCAGAGGGGAGGGGTGGGAGG - Intergenic
1119184867 14:72632914-72632936 AAGAATTGTTGAGGGGTGGGAGG + Intronic
1119358322 14:74025889-74025911 AGGCTGAGTGGCGGGGTGGGGGG + Intronic
1119382753 14:74239497-74239519 AAGCCCGGCGGGGGGGTGGGGGG + Exonic
1119416852 14:74476720-74476742 AAAAGGGGTGGAGGGGAGGGTGG - Intronic
1119431217 14:74569173-74569195 AAGCAGGGAGGGAGGGAGGGAGG + Intronic
1119779769 14:77270264-77270286 CCGCAGGGGAGAGGGGTGGGGGG - Intronic
1119806633 14:77486458-77486480 CAGCAGGGTGGATGAGTGGAAGG + Intronic
1119889388 14:78171646-78171668 AAGAAGGGATGGGGGGTGGGGGG - Intergenic
1119898132 14:78238142-78238164 GGGCAGGGTGGTGTGGTGGGGGG - Intergenic
1119943645 14:78668496-78668518 AACTAGGGTGGAGGAGTGGTTGG + Intronic
1120493746 14:85207839-85207861 GACAAGGGTGGAGGGGTGGGAGG + Intergenic
1120926158 14:89799656-89799678 AGTCAGGGTTGGGGGGTGGGAGG - Intronic
1121085106 14:91139901-91139923 AAGCAGGATGGAGGGGGAAGAGG + Intronic
1121099725 14:91242262-91242284 ATGGATGGTGGAGAGGTGGGAGG + Intronic
1121183661 14:91947994-91948016 GAGCAGCGGGGTGGGGTGGGGGG + Intergenic
1121332549 14:93058489-93058511 AGGCAGGGTGGAGGGGGTGCGGG + Intronic
1121332584 14:93058597-93058619 AGGCAGGGTGGAGGGGGTGCGGG + Intronic
1121332841 14:93059327-93059349 AAGCAGGGGGGAGGGGGTGCGGG + Intronic
1121630044 14:95415278-95415300 TGGCAGGGTGGGTGGGTGGGGGG - Intronic
1121708336 14:96018012-96018034 ATGCAGGATGGATGGGTGGATGG + Intergenic
1121720842 14:96107660-96107682 CAGCAGGGTGCAGGGGAGTGTGG - Intergenic
1121800148 14:96768493-96768515 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1121843859 14:97156258-97156280 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1121850596 14:97218603-97218625 AAGGCTGGTGGGGGGGTGGGGGG + Intergenic
1122114813 14:99522360-99522382 AAGCGGTGTGGAGGGGAGGGTGG - Intronic
1122126448 14:99581115-99581137 AAGCAAAGAGGAGGAGTGGGAGG + Intronic
1122227783 14:100289980-100290002 GAGCAAGGTGAAGGGGCGGGGGG - Intergenic
1122281824 14:100628049-100628071 ACACGGGGTGGTGGGGTGGGTGG + Intergenic
1122286097 14:100653780-100653802 AAGCAGGGTGGAGGCGACAGCGG + Intergenic
1122300979 14:100730968-100730990 AGGCAGGCTGGAGGGGGTGGGGG - Intronic
1122393543 14:101407133-101407155 AGGCAGGCTGGAGGCCTGGGAGG - Intergenic
1122488615 14:102097941-102097963 TAGCCGGGTGCTGGGGTGGGAGG - Intronic
1122625489 14:103083518-103083540 AAGCAGGGGGGGGGGGGGGGAGG - Intergenic
1122782501 14:104149599-104149621 AAGCTGGGTGGGGGCTTGGGTGG + Intronic
1122923586 14:104889995-104890017 TAGGAGGGTGGGTGGGTGGGTGG + Intronic
1122958309 14:105083060-105083082 ATGGATGATGGAGGGGTGGGTGG - Intergenic
1122958331 14:105083141-105083163 ATGGATGATGGAGGGGTGGGCGG - Intergenic
1122958357 14:105083230-105083252 ATGGAGGATGGAGGGTTGGGTGG - Intergenic
1122958440 14:105083532-105083554 ATGGAAGATGGAGGGGTGGGTGG - Intergenic
1122958507 14:105083775-105083797 AGGGAGGATGGAGGGGTGGGTGG - Intergenic
1122986126 14:105212480-105212502 ACTCAGGGAGGAGGGGAGGGAGG + Intronic
1123456338 15:20429833-20429855 AAGGAGGATGGTGGGGTGGGCGG + Intergenic
1123630931 15:22259000-22259022 GTGCAGGCTGGAGGCGTGGGTGG - Intergenic
1123661728 15:22570524-22570546 AAGGAGGATGGTGGGGTGGGCGG - Intergenic
1124216721 15:27813305-27813327 CAGGAGGGTGGAGGGGAGAGAGG - Intronic
1124262482 15:28205014-28205036 AAGGAGGACGGTGGGGTGGGCGG + Intronic
1124315525 15:28664757-28664779 AAGGAGGACGGTGGGGTGGGCGG - Intergenic
1124606231 15:31172144-31172166 AAGCTGGGTGGGTGGGTGAGGGG + Intergenic
1124657827 15:31523281-31523303 AGGCAGGGAGGAGGGGCAGGAGG + Intronic
1124759890 15:32440234-32440256 ATGCTTGGTGGGGGGGTGGGGGG - Intergenic
1124856135 15:33391137-33391159 AAGCAGAGTGGTGGGGCTGGAGG - Intronic
1125003656 15:34795609-34795631 CAGCCGGGGGCAGGGGTGGGGGG + Exonic
1125448667 15:39784952-39784974 AAGCAGGGTTGAGGGGACAGAGG - Intergenic
1126836231 15:52668785-52668807 AAGTAGGTGGGATGGGTGGGTGG - Intronic
1126897503 15:53274940-53274962 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1127038151 15:54942693-54942715 AAGCAGGCTGGAGGGGAAAGAGG - Intergenic
1127357350 15:58213216-58213238 AATGAGGGGAGAGGGGTGGGTGG - Intronic
1127659288 15:61085020-61085042 AGGGAGTGAGGAGGGGTGGGAGG - Intronic
1127694053 15:61426705-61426727 AAGCAGGAAGTTGGGGTGGGAGG + Intergenic
1127704164 15:61530887-61530909 AGGCAGAGTTGAGGGGGGGGGGG - Intergenic
1127919029 15:63478642-63478664 AACCAAGGTGGAGAGATGGGAGG - Intergenic
1128063350 15:64748842-64748864 AGGCAGGCTGCAGGGGAGGGAGG + Intronic
1128607909 15:69051053-69051075 ATGCAGGGAGGAGGGGAGGCAGG - Intronic
1128620107 15:69141658-69141680 TGGCAGGGTGGGGGGGTGGGGGG - Intergenic
1128636918 15:69308542-69308564 AAGCAGGGAGGGGGTGTGTGTGG - Intronic
1128672656 15:69586177-69586199 AACCAGGGGGAAGGGGAGGGAGG - Intergenic
1128680339 15:69646998-69647020 AGGCAGGCTGTGGGGGTGGGAGG - Intergenic
1128769974 15:70274744-70274766 ATGATGGGAGGAGGGGTGGGTGG - Intergenic
1128880411 15:71237156-71237178 ATGCAGAGAGAAGGGGTGGGTGG + Intronic
1129232444 15:74204270-74204292 AAGGCAGGAGGAGGGGTGGGAGG - Intronic
1129281681 15:74490045-74490067 GAGGAGGGTGGGGGTGTGGGGGG - Intergenic
1129301143 15:74626246-74626268 AAGCAGGGAGGCAGGGTTGGTGG - Intronic
1129460073 15:75696175-75696197 CAGGAGGGGGAAGGGGTGGGAGG - Intronic
1129698506 15:77754269-77754291 AAGAAGTGTGGAGGGAAGGGAGG + Intronic
1129782541 15:78282535-78282557 AAGCAGGAGGGAGAAGTGGGGGG + Intronic
1129787803 15:78320931-78320953 AAATAGGGATGAGGGGTGGGAGG + Intergenic
1129875095 15:78969732-78969754 AAGCAGGGGAGAGGAATGGGAGG - Intronic
1129901879 15:79157657-79157679 CAGTGGGGTGGAGGGGTGGGGGG + Intergenic
1130392715 15:83473220-83473242 AAGGTGGGTGGGGGGGTGGGTGG + Intronic
1130546752 15:84862526-84862548 CAGCAGGTTGGCAGGGTGGGAGG + Intronic
1130758990 15:86797730-86797752 AAGCATGGGGCAGGGGTGGTGGG + Intronic
1130923081 15:88365386-88365408 AGGGAGGGCAGAGGGGTGGGGGG + Intergenic
1131008731 15:88999791-88999813 AAGCAGGCTGGAGGGGAAAGGGG + Intergenic
1131288136 15:91080393-91080415 AAGCAGGGTGGAGCGGGAGGGGG - Intergenic
1131288249 15:91081151-91081173 AGGCAGGGAGGGAGGGTGGGAGG - Intergenic
1131588561 15:93722499-93722521 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1131620786 15:94065907-94065929 AAAAAAGGTGGGGGGGTGGGGGG + Intergenic
1131967754 15:97862604-97862626 AGGGAGGGTGAAGGGTTGGGTGG - Intergenic
1132055426 15:98648120-98648142 CAGGAGAGGGGAGGGGTGGGCGG - Intergenic
1132180721 15:99750765-99750787 AAGCAGGCAGGAGGGGAAGGAGG - Intergenic
1132211323 15:100024791-100024813 AAGCAGGGGAGTGGGGTGGAGGG - Intronic
1132512095 16:348392-348414 CAGCAGTGTGGAGTGGTGGCTGG - Intronic
1132561224 16:595140-595162 CAGCAGGGTGGTGTTGTGGGAGG + Intronic
1132609538 16:808350-808372 AAGGAGGGGCGGGGGGTGGGGGG + Intronic
1132618408 16:853269-853291 AGGCAGGGGGAAGGGGTGGGTGG + Intergenic
1132757757 16:1494140-1494162 GACCAGGGTTGAGGGGTGTGGGG + Intronic
1132786546 16:1660036-1660058 GAGCAGGGTGCAGAGCTGGGCGG - Exonic
1132867475 16:2100572-2100594 AGGCAAGAGGGAGGGGTGGGAGG + Intronic
1133035236 16:3030633-3030655 AAGCCGGGCTGAGGGCTGGGAGG - Intronic
1133057196 16:3151311-3151333 TAGTAGGGTGGGGGGGTGGGCGG + Intergenic
1133069391 16:3235568-3235590 TAGGGGGGTGGCGGGGTGGGGGG - Intronic
1133158453 16:3892514-3892536 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1133172893 16:3992715-3992737 GAGCAGGGTGCATGGGTCGGGGG + Intronic
1133220874 16:4318685-4318707 AAGGAGGGTGGAGGGGAGAGTGG - Intronic
1133279328 16:4656104-4656126 AAGCAGGGCGGTGGGGTGGAGGG + Intronic
1133323705 16:4930745-4930767 AAGCAGTGAAAAGGGGTGGGAGG + Intronic
1133421767 16:5652615-5652637 AAGCCGGGTGGGTGAGTGGGTGG - Intergenic
1133739481 16:8640631-8640653 AAGATGGGTGGATGGGAGGGAGG + Intronic
1133739508 16:8640707-8640729 AAGATGGGTGGGGGGGTGGGTGG + Intronic
1133909989 16:10057000-10057022 TAGAAGGCTGGAGGGGTGGAGGG - Intronic
1134106125 16:11486869-11486891 ATGATGGGTGGGGGGGTGGGGGG + Intronic
1134201074 16:12199521-12199543 CAGGAGGGGGCAGGGGTGGGTGG - Intronic
1134566160 16:15253553-15253575 AAACTGGGAGGAGGGGTGGGTGG + Intergenic
1134736333 16:16503145-16503167 AAACTGGGAGGAGGGGTGGGTGG - Intergenic
1134909985 16:18016953-18016975 TGGAAGGGTGGAAGGGTGGGAGG + Intergenic
1134931182 16:18209022-18209044 GAACTGGGAGGAGGGGTGGGTGG + Intergenic
1135049327 16:19179755-19179777 AAGGAGGATGTAGGGGTGGATGG - Intronic
1135050023 16:19185169-19185191 AAGAGGGGAGGAGGGGAGGGAGG - Intronic
1135118833 16:19747635-19747657 CGGAAGGGTGAAGGGGTGGGAGG - Intronic
1135302860 16:21345807-21345829 AAGGAGGGGGGAGGGGAGGAGGG - Intergenic
1135904170 16:26495509-26495531 CAGAAGGGTGAAGGGATGGGAGG + Intergenic
1136074480 16:27807376-27807398 ATGCAGGGTGCAGTGGGGGGTGG + Intronic
1136176947 16:28523758-28523780 AGGCAGGGAGTCGGGGTGGGAGG - Intergenic
1136285537 16:29238353-29238375 AGGGAGGGAGGAGAGGTGGGAGG + Intergenic
1136343888 16:29663172-29663194 GGGCAGGATGGAGGGGTGGGTGG + Intronic
1136369861 16:29829657-29829679 AAGCAGGTGGGATGGGTGGGTGG + Intronic
1136417323 16:30112103-30112125 GAGGACGGGGGAGGGGTGGGGGG + Intronic
1136454057 16:30370408-30370430 AAGCAGGAGGGAGGGGGCGGTGG - Intergenic
1136546588 16:30958217-30958239 AATCCGGGCGGGGGGGTGGGGGG - Intronic
1137044613 16:35643563-35643585 GAGCATGGTGAAGTGGTGGGGGG + Intergenic
1137558762 16:49489825-49489847 CAGCATGATGGAGGTGTGGGAGG + Exonic
1137579975 16:49627762-49627784 TAGATGGGTGGATGGGTGGGTGG - Intronic
1137693122 16:50442843-50442865 AAGCGGGGGGGGGGGGGGGGGGG + Intergenic
1138168041 16:54820921-54820943 CTGCTGGCTGGAGGGGTGGGTGG + Intergenic
1138194900 16:55044818-55044840 AAAAAGGGTGGAGAGGCGGGTGG - Intergenic
1138219912 16:55241745-55241767 AAGCAGGATGGGGAGGTGGTGGG + Intergenic
1138287650 16:55822479-55822501 AAGCTGAGTGGAGGCGTGGTGGG + Intronic
1138356376 16:56384229-56384251 AGGCAGTGTGGTGGAGTGGGTGG - Intronic
1138383211 16:56617870-56617892 AAGCAGGGTGGGTGGGAGGCAGG + Intergenic
1138458826 16:57136013-57136035 AGGGAGGGAGGAGGGGAGGGAGG + Intronic
1138544209 16:57706367-57706389 TAGGAGGGTGGATGGATGGGAGG - Intronic
1138544318 16:57706725-57706747 TAGGAGGGTGGATGGATGGGAGG - Intronic
1138619501 16:58199481-58199503 AGGTGGGGTGGAGGGGTTGGGGG - Intergenic
1138654207 16:58481476-58481498 ATGCAGGGTGGTGGTGTGGTTGG + Intronic
1138663573 16:58542578-58542600 GAGGTGGGTGGGGGGGTGGGGGG + Intronic
1139210040 16:65068041-65068063 AAGAAGGGAGGAAGGGAGGGAGG + Intronic
1139494730 16:67308130-67308152 AAGGAGGGAGGATGGGAGGGAGG - Intronic
1139542873 16:67631674-67631696 AAAAAGGGGGGGGGGGTGGGGGG - Intronic
1139583229 16:67885401-67885423 GGACAGGGTGGAGGGGAGGGAGG - Intronic
1139701557 16:68710967-68710989 AAGGAGGGGGGAGGGGGGAGGGG + Intronic
1139837272 16:69849218-69849240 TAGCAGGGAGGAGGGGTGGAGGG + Intronic
1139964437 16:70737635-70737657 ACCCAGGCTGGCGGGGTGGGCGG + Intronic
1140056708 16:71531675-71531697 AAGCAGGATGGAGGGAGGGAGGG + Intronic
1140067728 16:71625511-71625533 ATGGAGGGTGGGTGGGTGGGCGG + Intergenic
1140391018 16:74586839-74586861 TAGCAGGGTGTGGTGGTGGGAGG - Intronic
1140818041 16:78638641-78638663 CAGCAGGCTGGAGGGAAGGGCGG + Intronic
1140880663 16:79195276-79195298 AAGCAGGATGGGGTGGAGGGAGG + Intronic
1140894997 16:79317144-79317166 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1141075945 16:81006856-81006878 GAGCACGGTGGAGCGGTGGAGGG - Exonic
1141079826 16:81040314-81040336 AAGCAGTGGGTGGGGGTGGGAGG + Intronic
1141110178 16:81265612-81265634 ATGGATGGTGGATGGGTGGGTGG - Intronic
1141116929 16:81316474-81316496 GGGGAGTGTGGAGGGGTGGGGGG + Intronic
1141168547 16:81676803-81676825 CAGCTGGGGGAAGGGGTGGGAGG - Intronic
1141348468 16:83270883-83270905 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1141427093 16:83951749-83951771 AAGGAGGGTGGAAGGCAGGGAGG - Intronic
1141469374 16:84228353-84228375 CAGCAGGAGGGAGGGGAGGGAGG - Intronic
1141557577 16:84846198-84846220 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1141721735 16:85759768-85759790 AAGCAAAGTGGAGGGGCCGGAGG + Intergenic
1141860360 16:86712274-86712296 AAGCAGGGTGCTCGGGAGGGAGG - Intergenic
1141952013 16:87345333-87345355 AGGCAGGGTGGGAGGGAGGGAGG + Intronic
1142004037 16:87680587-87680609 AGCCATGGTGCAGGGGTGGGGGG + Intronic
1142040690 16:87891910-87891932 CAGCAGAGTGGAGGGGTCGAAGG + Exonic
1142090866 16:88208497-88208519 AGGGAGGGAGGAGAGGTGGGAGG + Intergenic
1142104182 16:88293263-88293285 AAGATGGGTGGATGGATGGGTGG + Intergenic
1142128664 16:88422421-88422443 TAAAAGGGTGGATGGGTGGGTGG + Intergenic
1142161887 16:88562011-88562033 TAGAGGGGTGGGGGGGTGGGGGG - Intergenic
1142238236 16:88932821-88932843 AAGCCGGGTGCAGTGGTGTGTGG + Intronic
1142248308 16:88979726-88979748 ATGATGGGTGGATGGGTGGGTGG + Intergenic
1142287866 16:89178797-89178819 AAGCAGCCTGGAGAGGTGGAGGG + Intronic
1203141637 16_KI270728v1_random:1771145-1771167 AAAGAAGATGGAGGGGTGGGTGG + Intergenic
1142605524 17:1079001-1079023 CAGCAAGGGGGAGGGGAGGGAGG + Intronic
1142893181 17:2958161-2958183 AGGCAGAGGGGTGGGGTGGGAGG + Intronic
1142903849 17:3029495-3029517 AGGCAGGGTGGAGTGGGGAGAGG + Intronic
1143021239 17:3918089-3918111 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1143325906 17:6098140-6098162 AGACAGGGGGGCGGGGTGGGGGG + Intronic
1143485749 17:7252608-7252630 AGGCACGGTGGCGGGGCGGGGGG + Intronic
1143513491 17:7408142-7408164 CAGGAGGGAGGAGGGGCGGGGGG - Intronic
1143527687 17:7482036-7482058 AGGCTGGGTGGAGCGGAGGGCGG - Exonic
1143548751 17:7615645-7615667 ATGCGGGGTGGGGGGGGGGGTGG - Intronic
1143775277 17:9195197-9195219 GCCCAGGGTGGAGGGGTGGAGGG - Intronic
1143866411 17:9926824-9926846 GTGCAGGGAGGAGGGATGGGAGG + Intronic
1143965736 17:10755541-10755563 AGGCAGGGTTGCGGGATGGGAGG - Intergenic
1144053414 17:11517228-11517250 AAGCAGGCTGGAGGGGAAAGAGG + Intronic
1144573465 17:16415225-16415247 CTGCTGGGTGGATGGGTGGGTGG + Intergenic
1144753038 17:17663192-17663214 AGGCAGGGTGGACAGGAGGGTGG - Intergenic
1144754747 17:17672355-17672377 CAGGAGGGTGGAGGGGTCTGTGG + Intergenic
1144769387 17:17751134-17751156 AAGCGGGAGGGAGGGGTGTGTGG + Intronic
1144777635 17:17792790-17792812 AGGCAGGGTGGGGAGGTGGGTGG + Intronic
1144965566 17:19075362-19075384 AAGTAGGATGGAGAGCTGGGAGG + Intergenic
1144982401 17:19176821-19176843 AAGTAGGATGGAGAGCTGGGAGG - Intergenic
1144985822 17:19201418-19201440 AAGTAGGATGGAGAGCTGGGAGG + Intergenic
1145240179 17:21236409-21236431 TGGCTGGGTGGATGGGTGGGTGG - Intergenic
1145819061 17:27817368-27817390 CAGCAGGGTGTTGGGGTGGCAGG - Intronic
1145836041 17:27955053-27955075 ACCAAGGGTGGAGGGATGGGTGG + Intergenic
1145845000 17:28030984-28031006 GAGCATGGGGCAGGGGTGGGAGG - Intergenic
1145846302 17:28041874-28041896 AAGCCGGGTGGGGGGGAGGGGGG + Intronic
1145950516 17:28813019-28813041 AAGCGGGGGGGGGGGGGGGGGGG + Intronic
1145987604 17:29057640-29057662 AGGGTGGGTGGAGGGGTGAGGGG + Intergenic
1146180362 17:30694181-30694203 GGACGGGGTGGAGGGGTGGGAGG - Intergenic
1146455410 17:33005566-33005588 AGGCACAGTTGAGGGGTGGGGGG + Intergenic
1146668106 17:34718159-34718181 AAGAAGGGTGGAGTCGAGGGAGG + Intergenic
1146695109 17:34902995-34903017 GAGCAGGGTGGGGGAGAGGGAGG - Intergenic
1146731071 17:35194234-35194256 AGGCTGGGTGGAGCGGAGGGCGG + Exonic
1146832287 17:36080681-36080703 AAGCAAGGTGGTGGGATGGGAGG - Intergenic
1146846772 17:36187004-36187026 AAGCAAGGTGGTGGGATGGGAGG - Intronic
1146944547 17:36864758-36864780 AAGGAGGGAGGAGGGGAGGGAGG - Intergenic
1147118740 17:38322413-38322435 AGGCCGGGTGGGTGGGTGGGTGG + Intronic
1147169844 17:38611532-38611554 AAGCAGGAGGGAGGGAGGGGAGG + Intergenic
1147213427 17:38885505-38885527 TAGCAGGGAGGAAGGGTGGGTGG + Intronic
1147219991 17:38922895-38922917 CAGCAGGGTGGAGAGGAGGAGGG + Intergenic
1147247431 17:39131704-39131726 GAGCAGAGTTGGGGGGTGGGTGG - Intronic
1147456541 17:40541728-40541750 GGACACGGTGGAGGGGTGGGAGG + Intergenic
1147495017 17:40907337-40907359 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1147776748 17:42907357-42907379 AAGATGGGTGGATGGATGGGGGG + Intronic
1147841060 17:43371775-43371797 AAGCGGGGGGGAGGAGAGGGGGG - Intergenic
1147935463 17:44008097-44008119 GAGCAGGGTGTAGGGGTGAGGGG - Intronic
1147945450 17:44077887-44077909 ATGCAGAGTGGAGGGGAGGTGGG - Exonic
1148068749 17:44893763-44893785 AAGGTGGGGGGGGGGGTGGGGGG + Intronic
1148214934 17:45829371-45829393 AAGCAGGGTGGAGAAGTGAGAGG + Intronic
1148397954 17:47325013-47325035 AAAAAGGGGGGTGGGGTGGGCGG - Intronic
1148545555 17:48516070-48516092 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1148564784 17:48626394-48626416 GAGCAGGGGGTGGGGGTGGGAGG - Intronic
1148760842 17:49999154-49999176 AAGGTGGGTGGAGGAGGGGGAGG - Intergenic
1148783721 17:50135196-50135218 AGGTGGGGTGGAGGGGTGGGGGG + Exonic
1148795326 17:50194221-50194243 AAGCATGATGGAGGTGGGGGAGG + Intronic
1149061562 17:52428684-52428706 CAGAAGGGTGGGAGGGTGGGAGG + Intergenic
1149572522 17:57683448-57683470 AAGCAGTGTGGAGGTGGTGGAGG - Exonic
1149995173 17:61402413-61402435 AGGGAGGCTGGGGGGGTGGGTGG - Intronic
1150197612 17:63317301-63317323 AAGGAGGGGGGCGGGCTGGGGGG - Intronic
1150333238 17:64311428-64311450 AGGTGGGGTGGAGGGGTTGGTGG - Intergenic
1150488044 17:65557729-65557751 AAGTATGGTGGATGGGTGGATGG - Intronic
1151144868 17:72031155-72031177 AAGATGGGTGGATGGGTGAGTGG - Intergenic
1151162268 17:72175653-72175675 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1151183045 17:72343478-72343500 ATGCAGAGAGGAGGGGTGAGAGG + Intergenic
1151328880 17:73395123-73395145 CAGCAGGGTGGCTGGGTGTGAGG + Intronic
1151401352 17:73857942-73857964 AAGCAGGGGTGTGGGGAGGGTGG + Intergenic
1151427934 17:74043274-74043296 AGGCAGGGAGGAAGGATGGGGGG + Intergenic
1151460202 17:74249802-74249824 CAGCCAGGTGGGGGGGTGGGAGG + Intronic
1151546884 17:74798742-74798764 GAGCAGGAGGGATGGGTGGGTGG - Intronic
1151555547 17:74844714-74844736 AAGCAGGGTGGAGGCTGGAGTGG + Intronic
1151662107 17:75524797-75524819 AAGCAGGGGTGAGGGGCTGGGGG - Intergenic
1151779938 17:76239537-76239559 AAGCCGGGGGGTGGGGGGGGTGG - Intronic
1151813443 17:76458865-76458887 CAGCTGGGGGGTGGGGTGGGAGG + Intronic
1151962050 17:77410683-77410705 AAGCAGGGTGGAGCGCCTGGGGG + Intronic
1152002337 17:77654594-77654616 GAGCAGACAGGAGGGGTGGGAGG - Intergenic
1152084278 17:78208072-78208094 AGGCGGTGTGGTGGGGTGGGTGG - Intergenic
1152085083 17:78213187-78213209 AAGAATGGGGGCGGGGTGGGAGG + Intergenic
1152093387 17:78258852-78258874 AAACAGGTGGGGGGGGTGGGGGG + Intergenic
1152141818 17:78541100-78541122 GAGCGGGGTGGGGGGGTGAGCGG + Intronic
1152141827 17:78541117-78541139 GAGCGGGGTGGGGGGGTGAGCGG + Intronic
1152141836 17:78541134-78541156 GAGCGGGGTGGGGGGGTGAGCGG + Intronic
1152141857 17:78541184-78541206 GAGCGGGGTGGGGGGGTGAGCGG + Intronic
1152141891 17:78541252-78541274 CAGATGGGTGGGGGGGTGGGGGG + Intronic
1152191822 17:78892767-78892789 CAGCTGGGTGGAGGCGAGGGAGG + Intronic
1152208058 17:78986774-78986796 AAGCAGGCTGGAGGGGGAAGTGG + Intergenic
1152253819 17:79225935-79225957 AAGCAGGATGGGGGTGTGGGAGG + Intronic
1152279382 17:79376350-79376372 AAGCAAAGAGGAGGTGTGGGTGG + Intronic
1152348290 17:79768314-79768336 AAGCAGGGAGGAGGTGGGGACGG + Intergenic
1152473629 17:80503754-80503776 TGGAGGGGTGGAGGGGTGGGTGG + Intergenic
1152550519 17:81027749-81027771 GGGCAGGGTGGAGGGGGAGGAGG - Intergenic
1152702888 17:81828263-81828285 GTGCAGGGTCGGGGGGTGGGGGG - Intronic
1152817714 17:82418298-82418320 GACCCGGGTGGGGGGGTGGGGGG - Exonic
1153100430 18:1462199-1462221 ACCCAGGGTGGGTGGGTGGGTGG - Intergenic
1153528709 18:6021760-6021782 CAGCGGGGTGGGGGGGTGGCGGG + Intronic
1153761362 18:8335236-8335258 AAGGAGGGGAGAGGGGAGGGAGG - Intronic
1153831793 18:8930265-8930287 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1154115430 18:11609647-11609669 AGGCTGGGTGGAGTGGAGGGCGG - Intergenic
1154145198 18:11861238-11861260 CAGCAGGAGGGAGGGGTCGGGGG - Intronic
1154489243 18:14906902-14906924 GAGGAGGGTGGGGGGTTGGGTGG + Intergenic
1154492329 18:14931902-14931924 CAGGAGGGAGGTGGGGTGGGGGG - Intergenic
1154492345 18:14931937-14931959 GAGGAGGGAGGTGGGGTGGGGGG - Intergenic
1155041095 18:22066144-22066166 AAGTAGTATGGATGGGTGGGTGG + Intergenic
1155479644 18:26271776-26271798 GAGCCGGGTGGTGTGGTGGGGGG + Intronic
1155554358 18:27001689-27001711 ATGCATGGTGGGAGGGTGGGAGG + Intronic
1155692573 18:28643993-28644015 AAGAAGGAAGGAGGGGAGGGAGG + Intergenic
1155885841 18:31207114-31207136 CAGGAGGGTGGAGATGTGGGAGG - Intergenic
1155944255 18:31829753-31829775 AGACAGGGTGTAGGAGTGGGTGG - Exonic
1156036254 18:32770668-32770690 GAGCAGGGTGGTGGAGCGGGTGG + Intronic
1156281981 18:35648081-35648103 AGGAAGGGTGGAAGGGAGGGAGG + Intronic
1156297427 18:35805603-35805625 CAGATGGGTGGATGGGTGGGTGG + Intergenic
1156359051 18:36367903-36367925 AAGCGGTGGGGAGGGATGGGGGG - Intronic
1156656449 18:39294139-39294161 AGGCAAAGTGGAGGGGTGGCTGG + Intergenic
1156895188 18:42238290-42238312 TGGAAGGGTGAAGGGGTGGGAGG - Intergenic
1157040789 18:44036616-44036638 AAGCAGGATGGGGGGGGGGGGGG - Intergenic
1157381866 18:47225848-47225870 AATAAGGGTGGAGAGGTTGGGGG + Intronic
1157385833 18:47259617-47259639 AAGCAGTTTGGGGGGGTGGTGGG + Intergenic
1157489430 18:48112297-48112319 AAGAAGGAAGGATGGGTGGGAGG - Intronic
1157493534 18:48139699-48139721 AGGGAGGCTGGAGGGGTGGTGGG - Intronic
1157613906 18:48975867-48975889 AGGCAGGGGGAAGGGGCGGGCGG + Intergenic
1157801143 18:50622317-50622339 AAGAAGGGTTGAAGGGTGGCTGG + Intronic
1157849968 18:51039491-51039513 ACGGGGGGTGGGGGGGTGGGGGG - Intronic
1157980244 18:52371622-52371644 AAGCAGGCGGGAGGGGAAGGAGG - Intronic
1158031119 18:52966428-52966450 AAGTAGGGTTTAGGGGTGGAGGG - Intronic
1158060956 18:53340824-53340846 AGGCAGGGTGTAGGGGGTGGGGG + Intronic
1158554810 18:58466433-58466455 CAGCATGGTGGTGGGGGGGGCGG - Intergenic
1158564005 18:58538887-58538909 AAGCAGGGTGGGGGTGGGGATGG - Intronic
1158947097 18:62456649-62456671 AAGAAGAGTGGGAGGGTGGGTGG - Intergenic
1159236084 18:65674101-65674123 TGGTAGGGTGGAAGGGTGGGAGG + Intergenic
1159768641 18:72521968-72521990 CAACAGGGTGGAGGGTTGAGGGG - Intergenic
1159951420 18:74486874-74486896 AGGCTGGGTGGGTGGGTGGGTGG + Intergenic
1160253373 18:77223913-77223935 AAGGCGGGGGGAGGGGGGGGTGG - Intergenic
1160719893 19:592431-592453 AAGGAGGGTGGAAGGATGAGAGG - Intronic
1160872161 19:1282448-1282470 AAGGAGGGAGGGGAGGTGGGAGG + Intergenic
1160915295 19:1493421-1493443 AAGCAGGTGGGAGGGGCTGGGGG + Intronic
1160916860 19:1500845-1500867 GAGGAGGGAGGAGGGGAGGGGGG + Intergenic
1160940764 19:1619475-1619497 CTGCAGGGTGGGGGGATGGGTGG + Intronic
1160990095 19:1856939-1856961 GAGCAGGTTGCCGGGGTGGGGGG + Intronic
1161013022 19:1969233-1969255 AAGCGGGATGGGTGGGTGGGTGG - Intronic
1161088062 19:2344180-2344202 GAGCGGGGTGATGGGGTGGGGGG - Intronic
1161131337 19:2590737-2590759 TAGGTGGGTGGATGGGTGGGTGG - Intronic
1161241283 19:3225148-3225170 GAGAGGGGAGGAGGGGTGGGTGG - Intronic
1161283200 19:3456648-3456670 AGGCCGGCTGGTGGGGTGGGAGG + Intronic
1161314240 19:3610438-3610460 AGGCAAGGCAGAGGGGTGGGGGG + Intergenic
1161394606 19:4038447-4038469 CAGTAGGGTGGGGGGATGGGTGG + Exonic
1161456117 19:4370489-4370511 CATCAGGGTGGCAGGGTGGGTGG + Intronic
1161565596 19:5000213-5000235 TAGGTGGGTGGATGGGTGGGTGG - Intronic
1161668473 19:5590899-5590921 CAGCCTGGTGGAGAGGTGGGAGG - Intronic
1161696131 19:5769312-5769334 AAAGAGGGTGGTGGGATGGGGGG + Intronic
1161803028 19:6426248-6426270 AAGCAGGCTGGGGGTGGGGGTGG - Exonic
1161878572 19:6931071-6931093 AAGGATAGTGAAGGGGTGGGTGG - Intronic
1161963193 19:7534102-7534124 GCGCGGGGAGGAGGGGTGGGAGG + Intronic
1161974512 19:7600694-7600716 AGGGTGGGTGGATGGGTGGGTGG - Intronic
1162051547 19:8036938-8036960 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1162136960 19:8561369-8561391 AAGAAGGGGGGAAGGGAGGGAGG - Intronic
1162337668 19:10071571-10071593 ATGGAGGGTGCAGGGGTTGGGGG - Intergenic
1162380522 19:10329162-10329184 TTGCAGGGTGGCGGGGTGGAGGG - Intronic
1162389014 19:10378051-10378073 TGGGAGGGTGGATGGGTGGGTGG + Intronic
1162475178 19:10895503-10895525 AAGCAAGGGGGAGGGGAAGGAGG + Intronic
1162518454 19:11164742-11164764 AAGCAGGATGGATGGATGGATGG - Intronic
1162577168 19:11505780-11505802 AACCAGGGTGGGGGGGATGGCGG - Exonic
1162582670 19:11540177-11540199 AAGCAGGGAGGTGGGGGGAGAGG + Intronic
1162719719 19:12655229-12655251 AAGCAGGGTGAACGGGTGACAGG - Intronic
1162767713 19:12930157-12930179 AAGCATGGTGGAGGCATGGTGGG - Intronic
1162933643 19:13969713-13969735 AAGCAGGGTTGGGGGGTGTCGGG + Intronic
1162969214 19:14170069-14170091 ATTCAGGGTGAAGGGCTGGGGGG - Intronic
1163096677 19:15063206-15063228 AAGGAGGGGGGAGGGGAGAGGGG - Intergenic
1163158324 19:15450664-15450686 TAGGTGGTTGGAGGGGTGGGTGG - Intergenic
1163238415 19:16043342-16043364 AGGAGGGGTGGATGGGTGGGTGG + Intergenic
1163329892 19:16629217-16629239 AAACAGGGTGGAGGGAGGAGGGG - Intronic
1163442695 19:17329641-17329663 AAGGATGGAGGAGGGGAGGGAGG + Intronic
1163533982 19:17866566-17866588 CAGGTGGGTGGATGGGTGGGTGG - Intergenic
1163551770 19:17969500-17969522 CAAGAGGGTGGAGGGGTGGAGGG - Intronic
1163676088 19:18656014-18656036 AAGGAGGCTGGAGGCATGGGTGG - Intronic
1163678121 19:18665691-18665713 GAGCAGGGCTGTGGGGTGGGGGG + Intronic
1163683469 19:18696915-18696937 AATCACAGGGGAGGGGTGGGGGG + Intronic
1163730192 19:18944544-18944566 AAAAAGGGTGGGGGGGAGGGAGG + Intergenic
1163826845 19:19528822-19528844 ATGCAGGGTGGGCGGGAGGGAGG + Intronic
1164039710 19:21483747-21483769 CAGCGGGGAGGAGGGGTCGGCGG + Intronic
1164147093 19:22518797-22518819 ACGGAGCGGGGAGGGGTGGGTGG - Intronic
1164159541 19:22617531-22617553 ACGGAGCGGGGAGGGGTGGGTGG + Intergenic
1164441695 19:28284457-28284479 AAGGAGGGTGGAGGGGAAGGAGG + Intergenic
1164441762 19:28284718-28284740 AAGGAGGGTGAAGGGGAAGGAGG + Intergenic
1164441787 19:28284798-28284820 AAGGAGTGTGGAGGGGAAGGAGG + Intergenic
1164441794 19:28284814-28284836 AAGGAGGGTGGAGGGGAAGGAGG + Intergenic
1164441801 19:28284830-28284852 AAGGAGGGTGGAGGGGAAGGAGG + Intergenic
1164441808 19:28284846-28284868 AAGGAGGGTGGAGGGGAAGGAGG + Intergenic
1164441821 19:28284877-28284899 AAGGAGGGTGGAGGGAAGGGGGG + Intergenic
1164441827 19:28284892-28284914 AAGGGGGGTGGAGGGGAAGGAGG + Intergenic
1164441862 19:28285013-28285035 AAGGTGGGTGGAGGGGAAGGAGG + Intergenic
1164441869 19:28285029-28285051 AAGGAGGGTGGAGGGGAAGGAGG + Intergenic
1164441880 19:28285061-28285083 AAGGAGGGTGGAGGGGAAGGAGG + Intergenic
1164441902 19:28285143-28285165 AAGGAGGGTGGAGGGGAAGAAGG + Intergenic
1164441952 19:28285303-28285325 AAGAAGGGTGGAGGGGAAAGAGG + Intergenic
1164701356 19:30287228-30287250 TAGATGGGTGGAGGGGTGGGTGG + Intronic
1164794382 19:31014496-31014518 AAGAAGGGAGGAAGGGTCGGGGG + Intergenic
1164926942 19:32138350-32138372 ATGGGTGGTGGAGGGGTGGGGGG - Intergenic
1165021240 19:32926025-32926047 AAGGAGTGTGGCAGGGTGGGAGG - Intronic
1165085805 19:33346154-33346176 AAGCAGGGGGCAGGGGGTGGGGG + Intergenic
1165313046 19:35040093-35040115 CAGCAAGGAGGAGGGGTGCGGGG - Intronic
1165331865 19:35144633-35144655 AAGCAGGGCGGGGGGTGGGGGGG + Intronic
1165824101 19:38695838-38695860 CAGCATGGTGGCGGGGTGGGGGG - Intronic
1165902160 19:39174065-39174087 GAGGAGGGAGGAGGGGAGGGAGG - Intronic
1165941400 19:39416412-39416434 AGGGTGAGTGGAGGGGTGGGGGG + Exonic
1166201418 19:41239974-41239996 ATGGAGGGTGGATGGGTGGGTGG + Intronic
1166201486 19:41240271-41240293 ATGGAGGGTGGATGGGTGGGTGG + Intronic
1166305264 19:41933977-41933999 AGGCAGAGTGGAGGGGTGGGGGG + Intergenic
1166320961 19:42018665-42018687 AAGCGGGGGGGGGGGGGGGGGGG + Intronic
1166377218 19:42334312-42334334 GAGGAGGGTGGGGTGGTGGGGGG - Intronic
1166677388 19:44748430-44748452 AGGCGGGGTCGGGGGGTGGGGGG - Intronic
1166690997 19:44821109-44821131 AGGGAGGGTGGGTGGGTGGGAGG + Exonic
1166790828 19:45397432-45397454 AAGCAGGGAGGGAGGGAGGGAGG - Intronic
1166798367 19:45441383-45441405 TAGCAGGGTGGATGGCGGGGGGG + Intronic
1167100911 19:47403744-47403766 AATCAGAGTGGAGGTGAGGGAGG + Intronic
1167103220 19:47416745-47416767 AGCCAGCGAGGAGGGGTGGGTGG - Intronic
1167144046 19:47671688-47671710 TAGAAGGATGGAGGGATGGGTGG + Intronic
1167144121 19:47671958-47671980 TGGAAGGATGGAGGGGTGGGTGG + Intronic
1167240859 19:48342269-48342291 AAGAAGGGAGGAAGGGAGGGAGG + Intronic
1167292949 19:48634670-48634692 AAGCGCGGAGGAGGGATGGGAGG + Intronic
1167413334 19:49357529-49357551 GAGCATGGTGGAGGGGAAGGAGG - Intronic
1167575486 19:50315638-50315660 GAGCAGTGGGGGGGGGTGGGGGG + Exonic
1167598217 19:50438371-50438393 ATGCATGGTGGAGAGGTGGGAGG + Intronic
1168045451 19:53790964-53790986 CAGCAGGGTGTAGGTGGGGGTGG + Intergenic
1168078018 19:53991310-53991332 TACCAGGGAGGAGGGGCGGGAGG - Intergenic
1168100863 19:54140248-54140270 AAGGCGGGTGGCGGGGTGGGGGG - Intronic
1168146177 19:54421024-54421046 ATGGTGGGTGGAGTGGTGGGGGG - Intronic
1168230782 19:55029899-55029921 AGGCAGGGAAGAGGGGAGGGAGG + Intronic
1168313803 19:55474999-55475021 ATGCAGGGTGGAGACGTGGATGG - Intergenic
1168328776 19:55553902-55553924 AAGGAGGAGGGAGGGGTGGGAGG - Intergenic
1168427865 19:56253320-56253342 GGGCAGGGAGGAGGGGTGGAGGG + Intronic
1168464933 19:56594816-56594838 AAGAAGGATGGAGGGGAAGGAGG - Intergenic
1168666615 19:58209577-58209599 AGGCAGGGTGCAGGGCTTGGAGG + Intronic
925013572 2:504433-504455 AAGAAGGGAGGAGGGGAGGAAGG - Intergenic
925034231 2:673716-673738 AACCAGAGGGGAGGGGAGGGAGG + Intronic
925313782 2:2906736-2906758 GAGGAAGGTGTAGGGGTGGGTGG - Intergenic
925609680 2:5692635-5692657 CAGGAAGGTGGAGGGGTGGGAGG + Intergenic
925643188 2:6006914-6006936 TTGGAGGGTGCAGGGGTGGGGGG - Intergenic
925978601 2:9158445-9158467 AAGGATGGGGGAGGGGTTGGGGG - Intergenic
926050318 2:9740301-9740323 TAGATGGGTGGATGGGTGGGTGG - Intergenic
926050338 2:9740353-9740375 TAGATGGGTGGATGGGTGGGTGG - Intergenic
926089909 2:10043256-10043278 AAGCGGGGCGGAGGGGGCGGCGG - Intronic
926107818 2:10163322-10163344 AAGACGGGCGGGGGGGTGGGGGG + Intronic
926121478 2:10243424-10243446 AGGCAGAGCGGTGGGGTGGGTGG + Intergenic
926220840 2:10934633-10934655 AAGCAGGGCGGGGTGGAGGGAGG - Intergenic
926317504 2:11721838-11721860 AAGCAGGGTGGGGAGGGGAGAGG + Intronic
926524376 2:13958302-13958324 CAGAAGGGTGGAAGAGTGGGAGG + Intergenic
926817410 2:16813692-16813714 GAGCAGTGTGAAGGGGTGGTAGG - Intergenic
926992843 2:18698332-18698354 AAGATGGATGGATGGGTGGGTGG - Intergenic
927144277 2:20151401-20151423 ATGCAGGGTGCAGGGGCTGGCGG + Intergenic
927429750 2:23017422-23017444 AGGCAGGGTGCAGGCGTGTGGGG - Intergenic
927440618 2:23113979-23114001 AAGTATGGTGGAGAGGTGTGGGG - Intergenic
927473438 2:23393990-23394012 AAGCAAGTTGGAGGTGTGGGCGG + Intronic
927645991 2:24877282-24877304 CTGAAGGGGGGAGGGGTGGGTGG - Intronic
927683431 2:25154956-25154978 AAGCAGGATGCAGGGCTGGCAGG + Exonic
927692269 2:25216358-25216380 AAGCAGCCAGGAGCGGTGGGTGG - Intergenic
927714550 2:25343094-25343116 AAGGAGGCTGGAGGCGGGGGTGG - Intergenic
928016950 2:27666366-27666388 AGGCCGGGGGGCGGGGTGGGGGG - Intronic
928893406 2:36233826-36233848 AACCGGGGTGGAGAGGTGGAGGG + Intergenic
928993793 2:37264510-37264532 TAGGGGAGTGGAGGGGTGGGAGG + Intronic
929070919 2:38029705-38029727 AGGGAGAGTGGAGGGGAGGGTGG + Intronic
929287537 2:40152753-40152775 AAGCAGGGTGGCAGCTTGGGTGG + Intronic
929457772 2:42078142-42078164 GGGTAGGGTGGAGGGCTGGGAGG - Intergenic
929545879 2:42855006-42855028 AATGGGGGTGGTGGGGTGGGGGG + Intergenic
929556124 2:42926744-42926766 AGCCAGCCTGGAGGGGTGGGAGG - Intergenic
929870151 2:45752434-45752456 AAACAGTGGGGAGGGGAGGGAGG - Intronic
929876028 2:45797294-45797316 CTGCAGGGTGAAGGGGAGGGAGG + Intronic
930177262 2:48314386-48314408 AAGCAGGGTGGAGGCGCTGTAGG - Intergenic
930582398 2:53228220-53228242 GAGAAGGGTGGACGGGTGGGGGG - Intergenic
930724079 2:54665780-54665802 AAGGAAGGTTGAGGGTTGGGTGG + Intronic
930852495 2:55975591-55975613 AGTCGGGGTGGGGGGGTGGGGGG + Intergenic
931029456 2:58155760-58155782 AAACGGGGCGGCGGGGTGGGGGG - Intronic
931254612 2:60558757-60558779 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
931264621 2:60649781-60649803 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
931576741 2:63725195-63725217 CTGGAGGGTGGAAGGGTGGGAGG - Intronic
931590677 2:63880167-63880189 GAGGAGGGGGGAGGGGTAGGGGG - Intronic
932071608 2:68626353-68626375 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
932486274 2:72086111-72086133 AATCAGGGTTGAGGGGCTGGCGG - Intergenic
932597116 2:73101026-73101048 AAGGTTGGTGGTGGGGTGGGGGG + Intronic
932618876 2:73254215-73254237 AAGCAGGGTTGAGCGGTGGCAGG + Intergenic
932629976 2:73332572-73332594 AGGCAGGGTGGTGGTGTGGGTGG + Intergenic
932692009 2:73921292-73921314 AAGCAGAGTGCGGGGGAGGGGGG + Intergenic
932702300 2:74000249-74000271 AAGGAGGGTGGAGAGGCAGGGGG - Intronic
932775624 2:74526710-74526732 CAACAGGCTGGATGGGTGGGTGG - Exonic
933632240 2:84671642-84671664 AAGCAGCAGGAAGGGGTGGGGGG - Intronic
933647034 2:84821306-84821328 AGGCTGGGTGGGGGGGTTGGGGG - Intergenic
933840769 2:86284135-86284157 AGGCAGTGTGGAGGAGTGTGGGG - Intronic
933898753 2:86834516-86834538 AAGCAGTGTGGGGGAGAGGGTGG + Intronic
933940301 2:87239600-87239622 CAGCAGAGTGGAGGGGTTGGAGG + Intergenic
934094292 2:88584867-88584889 GAGCACGGTGGAGGGGAGGAAGG + Intronic
934615528 2:95768361-95768383 GAGCAGGCTGGAAGGGCGGGAGG + Intergenic
934645371 2:96056197-96056219 GAGCAGGCTGGAAGGGCGGGAGG - Intergenic
934697481 2:96410426-96410448 AAGTGGGGTGCAGGGGTGAGGGG + Intergenic
934763690 2:96869279-96869301 CAGCCGGGAGGAGGGGTTGGGGG + Intronic
934838776 2:97612286-97612308 GAGCAGGCTGGAAGGGCGGGAGG - Intergenic
935107798 2:100061846-100061868 TAGCACAGTGGAGGGGGGGGGGG + Intronic
935140683 2:100350409-100350431 AAGCCAGGTGGCTGGGTGGGAGG - Intergenic
935334973 2:102007706-102007728 AAGCAGGCTGGAGGGCAGAGAGG + Intronic
935781789 2:106514703-106514725 AAGCAGTGTGGGGGAGAGGGTGG - Intergenic
935784765 2:106538797-106538819 AGGCAGTGTGGAAGGGTGGGTGG - Intergenic
936152096 2:110027576-110027598 AACCAGTGGGGAGGGGTGGGTGG + Intergenic
936192582 2:110343837-110343859 AACCAGTGGGGAGGGGTGGGTGG - Intergenic
936326640 2:111510875-111510897 AGGCAGGGTGAAGAGGTGGAAGG + Intergenic
936352837 2:111726176-111726198 CAGCAGAGTGGAGGGGTTGGAGG - Intergenic
936518418 2:113197068-113197090 GACCAGGGTGGAGAGGTAGGGGG + Intronic
937089370 2:119195831-119195853 AAGAAGGAAGGAGGGGAGGGAGG + Intergenic
937127133 2:119482092-119482114 CAGGTGGGTGGAGGGCTGGGTGG - Intronic
937379686 2:121365412-121365434 AAGCAGGGCGGAGGGTGGGAGGG - Intronic
937613852 2:123896426-123896448 ACGCAATGTGGGGGGGTGGGGGG - Intergenic
937870697 2:126783956-126783978 AAACAGAGTGCAGGGGTGGGGGG + Intergenic
937870794 2:126784642-126784664 AAGCAGTGGGGATGGGAGGGAGG + Intergenic
937876336 2:126828210-126828232 AAGGAGAGTGGAGGGGAAGGAGG - Intergenic
937924046 2:127154123-127154145 GAGTAGGGTGCAGGGATGGGCGG - Intergenic
938159663 2:128973848-128973870 AGGCAGGGAGGAGGGATGGTAGG - Intergenic
938222578 2:129582884-129582906 CAGAAGGGTGGGGAGGTGGGAGG - Intergenic
938632577 2:133184107-133184129 GAGCAGGGAGGAAGGGTGAGTGG - Intronic
938765923 2:134460373-134460395 AGGCAGGAGGGAGTGGTGGGTGG - Intronic
938894624 2:135737946-135737968 AGGAAGGGTAGGGGGGTGGGAGG - Intergenic
938965923 2:136388578-136388600 GGGCAGGGTGGGGGGGGGGGGGG - Intergenic
939012819 2:136866510-136866532 AAAAAAGGTGGAGGGGTGTGGGG + Intronic
939393446 2:141599056-141599078 AAGCGGGGGGGGGGGGGGGGGGG - Intronic
939631786 2:144534437-144534459 ATGCAGGGTGGGAGGTTGGGAGG - Intergenic
939818099 2:146921434-146921456 ACGCAGGGTGGGTGGATGGGAGG + Intergenic
939986238 2:148832167-148832189 AAGCAGAGTGTAGGGGTCAGGGG + Intergenic
940212372 2:151268411-151268433 ATGGAGGGTGGAGGAGGGGGAGG - Intergenic
940284416 2:152019496-152019518 ATGATGGGTGGATGGGTGGGTGG + Intronic
940379974 2:153002946-153002968 AGGAAGGGTAGAGGGGAGGGAGG + Intergenic
940637932 2:156320608-156320630 ATGCTGGGAGGAGGGGTTGGGGG + Intergenic
941015337 2:160349821-160349843 AAGCGGGGTGGGGGGGTGGAGGG + Intronic
941165895 2:162082684-162082706 TGGCAGGGTGGAGGGTGGGGAGG + Intergenic
941339309 2:164286974-164286996 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
941361081 2:164552022-164552044 AAGCAAGAGGGAGGGGAGGGCGG + Intronic
941574392 2:167212891-167212913 CAGAGGGGTGGGGGGGTGGGGGG - Intronic
941769533 2:169330083-169330105 CAGCAGGGTGGTGGTGGGGGAGG - Intronic
942072415 2:172327803-172327825 AAATAGGCTGGAGGGGTGGGAGG + Intergenic
942172630 2:173302781-173302803 AAGCAGGGTGGAGGGCTTCCAGG + Intergenic
942275933 2:174323660-174323682 AAACAGGGTGGGGGGTTGGGGGG + Intergenic
942299305 2:174546926-174546948 AAGGAGGGTGGAGGGCTGGGAGG - Intergenic
942303686 2:174586185-174586207 AGGCGGGGTGGACGTGTGGGGGG + Intronic
942396438 2:175554865-175554887 AGAAAAGGTGGAGGGGTGGGTGG + Intergenic
942482285 2:176402786-176402808 AAGGAGGAAGGAGGGGAGGGAGG - Intergenic
942487982 2:176459249-176459271 AAGCAGTGGGGTCGGGTGGGGGG + Intergenic
942539267 2:176998355-176998377 AAGTAAGGGGGGGGGGTGGGGGG + Intergenic
943745091 2:191454007-191454029 ACCCAGAGTGGAAGGGTGGGTGG - Intergenic
944591329 2:201220454-201220476 AAGCAGACTGGAGGGGGGTGGGG + Exonic
944777437 2:202981162-202981184 ACCCAGGGTGGAGAGTTGGGGGG + Intronic
945109802 2:206351512-206351534 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
945455647 2:210049285-210049307 GTGGTGGGTGGAGGGGTGGGGGG - Intronic
945592191 2:211747343-211747365 TATCATGGAGGAGGGGTGGGAGG - Intronic
945909821 2:215635709-215635731 AAGCATGGTGGAGGGGTTCAGGG + Intergenic
946006827 2:216532424-216532446 AAACTGGGTGGTAGGGTGGGAGG - Intronic
946061162 2:216942696-216942718 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
946125043 2:217555381-217555403 AAGCAGGGTGGAATGCTGGGTGG + Intronic
946232956 2:218303929-218303951 AAGCAGGGTGGAGAAGACGGAGG - Intronic
946328650 2:218997698-218997720 AACGAGGGGGGAGGGCTGGGAGG - Intergenic
946951971 2:224886139-224886161 AAGGGGGGTGGAGGAGCGGGAGG - Exonic
947030027 2:225782926-225782948 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
947038905 2:225892497-225892519 AAGAAGGGAGGAGGGGGGAGAGG + Intergenic
947077744 2:226363982-226364004 AGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077791 2:226364101-226364123 AGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077839 2:226364209-226364231 AGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077883 2:226364305-226364327 AGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947739956 2:232480486-232480508 GAGCGGGGTGGAGGGGAGGAGGG + Intronic
947928725 2:233943999-233944021 AAGCATGGTAGAGGGGGAGGAGG + Intronic
948055206 2:235005606-235005628 AAGCAGGGTGGCGGAGGCGGGGG - Intronic
948342991 2:237270185-237270207 AAGCAGGGGAGGTGGGTGGGAGG - Intergenic
948432649 2:237929878-237929900 CAGCAGCCTGGAGGAGTGGGAGG - Intergenic
948738241 2:240025171-240025193 TGGCAGGGTGGCGGGGTGGCGGG - Intronic
948738249 2:240025187-240025209 TGGCAGGGTGGCGGGGTGGCAGG - Intronic
948818654 2:240527117-240527139 AAGATGGATGGATGGGTGGGTGG + Intronic
948863468 2:240763956-240763978 CAGCCGGGTGCTGGGGTGGGAGG - Intronic
948916158 2:241035915-241035937 CCACGGGGTGGAGGGGTGGGGGG + Intronic
948980249 2:241490883-241490905 TAGCAGGGAGGAGAGCTGGGAGG - Intronic
949032781 2:241804861-241804883 AAGGAGGCTGGAGTGGTTGGGGG + Intergenic
949062780 2:241970794-241970816 AAGCAGGAAGGAGGGCAGGGTGG - Intergenic
1169054873 20:2612277-2612299 CTGCAGGGTGCAGGGGTGGTCGG - Exonic
1169160508 20:3373682-3373704 GACCAGGGTGGATGGGTTGGTGG + Intronic
1169191640 20:3661956-3661978 ATGAAGGGTGGAGGGGCTGGAGG - Intronic
1169789324 20:9392887-9392909 TGGATGGGTGGAGGGGTGGGTGG + Intronic
1169971712 20:11275719-11275741 AAGCAAGGAGGAGGGGAGGGAGG - Intergenic
1169990558 20:11498311-11498333 AGGGAGGGTGGAAGGGAGGGAGG + Intergenic
1170008704 20:11697251-11697273 AAGCAGGACGGGGGAGTGGGGGG + Intergenic
1170012276 20:11736995-11737017 AAGCGGGGTGGGGGGGGGGGTGG + Intergenic
1170025981 20:11890685-11890707 AAGCAGGAGTGAGGGGTGGGCGG - Intergenic
1170394965 20:15916157-15916179 AAGGTGGGTGGTGGGGTAGGGGG - Intronic
1170501808 20:16982422-16982444 AAGCAGGAGGGAAGGGAGGGAGG - Intergenic
1170631745 20:18072325-18072347 AAGGAGGGAGGAGGGGAGGGAGG - Intergenic
1170631769 20:18072381-18072403 AGGGAGGGAGGAGGGGAGGGAGG - Intergenic
1170819185 20:19741643-19741665 AAGAAGGGAGGGAGGGTGGGAGG + Intergenic
1170824732 20:19783762-19783784 ACGAGGGGTGGAGGTGTGGGAGG + Intergenic
1170921144 20:20680987-20681009 GAGCAGGGCTGAGTGGTGGGTGG - Intronic
1171360970 20:24586122-24586144 GAGCAGGGGAGAGTGGTGGGTGG + Intronic
1171724504 20:28603419-28603441 AAACAGGGCGGAGGCGTGGAGGG + Intergenic
1171947740 20:31393277-31393299 AACCAGGGAGGAAGGGTAGGAGG - Intergenic
1172001303 20:31779797-31779819 AAGGAGGATGGAAGAGTGGGAGG + Intronic
1172022402 20:31924006-31924028 AGGCATGGTGGGGGGATGGGAGG - Intronic
1172033772 20:31998025-31998047 GGGCAGGGTGTTGGGGTGGGGGG + Exonic
1172046728 20:32085729-32085751 AAGCAGGGTGGGGTGAGGGGAGG + Intronic
1172074254 20:32281927-32281949 AGGCAGAGTGGGGAGGTGGGTGG + Intronic
1172110948 20:32544563-32544585 CTGCAGGGTAAAGGGGTGGGAGG + Intronic
1172113941 20:32562933-32562955 AAGGAGGGTGGAGGGGAGGGAGG + Intronic
1172113988 20:32563069-32563091 AAGGAGGGTGAAGGGGAAGGAGG + Intronic
1172114078 20:32563311-32563333 AGGGAGGGTGAAGGGGAGGGAGG + Intronic
1172196293 20:33093783-33093805 TAGATGGGTGGATGGGTGGGTGG - Intronic
1172226449 20:33308109-33308131 AAGCAGGAGCAAGGGGTGGGAGG + Intronic
1172608427 20:36231424-36231446 AAGAAGGTGGGAGGGGAGGGCGG + Exonic
1173201701 20:40959661-40959683 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1173341266 20:42154867-42154889 AAGCAGGCTGGGGAGGAGGGAGG + Intronic
1173404572 20:42753561-42753583 AGGGAGGGTGGGGTGGTGGGTGG - Intronic
1173440107 20:43068118-43068140 AAGAAGGGAGGAAGGGAGGGAGG + Intronic
1173591547 20:44228845-44228867 ATGCCGGGTGGGGGGGTGGGGGG - Intergenic
1173607167 20:44339709-44339731 GTGCAGGGTGGTGGGGTTGGGGG + Intronic
1173735773 20:45360281-45360303 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1173843203 20:46172475-46172497 TCGCAGGGTGGAGGAGTGGTGGG - Intergenic
1173856843 20:46255708-46255730 AAGAAGGGAGGAAGGGAGGGAGG - Intronic
1173974751 20:47178802-47178824 TAGATGGGTGGATGGGTGGGTGG + Intronic
1174038601 20:47683351-47683373 AAGAACCGTGGAGGGGAGGGCGG - Intronic
1174098694 20:48109987-48110009 TAGAAGGGTGAAGGGGTGGGTGG - Intergenic
1174175331 20:48640923-48640945 TAGTTGGGTGGAGGGGTGGATGG + Intronic
1174198501 20:48790436-48790458 AAGGAGGGTGGAGGGCTGCAAGG + Intronic
1174252587 20:49230760-49230782 GAGCTGGGGGGCGGGGTGGGGGG - Intronic
1174287334 20:49482713-49482735 GAGCCTGGTGGAGAGGTGGGGGG - Intergenic
1174404415 20:50294250-50294272 AAGGAGGCTGAAGGGGTGTGAGG + Intergenic
1174468822 20:50739856-50739878 AAGTAGAGGGGAAGGGTGGGGGG + Intronic
1174533782 20:51235648-51235670 AAGGAGGCTGGAGGGGAAGGAGG + Intergenic
1174725126 20:52853329-52853351 CAGCAGAGTGGAGGGGGAGGGGG - Intergenic
1174824114 20:53753852-53753874 AAGCAGGGTGGGGCGGGGGTGGG - Intergenic
1174875437 20:54222444-54222466 AAGCAGGGCAGAGGAGGGGGAGG + Intronic
1175094424 20:56530148-56530170 TGGGAGGGTGGATGGGTGGGTGG - Intergenic
1175213989 20:57380443-57380465 AAGCAGGATGGAGCTGTGGTGGG + Intergenic
1175284196 20:57826901-57826923 AAGCAGAATGGAGAGGTGAGGGG - Intergenic
1175385632 20:58593180-58593202 AAGAAGGCTGGAAGGGTGGAGGG - Intergenic
1175407381 20:58743983-58744005 GAGGAGGGTGGAGGGATGGGTGG + Intergenic
1175419629 20:58823137-58823159 CAGCAGGATGGAGGGGCAGGGGG - Intergenic
1175518910 20:59587278-59587300 AAGCAGGGTGGAGGAGATGCAGG + Intronic
1175526588 20:59638691-59638713 TAGGTGGGTGGAGGGATGGGTGG + Intronic
1175678797 20:60969313-60969335 AAGAGGGGTGGAGTGGTGGGAGG - Intergenic
1175765864 20:61592618-61592640 AAGCAGGGTGGAGGGGGAAAGGG - Intronic
1175809845 20:61852131-61852153 AATATGGGTGGTGGGGTGGGGGG - Intronic
1175814569 20:61876829-61876851 CTGCCGGGTGGAGGGCTGGGAGG + Intronic
1175817860 20:61892998-61893020 AGGGATGGTGGATGGGTGGGTGG + Intronic
1175817921 20:61893235-61893257 AGGGATGGTGGATGGGTGGGTGG + Intronic
1175824882 20:61931409-61931431 AAGCGGAGTGGAGGCTTGGGAGG - Intronic
1175825399 20:61933988-61934010 ATGCAGGGTGGAAGGGGGGCTGG + Intronic
1175862373 20:62157212-62157234 TAGAAGTGGGGAGGGGTGGGTGG - Intronic
1175909100 20:62396155-62396177 AAGCAGTGTGGTGGGGAGGAGGG + Intronic
1175917075 20:62430981-62431003 TCGCAGGGTGGAGGGAAGGGAGG - Intergenic
1175934557 20:62509084-62509106 GTGGAGGGTGGAGGGGTGGAGGG - Intergenic
1175934655 20:62509361-62509383 GTGGAGGGTGGAGGGGTGGAGGG - Intergenic
1175934728 20:62509543-62509565 ATGGAGGGTGGAGGGGTGGAGGG - Intergenic
1175934936 20:62510100-62510122 ATGGAGGATGGAGGGGTGGAGGG - Intergenic
1175935037 20:62510390-62510412 ATGGAGGGTGGAGGGGTGGAGGG - Intergenic
1176009175 20:62882780-62882802 CAGTAGTGTGGAGGGGAGGGAGG + Intronic
1176070800 20:63225273-63225295 AAGCAGGCTGGAGGGGCAAGAGG + Intergenic
1176304013 21:5114107-5114129 AAGCAGCTGGGAGTGGTGGGGGG + Intergenic
1176372657 21:6071708-6071730 CAGCAGGGTGGTCGGGGGGGGGG + Intergenic
1176546568 21:8204861-8204883 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176554462 21:8249052-8249074 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176565519 21:8387908-8387930 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176573384 21:8432076-8432098 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1177109755 21:17010858-17010880 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1177169726 21:17641665-17641687 AAGGAGGCTAGAGAGGTGGGAGG + Intergenic
1177845813 21:26286287-26286309 ATTGTGGGTGGAGGGGTGGGAGG - Intergenic
1178357855 21:31923516-31923538 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
1178598312 21:33974651-33974673 AAGAAGGGGGATGGGGTGGGAGG - Intergenic
1178627350 21:34229174-34229196 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1178723050 21:35027124-35027146 GGGCAGGGTGGAGGGGCAGGGGG + Intronic
1178946884 21:36956190-36956212 AAACTGGGAGGAGGGGTAGGGGG + Intronic
1179019286 21:37623621-37623643 AAGAAGGGAGGAAGGGAGGGAGG - Exonic
1179218846 21:39389079-39389101 AAGAAGGGAGGAAGGGAGGGAGG - Intronic
1179412030 21:41168999-41169021 CAGCATGGTGGTGGGGTGGGGGG - Intronic
1179502988 21:41821514-41821536 CAGCAGGGAGGAGGAGGGGGAGG + Intronic
1179582553 21:42352591-42352613 AAGCAGAGAGGAGAGGTGGGTGG - Intergenic
1179649522 21:42798419-42798441 AAGCGGGTGGGAGGGGAGGGTGG + Intergenic
1179707257 21:43188832-43188854 AAGAAGGGTGGTGGGGGCGGGGG - Intergenic
1179725850 21:43340841-43340863 AGGTAGGTTGGAGGGGTTGGGGG + Intergenic
1179731122 21:43367928-43367950 ATGCAGGGTGGTGGTGTGAGGGG - Intergenic
1179853017 21:44147843-44147865 AAGCAGCTGGGAGTGGTGGGGGG - Intergenic
1179874848 21:44262380-44262402 GTGGAGGGTGGAGGGGTGGAGGG + Intergenic
1179888246 21:44323668-44323690 CAGCAGGGAGCAGGGCTGGGCGG + Intronic
1180012149 21:45058462-45058484 AAGGAGGGTGGTGGGGGGAGTGG + Intergenic
1180013082 21:45064240-45064262 AAGAAGGGTGGGAGGGTAGGAGG - Intergenic
1180074742 21:45456734-45456756 CAGCAGGGTGGCGGGGCGGGCGG - Intronic
1180228982 21:46414897-46414919 CAGCAGGGAGGAGGGGGAGGAGG - Intronic
1180298053 22:10962093-10962115 AAACAGGGCGGAGGTGTGGAGGG + Intergenic
1180315113 22:11271357-11271379 CAGCTGGGTGGAGGGTGGGGTGG + Intergenic
1180651333 22:17379410-17379432 CCGCAGGGAGGAGGGGTGAGGGG + Intronic
1180938561 22:19641905-19641927 GAGGAGGGAGGAGGGGAGGGAGG + Intergenic
1180981373 22:19879607-19879629 GTGCAGGGTGGTGGGGGGGGTGG + Intronic
1181033618 22:20159654-20159676 TAGCTGGGTGGTGGTGTGGGTGG - Intergenic
1181064241 22:20298304-20298326 AAGCAGGTGGGTGAGGTGGGAGG + Intergenic
1181279778 22:21710997-21711019 ACGCGGGGTGGGGGGGTGGCAGG + Intronic
1181335426 22:22124897-22124919 CAGCAGTGTGGGGGGGGGGGTGG + Intergenic
1181490005 22:23255772-23255794 AAGCAGGGAGCAGGGGTCGGGGG - Intronic
1181681786 22:24500425-24500447 ATGCAGGCTGGAGGGATGTGGGG - Intronic
1181822638 22:25487629-25487651 AAGGCGGGTGGAAGGGTGGGTGG + Intergenic
1181822698 22:25487892-25487914 AAGGTGAGTGGAAGGGTGGGTGG + Intergenic
1181822719 22:25487960-25487982 AAGGTGGGTGGAAGGGTGGGTGG + Intergenic
1181853360 22:25765689-25765711 AAAAAGGGTGGCAGGGTGGGGGG + Intronic
1182013272 22:27018374-27018396 AGGATGGGTGGAAGGGTGGGTGG - Intergenic
1182024002 22:27103046-27103068 AGGGAGGATGGAGGGGTGGCAGG + Intergenic
1182134663 22:27890219-27890241 ATGGAGGGTGTGGGGGTGGGCGG - Intronic
1182361280 22:29747956-29747978 AAGCAGGGGGCGGAGGTGGGGGG - Intronic
1182487806 22:30649694-30649716 AGGCAGGATGGAGGGATGGATGG + Intronic
1182569513 22:31226033-31226055 AGGCAGGGTGGGGGGATGAGAGG + Intronic
1182895554 22:33856320-33856342 AAGCTGGGTGGGTGGGTGGTGGG + Intronic
1182948726 22:34350563-34350585 GAGCAGGGTGGAGAGGGGAGGGG + Intergenic
1183080341 22:35451963-35451985 CTGCAGGGTGATGGGGTGGGAGG + Intergenic
1183100002 22:35578198-35578220 AAGGAAGGTGGATGTGTGGGTGG + Intergenic
1183100021 22:35578275-35578297 AAGGAAGGTGGATGGATGGGTGG + Intergenic
1183298001 22:37043447-37043469 AAGCGGGGTTGGGGAGTGGGTGG + Intergenic
1183306725 22:37086724-37086746 TAGCAGGGTGGAGGGGTCTGGGG - Intronic
1183313244 22:37123125-37123147 AAGGAGGGTGGAATGTTGGGTGG - Intergenic
1183329899 22:37213735-37213757 AAGCCGTGGGTAGGGGTGGGTGG - Intergenic
1183357817 22:37368886-37368908 CAGAAGGGTGGGTGGGTGGGTGG - Exonic
1183474889 22:38030766-38030788 ATGCAGTGGGGAGGTGTGGGTGG + Intronic
1183629816 22:39026193-39026215 GTCCAAGGTGGAGGGGTGGGTGG + Intronic
1183633258 22:39046052-39046074 GTCCAAGGTGGAGGGGTGGGCGG + Intronic
1183639012 22:39082113-39082135 GTCCAAGGTGGAGGGGTGGGCGG + Intronic
1183649139 22:39144407-39144429 AAGGAGGGTGGAGGAGGGGCAGG - Intronic
1183651023 22:39153197-39153219 AGGGCGGATGGAGGGGTGGGTGG - Intergenic
1183772159 22:39936201-39936223 CAGAAGGGTGGAGGGCGGGGTGG - Intronic
1183952351 22:41358772-41358794 AGGTAGGGTGGAGAGGAGGGGGG - Exonic
1183952605 22:41359895-41359917 AAGCATGGGGGCGGGGTGGGTGG + Exonic
1183977162 22:41519019-41519041 AAGCAGCCTGGAGCAGTGGGTGG + Intronic
1184059967 22:42075429-42075451 TGGCTGGGTGGATGGGTGGGGGG + Intronic
1184300550 22:43556205-43556227 AGGCAGGGGTCAGGGGTGGGGGG + Intronic
1184409113 22:44316399-44316421 AACCAGGGTGGGGGGTGGGGGGG + Intergenic
1184411464 22:44328764-44328786 GGGCAGGGAGGAGGGGAGGGTGG - Intergenic
1184434181 22:44460187-44460209 TAGCAGGGTAGATGGGTGGGTGG - Intergenic
1184644060 22:45886559-45886581 AAGGAGGGTGCTGGGGTGGGTGG - Intergenic
1184739137 22:46416967-46416989 AGGCGGTGTGGGGGGGTGGGAGG + Intronic
1184780739 22:46648103-46648125 TAGATGGGTGGACGGGTGGGTGG + Intronic
1184856824 22:47150850-47150872 CAGCAGGGTGGTGGGGGCGGAGG - Intronic
1184977554 22:48073618-48073640 TAGATGGGTGGATGGGTGGGTGG - Intergenic
1184980055 22:48089575-48089597 AGGCAGGGAGGAGGGATGGGAGG + Intergenic
1185053499 22:48565957-48565979 CAGCTGGGTGGATGGGTGGATGG + Intronic
1185081132 22:48710034-48710056 AAGCAAGGTAGAGGGGGTGGTGG - Intronic
1185108519 22:48887682-48887704 ATGGATGGTGGATGGGTGGGTGG - Intergenic
1185111292 22:48901551-48901573 AAGCAGGGAGGAGGCTTGGTGGG + Intergenic
1185111616 22:48903217-48903239 AAGCAGGGAGGAGGCTTGGTGGG - Intergenic
1185154596 22:49185620-49185642 GAGAAGGATGGATGGGTGGGTGG - Intergenic
1185175535 22:49324421-49324443 AAGCAGAGTGGGGACGTGGGTGG - Intergenic
1185228472 22:49667421-49667443 AGCCGGGGTGGAGGGGTGTGGGG - Intergenic
1185276050 22:49950556-49950578 TAGGGGGGTGGGGGGGTGGGGGG + Intergenic
1185297020 22:50059306-50059328 ACACAGGGAGGAGGGGCGGGTGG - Intergenic
1203251433 22_KI270733v1_random:121127-121149 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1203259483 22_KI270733v1_random:166209-166231 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1203303603 22_KI270736v1_random:94091-94113 AAGGAGTGTAGAGGAGTGGGTGG + Intergenic
949105786 3:198113-198135 CAGCAGGGTGGAGCGCAGGGTGG + Intronic
949549859 3:5104046-5104068 AAGGAGGGGGGAGGAGGGGGAGG - Intergenic
949736438 3:7177527-7177549 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
949881366 3:8663555-8663577 CAGCAGTGGGGCGGGGTGGGGGG + Intronic
949937421 3:9126767-9126789 CAGAAGGGTGAGGGGGTGGGAGG + Intronic
950093676 3:10315468-10315490 AGGCTGGGTGGGTGGGTGGGTGG + Intronic
950156280 3:10723777-10723799 AAGGAGGGTGGGGGAGGGGGAGG + Intergenic
950256754 3:11512224-11512246 AAGGAGGGGAGAGGGGTGTGGGG - Intronic
950263402 3:11558455-11558477 AATCATGGGGGTGGGGTGGGGGG - Exonic
950443821 3:13024711-13024733 CAGATGGGTGGATGGGTGGGTGG - Intronic
950456346 3:13095049-13095071 AAGCAAGGTGGAGAGGAGGGGGG - Intergenic
950541907 3:13617922-13617944 AAGCAGGATGGATGGATGGGTGG - Intronic
950672358 3:14534926-14534948 AAGAAGCGTGGGGGAGTGGGTGG + Intronic
950677524 3:14563631-14563653 AGGCAGGGAGGAGGGGTGTAGGG + Intergenic
950941960 3:16901864-16901886 GGGCAGGGTGGAGGGGTGAATGG - Intronic
951150062 3:19278141-19278163 ATGCAGGGTGGAGGGCTTGCTGG + Intronic
951336448 3:21428558-21428580 AAGCAGGGGGTGGGGGTGCGGGG - Intronic
951577512 3:24128756-24128778 AAGCTGGGTGGGGGCGGGGGTGG + Intronic
952022143 3:29036030-29036052 AACCGGGGTCGGGGGGTGGGGGG - Intergenic
952278839 3:31903844-31903866 AAGCAGGGTGACGGGGTTGCGGG + Intronic
952367047 3:32684233-32684255 AAGTAGTGTGGAAGGGTAGGAGG + Intergenic
952504914 3:33998879-33998901 AAGCAGGGTGGGGCATTGGGAGG + Intergenic
952846076 3:37689051-37689073 TGGCTGGGTGGATGGGTGGGCGG + Intronic
953357357 3:42266227-42266249 AGGCGGGGTGGGGGGGTTGGGGG + Intergenic
953357419 3:42266621-42266643 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
953494329 3:43373155-43373177 AAGCTGGGTGAAGGGGTGGGTGG + Intronic
953797037 3:45993908-45993930 AAGCAGGGTGGGTGGGGGTGAGG + Intronic
954112953 3:48446021-48446043 TAGCAGGATAGAGGGGTAGGAGG - Intergenic
954325348 3:49860446-49860468 GAGCAGGGTCCAGGGGAGGGTGG - Intronic
954378911 3:50209276-50209298 AAGGAGGGTCCAGGGCTGGGTGG + Intronic
954408142 3:50356867-50356889 AAGCAGGTTGGTGGGGAGGAAGG - Intronic
954609047 3:51934594-51934616 AGGCAGGGAGGAGGGGTCGCCGG - Intronic
954865187 3:53722947-53722969 AAGCAGGCTGGAGAGGTAGAGGG - Intronic
955059837 3:55485166-55485188 ATGAAGGGAGCAGGGGTGGGAGG + Intronic
955101580 3:55854850-55854872 AAGGAGGCTGGTGGGGAGGGTGG + Intronic
955257494 3:57348342-57348364 TGGCAGGGTTGAGGGGAGGGAGG + Intronic
955333042 3:58063273-58063295 AGGCATGGTGCAGGGATGGGTGG - Intronic
955333981 3:58069972-58069994 AATGAGGATGGAGGGGAGGGAGG + Intronic
955363758 3:58294355-58294377 CAGCAGGGTACATGGGTGGGAGG + Exonic
955675536 3:61444359-61444381 AAGCAGGGTGGAGGGAGGGAGGG - Intergenic
955736353 3:62042548-62042570 ATGCAGGGTGGCGGTGCGGGAGG - Intronic
955856181 3:63276621-63276643 AACTATGGGGGAGGGGTGGGGGG - Intronic
955858702 3:63303281-63303303 AAGCAGGGTGGTGTAGAGGGAGG + Intronic
956035800 3:65089963-65089985 AAGTGGGGTGGAGGGGGGGGCGG - Intergenic
956089900 3:65655129-65655151 AAGCAGGGTAGAGTGGAGCGGGG + Intronic
956174403 3:66459416-66459438 ATGCACGATGGAGGGGTGCGTGG - Intronic
956257475 3:67298976-67298998 TAGAAGGGTGGAGGGGTTGTAGG + Intergenic
956358039 3:68415490-68415512 GAGGAGGTTGGAGGGATGGGAGG + Intronic
956365485 3:68497514-68497536 TGGGAGGGTGGAAGGGTGGGAGG + Intronic
956629579 3:71302899-71302921 AATTAGGGAGGAGGGGTGGTTGG - Intronic
956805339 3:72804421-72804443 TCGGAGGGTGGCGGGGTGGGGGG - Intronic
956913635 3:73847423-73847445 AAGCAGGCTGGAGGGGAAAGGGG + Intergenic
956960382 3:74392387-74392409 AAGCAGGGTGGAAGGGAGGGAGG - Intronic
957047254 3:75385656-75385678 AAATGGGGTGGAGGGGTGGGGGG - Intergenic
957179767 3:76861465-76861487 AAGAAGGGAGGAGGAGTGAGAGG - Intronic
957646610 3:82939163-82939185 GACCAGGGTGGGGGGTTGGGGGG - Intergenic
958087219 3:88825674-88825696 AAGCAGGGGGGAGTGTTGTGTGG + Intergenic
958108694 3:89111512-89111534 AACCATGGAGGCGGGGTGGGGGG - Intronic
958456002 3:94332093-94332115 AGGCAGTGGGGCGGGGTGGGGGG - Intergenic
959022039 3:101198307-101198329 GGGGAGGGGGGAGGGGTGGGGGG - Intergenic
959510562 3:107206889-107206911 AGGCTGGGTGGAGGGTTGAGGGG - Intergenic
959524872 3:107365556-107365578 AGGAAGGGTGGGAGGGTGGGAGG + Intergenic
959637750 3:108594405-108594427 AGGGAGGGGGGAGGGGAGGGGGG - Intronic
959859929 3:111205486-111205508 AAGCAAGTTCGAGGTGTGGGAGG - Intronic
960338350 3:116445586-116445608 GGGGAGGGTGGGGGGGTGGGGGG - Intronic
960469633 3:118046598-118046620 TTGCCGGGAGGAGGGGTGGGTGG + Intergenic
960786235 3:121375007-121375029 CAGAAGGGTGGGAGGGTGGGAGG + Intronic
961008350 3:123419929-123419951 GTGCTGGGTGGAGGGGTGGGGGG - Intronic
961038374 3:123659577-123659599 AAGGCAGGTGGAGGAGTGGGAGG - Intronic
961164141 3:124751892-124751914 TGGCAGGGTGGCGGGGCGGGGGG - Intergenic
961265105 3:125635271-125635293 ACCCTGGGTGGAGGGGGGGGCGG - Intergenic
961345488 3:126260797-126260819 AAGAAGGGTGGGGAGGAGGGGGG - Intergenic
961452162 3:127007133-127007155 AAGCAGGGTGGTGGGGGAGCTGG + Intronic
961454796 3:127018604-127018626 AAGCAGGGTGGGGGCGGCGGTGG - Intronic
961457735 3:127032585-127032607 GAGCTGGGTGGAGAGGTAGGTGG + Exonic
961561407 3:127732921-127732943 GAGCTGGGAGGAGCGGTGGGTGG + Intronic
961640331 3:128360903-128360925 CAGCAGGGAGTGGGGGTGGGAGG - Intronic
961678321 3:128582015-128582037 AAGAGAGGGGGAGGGGTGGGAGG - Intergenic
961772864 3:129263047-129263069 GAGCAGAGTGGAGGGGTGACTGG + Intronic
961879322 3:130049757-130049779 AAATGGGGTGGAGGGGTGGGGGG - Intergenic
961957009 3:130814904-130814926 CAGCAGTGGGGCGGGGTGGGGGG + Intergenic
962315200 3:134354908-134354930 AGGCAGGCTGGAGGGTTGGGTGG + Intergenic
962630886 3:137274300-137274322 AAGCGGGGGGGAGGGGGTGGAGG + Intergenic
962727992 3:138252749-138252771 AGGCCGGGTGGGGGGGGGGGGGG - Intronic
962745060 3:138390735-138390757 TAGCAGGGAGGAGGGGTGTGTGG - Intronic
962769695 3:138600913-138600935 AAGGAGGGAGGAGGGGGAGGAGG + Intergenic
962769705 3:138600938-138600960 AAGGAGGGAGGAGGGGGAGGAGG + Intergenic
962848928 3:139293446-139293468 AAGTAGGGTTGGGGGGTGGCTGG + Intronic
963028378 3:140942175-140942197 GAGGGGGGTGGGGGGGTGGGGGG + Intronic
963037731 3:141047216-141047238 AGGCAGGGAGGAAGGGAGGGAGG - Intergenic
963104967 3:141639138-141639160 AGGCTGAGTGGGGGGGTGGGGGG + Intergenic
963406316 3:144868227-144868249 AAGCAGGAGAGAGGGGAGGGAGG - Intergenic
963440537 3:145334061-145334083 CAGCAGGATGGGGGGGGGGGAGG + Intergenic
963496600 3:146071246-146071268 AAATAGGCTGGAGGGGTGAGAGG + Intronic
964548466 3:157860643-157860665 AAGCTGGGCGGGGGGGGGGGGGG + Intergenic
964601753 3:158508901-158508923 AATCAGGGAGCAGAGGTGGGAGG - Intronic
964618909 3:158700884-158700906 AAGCAGGGTGGAGGGGCATGGGG - Intronic
964629419 3:158794076-158794098 CAGAAGGGTGAAGGGTTGGGAGG - Intronic
964828017 3:160850963-160850985 AAACAGGGAGGTGGGGTGGGGGG - Intronic
965630302 3:170726104-170726126 TAGCCGGGTGTAGTGGTGGGTGG + Intronic
965798284 3:172464704-172464726 CAGCAGAGTTGAGGGGTAGGAGG + Intergenic
966075251 3:175928232-175928254 AAACAAGGGGGAGGGGAGGGAGG + Intergenic
966205126 3:177398322-177398344 AAGCAGGAGAGAGGGGAGGGAGG + Intergenic
966452705 3:180079612-180079634 AATCATGGTGGAAGGGTGGAGGG + Intergenic
966461502 3:180181709-180181731 AAGGAGGGAGGATGGGAGGGAGG - Intergenic
966846466 3:184134550-184134572 AAGCAGAGTGGAGACGGGGGTGG - Intergenic
967020405 3:185517401-185517423 TAGCAGGGTGGAGAGGTGTGGGG + Intronic
967236949 3:187394081-187394103 AAGCAGGCTGGAGGGGAAAGAGG + Intergenic
967844106 3:194030952-194030974 AAGCAGCCAGGAGGTGTGGGTGG - Intergenic
968011322 3:195280068-195280090 AAGCTGGGTGGGGGGGTTGGGGG + Intronic
968095235 3:195925268-195925290 CAGGAGGGTGGGAGGGTGGGAGG - Intergenic
968113040 3:196065409-196065431 AAGCGGGGCGGGGGGGGGGGGGG + Intronic
968180210 3:196589267-196589289 CAGCAGGAGGGTGGGGTGGGGGG - Intergenic
968192283 3:196677443-196677465 CAGCTGGCTTGAGGGGTGGGGGG - Intronic
968380997 4:95699-95721 AAGCAGGGTTGGGGGGGTGGGGG - Intergenic
968606605 4:1538386-1538408 GAGGTGGGGGGAGGGGTGGGAGG + Intergenic
968708611 4:2096002-2096024 AAGCACAGTGGTGGGGTGTGTGG - Intronic
968758270 4:2427884-2427906 AAGCTGGGAGCAGGGATGGGTGG - Intronic
968938130 4:3624288-3624310 CAGCAGGCAGGATGGGTGGGTGG + Intergenic
969104440 4:4794616-4794638 AAGCAGGATGGAGAGGGAGGAGG - Intergenic
969296901 4:6275583-6275605 ATGCACGGGGGTGGGGTGGGGGG + Intronic
969308007 4:6336648-6336670 AAGCAGGGAGGGAGGGAGGGAGG - Intronic
969423164 4:7108902-7108924 GGGCAGAGAGGAGGGGTGGGTGG - Intergenic
969571641 4:8012327-8012349 TAGATGGGTGGATGGGTGGGTGG - Intronic
969571680 4:8012510-8012532 TAGATGGGTGGATGGGTGGGTGG - Intronic
969627981 4:8317312-8317334 CAGCAGGGTGGGGTGATGGGGGG + Intergenic
969701640 4:8770904-8770926 GGGCGGGGTGGAGGGGGGGGTGG + Intergenic
969712842 4:8854076-8854098 AGACAGGGAGAAGGGGTGGGTGG - Intronic
970191607 4:13523719-13523741 AAGTGGGGTGGGGGGGTGCGGGG + Intergenic
970444496 4:16112649-16112671 GGGGAGGGTGGAGGGGAGGGTGG + Intergenic
970448074 4:16140495-16140517 GAGCTGGGGGAAGGGGTGGGTGG - Intergenic
971034143 4:22675074-22675096 AGGAAGGGGGGAGGGGAGGGAGG - Intergenic
971217409 4:24674090-24674112 AAGGAGGGTGGAGGGGAAGAGGG - Intergenic
971261747 4:25063497-25063519 AAGAATGGTAGAGGGATGGGAGG + Intergenic
971425016 4:26507501-26507523 AAGAAGGATGGAGGGATGGATGG + Intergenic
971756623 4:30717030-30717052 AAGCCGGGGGGGGGGGGGGGGGG + Intergenic
971788643 4:31138211-31138233 AGGCAGGGTAGATGGATGGGTGG - Intronic
971917047 4:32884739-32884761 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
971949597 4:33327728-33327750 CTCCAGGGTGGCGGGGTGGGGGG - Intergenic
971984752 4:33807363-33807385 AAGCAGGGTCGGGGGTCGGGGGG - Intergenic
972106788 4:35497562-35497584 TTGGAGGGTGGAAGGGTGGGAGG + Intergenic
972204788 4:36758967-36758989 AAGCAGCGGAGCGGGGTGGGGGG - Intergenic
972431856 4:38990618-38990640 AAGAAGGCTGCAGGGATGGGTGG - Intronic
972437313 4:39045819-39045841 TGGGAGGGTGCAGGGGTGGGTGG - Intronic
972511085 4:39769674-39769696 AAGAAGGGTGGGGGGGTGGGTGG - Intronic
972559107 4:40210640-40210662 AGGCAGGGTGGGTGGGTGTGGGG + Intronic
972670731 4:41212446-41212468 AAGCTGGATGGTGAGGTGGGAGG - Intronic
973161244 4:47019589-47019611 AAGAAGGGAGGAAGGGAGGGAGG - Intronic
973570736 4:52236910-52236932 AAGCGGGGATGAGGGGTGGAAGG + Intergenic
973723884 4:53752718-53752740 AAGCAGTGGGGTGGGATGGGTGG - Intronic
973758172 4:54095055-54095077 AAGCAGCGGGGAGAGGGGGGTGG - Intronic
974834879 4:67236483-67236505 ATTCAGGGTGAAGTGGTGGGTGG + Intergenic
975217214 4:71769754-71769776 AAGCAGGGTGGGAAGGAGGGAGG - Intronic
975400326 4:73929961-73929983 AAGGAGGGTGGAGGGTGGGAGGG + Intergenic
975905319 4:79204514-79204536 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
976052119 4:81021800-81021822 AAACAGGGTGGAGGAGTTGTTGG + Intergenic
976586296 4:86800701-86800723 AAGCAGGGAGGGAGGGAGGGAGG + Intronic
976598661 4:86917597-86917619 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
976717133 4:88135183-88135205 TAGAAGGGTGGAGGGTGGGGTGG - Intronic
976815944 4:89148601-89148623 TTGCAGGGAGGCGGGGTGGGGGG + Intergenic
977014317 4:91673647-91673669 AGGAAGGGAGGAGGGGAGGGAGG - Intergenic
977290550 4:95160571-95160593 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
977290559 4:95160594-95160616 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
977420172 4:96789635-96789657 AGGCAGGGAGGAGGGATGGCAGG - Intergenic
977654625 4:99506404-99506426 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
977658508 4:99554158-99554180 AAGTAGGTTGGAGGGGTCTGAGG - Intronic
977727692 4:100316387-100316409 ACACAAGGTGTAGGGGTGGGGGG - Intergenic
977996831 4:103504866-103504888 AAGCAAGTTAGAGAGGTGGGGGG - Intergenic
978364299 4:107964625-107964647 CAGGGGGGTGGGGGGGTGGGGGG - Intergenic
978493590 4:109334762-109334784 AATGTGTGTGGAGGGGTGGGGGG - Intergenic
979187537 4:117816433-117816455 AAGCAGGGTGGGGAGGTGGCGGG - Intergenic
979506462 4:121502757-121502779 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
979523627 4:121696169-121696191 AAGTCGGGGGGCGGGGTGGGGGG + Intronic
979640836 4:123011826-123011848 AGACAGAGTGAAGGGGTGGGGGG + Intronic
979938051 4:126722365-126722387 ATGCAGGGGGGTGGGGGGGGGGG + Intergenic
980061303 4:128133126-128133148 AACCACGGTTGAGTGGTGGGTGG - Intronic
980071022 4:128243059-128243081 GAGCTGGGTGGGTGGGTGGGTGG + Intergenic
980157625 4:129126361-129126383 AAGCTTGGTGGAGGGAGGGGGGG - Intergenic
980284791 4:130768544-130768566 AGACAGGGAGAAGGGGTGGGGGG - Intergenic
981413338 4:144458755-144458777 AAGGAGGGAGGAGGGGAGGAAGG + Intergenic
981743801 4:148032087-148032109 AAGAAGGGGAGAGGAGTGGGAGG - Intronic
982036015 4:151346552-151346574 ATCCGGGGTGGACGGGTGGGTGG - Intergenic
982270030 4:153577095-153577117 TAGCTAGGTGGAGAGGTGGGTGG + Intronic
982558632 4:156900894-156900916 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
982863414 4:160482036-160482058 GAGCCGGGGGGAGGGGTGGGAGG - Intergenic
983028249 4:162764608-162764630 AAGAGGGGAGGAGGGGTGGAGGG + Intergenic
983481932 4:168285721-168285743 ATGCATGGGGGATGGGTGGGTGG + Intronic
983653159 4:170053605-170053627 AAGGAGGGGGGAGGGGGAGGGGG - Intergenic
983886167 4:172982977-172982999 CAGAAGGGTGAATGGGTGGGAGG + Intronic
984149392 4:176107988-176108010 AAGAAGGGTGGAAGGGAGGAAGG - Intronic
984355846 4:178655888-178655910 AAGGATGGTGGTGGGGTGGGAGG + Intergenic
984461385 4:180041184-180041206 AAGGATGGGGGTGGGGTGGGGGG + Intergenic
984551747 4:181169019-181169041 AAGGAGGGTGAAGGGGTGAACGG - Intergenic
984851637 4:184158397-184158419 AATCAGCGGGGTGGGGTGGGGGG + Intronic
984873831 4:184350051-184350073 AAGCAGGGGGAAAGGGTGAGGGG + Intergenic
984963409 4:185120092-185120114 AAATAGAGTGGAGGGCTGGGGGG + Intergenic
985139233 4:186821931-186821953 AGCCAGGGTGGGGGGCTGGGGGG - Intergenic
985436976 4:189940247-189940269 AAACAGGGCGGAGGCGTGGAGGG - Intergenic
985546294 5:510799-510821 CTGCTGGGTGCAGGGGTGGGCGG + Intronic
985648566 5:1096766-1096788 AAGGAGGGAGGGGGGGAGGGAGG + Intronic
985669437 5:1200104-1200126 GTGCAGGGTGGAGGTGGGGGCGG + Intergenic
985685579 5:1279958-1279980 AAGCAGCGTGGGGGTGTAGGGGG - Intronic
985789870 5:1919926-1919948 AGGCGGGGTGGAAGGATGGGAGG - Intergenic
985821182 5:2161213-2161235 TTGGAGGGTGGATGGGTGGGTGG - Intergenic
985938896 5:3118471-3118493 AAGGAGGGTGGAGGGGGTGCTGG - Intergenic
985951062 5:3221644-3221666 GAGCAGGGCAGAGGGGTGGGTGG + Intergenic
985976008 5:3419606-3419628 GAGCGGGGGTGAGGGGTGGGAGG + Intergenic
985993689 5:3584567-3584589 ACGGAGGGAGGAGGGATGGGAGG + Intergenic
985993720 5:3584694-3584716 AAGGAGTGAGGAGGGATGGGAGG + Intergenic
985993772 5:3584901-3584923 AAGGAGGGAGGAGGGATGGGAGG + Intergenic
985993786 5:3584951-3584973 AAGGAGGGAGGAGGGATAGGAGG + Intergenic
985993845 5:3585176-3585198 AAGGAGGGAGGAGGGATGGGAGG + Intergenic
986224679 5:5801609-5801631 AAGGAGGGTGTAGTGGTGAGGGG + Intergenic
986370635 5:7077218-7077240 AAGGAGGGTGAAGGGAGGGGCGG - Intergenic
986651845 5:9971797-9971819 TGGAAGGGTGGAGGGGTGGAGGG + Intergenic
986718525 5:10541243-10541265 CAGCAGGGTGGAGGGATGCCAGG + Intergenic
986799734 5:11246716-11246738 TAGGTGGGTGGGGGGGTGGGGGG + Intronic
986884380 5:12215750-12215772 AAGCAGGGTGGGGAGTTGGGGGG + Intergenic
986917947 5:12647597-12647619 AAGCAGGGTGGCTGGGTGTGAGG + Intergenic
987129830 5:14850180-14850202 AAGCCGGTGGGAGTGGTGGGGGG - Intronic
987262842 5:16221080-16221102 AGGAAGGGTGAAGGGGTAGGAGG + Intergenic
987374091 5:17218038-17218060 TCGCATGGTGGAGGGGTGAGGGG + Intronic
987595157 5:19988376-19988398 ATGCACGGTGGGGGGTTGGGGGG - Intronic
987698360 5:21361595-21361617 AAGAAGGGTGGTTGGGTGGGAGG + Intergenic
988029669 5:25747139-25747161 AAGAAGGGTAGTGGGGTAGGGGG + Intergenic
988122326 5:26982118-26982140 AGGAAGGGAGGAAGGGTGGGAGG - Intronic
988599954 5:32630688-32630710 CACTAGGGTGGAGGGGCGGGTGG + Intergenic
988720741 5:33876600-33876622 AAGGAGGGAGGAGGGGAGGGAGG + Intronic
988754290 5:34229931-34229953 GAGAAGGGTGGTTGGGTGGGAGG - Intergenic
989105270 5:37857249-37857271 GTGCAGGGTGGGGGGGTCGGGGG - Intergenic
990347551 5:54884483-54884505 CAGCAGGCTGGAGGGTTGGGAGG + Intergenic
990770269 5:59236155-59236177 AAGCAGGGAGGAAGAGAGGGTGG - Intronic
990917081 5:60919249-60919271 TATGAGGGTGGATGGGTGGGAGG + Intronic
991208125 5:64073476-64073498 ATGAAGGGAGGAAGGGTGGGAGG - Intergenic
991261844 5:64676468-64676490 ATGCAGGGTGGTGGGGGGGGGGG + Intergenic
991518924 5:67472488-67472510 AAGGAGGGTGGAAGGAAGGGAGG - Intergenic
991584878 5:68191611-68191633 AATCTGGCTGGAGGGGTGGGAGG + Intronic
991690109 5:69217649-69217671 TAGTAGGGAGAAGGGGTGGGCGG + Intergenic
991742068 5:69690778-69690800 GAGAAGGGTGGTTGGGTGGGAGG - Intergenic
991755625 5:69864430-69864452 GAGAAGGGTGGTTGGGTGGGAGG + Intergenic
991793642 5:70270518-70270540 GAGAAGGGTGGTTGGGTGGGAGG - Intergenic
991821458 5:70566082-70566104 GAGAAGGGTGGTTGGGTGGGAGG - Intergenic
991834952 5:70739578-70739600 GAGAAGGGTGGTTGGGTGGGAGG + Intergenic
991886021 5:71270050-71270072 GAGAAGGGTGGTTGGGTGGGAGG - Intergenic
991997011 5:72397959-72397981 AAGCAGGCTGGAGGGGAAAGAGG + Intergenic
992199827 5:74372092-74372114 AAGCAGGGGGTGGGAGTGGGAGG - Intergenic
992456783 5:76923527-76923549 GGGCAGGCTAGAGGGGTGGGAGG + Intergenic
993204588 5:84863348-84863370 ATGGAGGGGGGAGGGGAGGGAGG - Intergenic
993436286 5:87899623-87899645 AAGGGGGGTTGGGGGGTGGGTGG + Intergenic
993532741 5:89044182-89044204 AAAAAGGGTGCTGGGGTGGGGGG - Intergenic
995397440 5:111702480-111702502 AAGAAGGGTGCATGGGTGGAAGG - Intronic
995850244 5:116537418-116537440 AAGCAGTGTTGAGGGGTCTGTGG + Intronic
996027131 5:118658617-118658639 AATCATGGTGGAAGGGTGAGGGG + Intergenic
996167414 5:120242303-120242325 AAGGAGGGAAGATGGGTGGGAGG - Intergenic
996849656 5:127937998-127938020 CAGCAGGGGGCAGGGGTGGAGGG - Intergenic
997449341 5:133969107-133969129 AAGGCGGGCGGGGGGGTGGGGGG - Intergenic
997500838 5:134371950-134371972 CCGCAGGGTGCAGGGGCGGGCGG - Intronic
997646722 5:135486989-135487011 AAGAAGGGTGGAGGGGCTGAAGG + Intergenic
997738009 5:136228618-136228640 AGGCAGGGGGCTGGGGTGGGGGG + Intronic
997824668 5:137095964-137095986 AATCTGGGTAGATGGGTGGGTGG + Intronic
998038445 5:138935936-138935958 ATGGAGGGTGTGGGGGTGGGCGG - Intergenic
998133778 5:139664183-139664205 GAGGAGGGTGGATGGGTGGGTGG + Intronic
998367226 5:141639436-141639458 CAGCAGGGAGGAGGGGAGTGAGG - Exonic
998398272 5:141833743-141833765 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
998400360 5:141845679-141845701 AAGCTGGGTGAAGGTGGGGGTGG - Intergenic
998451216 5:142235821-142235843 GAGCAGGGAGTGGGGGTGGGGGG + Intergenic
998499650 5:142621371-142621393 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
999184556 5:149696937-149696959 AAGCGGGGAGGAGGGGTGGGAGG + Intergenic
999287395 5:150402346-150402368 GAGCAGGGGGCAGGGGAGGGTGG - Intronic
999291734 5:150430281-150430303 AAGCAGGGAGGGTGGCTGGGGGG + Intergenic
999378160 5:151101336-151101358 AAGGAAGGGGCAGGGGTGGGGGG - Exonic
999633519 5:153596643-153596665 AAGCTGGGTGGAGGAGAGGCAGG + Intronic
999711239 5:154320474-154320496 AAGCAGGGTTGGGGGCGGGGTGG - Intronic
999904095 5:156120242-156120264 AAGAGGTGTGTAGGGGTGGGAGG + Intronic
1000064547 5:157683520-157683542 GAGGAGGAGGGAGGGGTGGGGGG - Intergenic
1000205181 5:159051431-159051453 CGGCGGGGTGGGGGGGTGGGGGG - Intronic
1000386086 5:160675861-160675883 AAGCAGGGGGGTGGGGGAGGGGG + Intronic
1000612965 5:163395425-163395447 AACTAGGGGGAAGGGGTGGGAGG + Intergenic
1000818388 5:165953072-165953094 AAGCAGGGGTTTGGGGTGGGGGG + Intergenic
1001109865 5:168886665-168886687 GAGTAGGGTGCAGGAGTGGGAGG + Intronic
1001269957 5:170303423-170303445 AAGCGGGGTGGAGTGGGGGCTGG + Intergenic
1001701890 5:173712680-173712702 AAGCAGGGAGGCTGGATGGGAGG + Intergenic
1001724653 5:173887075-173887097 AAACAGGAGTGAGGGGTGGGGGG + Intergenic
1002064172 5:176643886-176643908 AAAGAAGGTGGTGGGGTGGGGGG - Intronic
1002466597 5:179411865-179411887 AAGGTCGGTGGAGGGGAGGGTGG - Intergenic
1002466669 5:179412028-179412050 AAGGTCGGTGGAGGGGAGGGTGG - Intergenic
1002466699 5:179412098-179412120 AAGGTCGGTGGAGGGGAGGGTGG - Intergenic
1002466769 5:179412260-179412282 AAGGTCGGTGGAGGGGAGGGTGG - Intergenic
1002466919 5:179412603-179412625 AAGGTCGGTGGAGGGGAGGGTGG - Intergenic
1002476554 5:179469515-179469537 AAGCAGGGCCCTGGGGTGGGTGG + Intergenic
1002539027 5:179893920-179893942 AAGGAGGGAGGAGGGCTTGGTGG + Intronic
1002570005 5:180134852-180134874 AGGAAGGGTGGACAGGTGGGTGG - Intronic
1002641952 5:180634799-180634821 CAGATGGGTGGATGGGTGGGTGG + Intronic
1002642051 5:180635107-180635129 AGTATGGGTGGAGGGGTGGGTGG + Intronic
1002819388 6:710869-710891 GAGCAGGGACGAGGGCTGGGAGG + Intergenic
1002926852 6:1610016-1610038 AACCAGGGCGGGGGGGGGGGGGG - Exonic
1003000543 6:2328258-2328280 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1003060408 6:2858273-2858295 AAACAGGGTGGAAGGGGGAGGGG - Intergenic
1003088019 6:3076990-3077012 GAGTAGGGAGCAGGGGTGGGTGG + Intronic
1003123773 6:3339061-3339083 GAGCAGGGTCGAGGGGAGGGAGG + Intronic
1003206620 6:4018680-4018702 TAGCAGCGGGGAGGCGTGGGAGG - Intergenic
1003263827 6:4549349-4549371 AAGCAGGGAGGGAGGGAGGGAGG + Intergenic
1003263839 6:4549381-4549403 AAGCAGGGAGGGAGGGAGGGAGG + Intergenic
1003406759 6:5832560-5832582 GAGGAGGGGGGAGGGGGGGGAGG + Intergenic
1003491763 6:6628330-6628352 AAGAAGGGAGGAAGGGAGGGAGG - Intronic
1003642422 6:7887195-7887217 CACCAGGGAGGAGGGGTTGGTGG + Intronic
1003774663 6:9346951-9346973 AAGCAGGGTGGAAGGGAATGTGG + Intergenic
1004298304 6:14434341-14434363 AAGGAAGGTGGTGGGGAGGGAGG - Intergenic
1004319460 6:14621307-14621329 AGGGAGGGTGGAGTTGTGGGTGG - Intergenic
1004562566 6:16763343-16763365 AAGCAGGGTGTTGGGGGCGGGGG - Intergenic
1004585897 6:17000088-17000110 GAGAAGGGTGGATGGATGGGTGG - Intergenic
1004893907 6:20128083-20128105 AGCCATGGTGGAGGGGCGGGGGG - Intronic
1005187917 6:23183507-23183529 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1005552473 6:26936786-26936808 GAGAAGGGTGGTTGGGTGGGAGG - Intergenic
1005714673 6:28535349-28535371 AATCAGTGTGGAGGGTTGGGGGG - Intergenic
1005841810 6:29748734-29748756 AAGCAGGGTTGAGGTGTGGCGGG + Intergenic
1005906305 6:30263806-30263828 ATGCAGGGAGGAAGGGAGGGAGG + Intergenic
1006027646 6:31157801-31157823 AATGAGGGTGGGAGGGTGGGAGG - Intronic
1006034856 6:31203010-31203032 GAGCAGAGTGGAAGGGTTGGGGG + Exonic
1006071095 6:31498408-31498430 AAGCAGGGCTGAGGTGTGGCGGG - Intronic
1006093692 6:31642977-31642999 ATGGAGGGTTGAGGGGTGGGTGG + Exonic
1006136526 6:31899530-31899552 AAGAAGGGTTGGGGGGTGGGTGG - Intronic
1006244931 6:32724514-32724536 AAGTAGGGTGATGAGGTGGGAGG + Intergenic
1006308589 6:33240821-33240843 AAGCAGGGTGGAGTGGGGGGAGG + Intergenic
1006319522 6:33312317-33312339 CAGGAGGGTGGAGGGAAGGGAGG + Intronic
1006342336 6:33453458-33453480 AAGCAGAGGGGCGGGGGGGGAGG - Exonic
1006419021 6:33921910-33921932 AAGCGGGGTGGAGGTGAGGCAGG + Intergenic
1006598278 6:35209279-35209301 GGGCAGAGAGGAGGGGTGGGAGG + Intergenic
1006681196 6:35797965-35797987 AAGGAAGGTTGAGGGGTGGGAGG - Intergenic
1006839640 6:37020462-37020484 CAGCACTGTGGAGGGGAGGGAGG - Intronic
1006957006 6:37882648-37882670 CAAAAGGGTGGAAGGGTGGGGGG - Intronic
1007167085 6:39836300-39836322 AAGAAGGCTGGAAGGCTGGGGGG - Intronic
1007387647 6:41530558-41530580 CAGCAGGTCGGGGGGGTGGGGGG - Intergenic
1007419844 6:41712884-41712906 AGGCCGGGTGGGGGAGTGGGTGG - Intronic
1007475080 6:42114259-42114281 AAGCATGGTGGTGAGGTGGTGGG - Intronic
1007635195 6:43295634-43295656 TCCCAGGTTGGAGGGGTGGGAGG + Intergenic
1007719787 6:43878224-43878246 AGGCAGGGTGGGGGTGAGGGAGG - Intergenic
1008219077 6:48833895-48833917 TAGGAGGGTGGAGGGGTGTTAGG + Intergenic
1008846014 6:55964980-55965002 AAGCGGGGAGGAGGGGAAGGGGG + Intergenic
1008912055 6:56745075-56745097 AAGTAGGGTGGAGGGGCGAGTGG - Intronic
1009495000 6:64335243-64335265 AAGTCGGGAGGGGGGGTGGGGGG - Intronic
1009497973 6:64374188-64374210 TGGGAGGGTGGAGGTGTGGGGGG + Intronic
1010630787 6:78195477-78195499 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1010698546 6:79010072-79010094 AAGAAGGGAGGAAGGGAGGGAGG + Intronic
1011442986 6:87407740-87407762 AAGCGGGGTGGGGGAGAGGGAGG - Intergenic
1011515457 6:88148040-88148062 AAGAAGATTGGAGAGGTGGGCGG - Intronic
1011840375 6:91490324-91490346 CAGATGGGTGGAAGGGTGGGAGG + Intergenic
1011933738 6:92747817-92747839 AAGCTGCTTGCAGGGGTGGGAGG - Intergenic
1012760366 6:103293990-103294012 CAGCAGGATGTAGGGGGGGGGGG - Intergenic
1013327618 6:109063283-109063305 TAGGAGGGTGGGGTGGTGGGAGG + Intronic
1013458835 6:110357023-110357045 AAGCGGGGTGGAGGTTGGGGTGG + Intronic
1013498191 6:110719978-110720000 AAGCAGGGGGGGGGTGGGGGGGG - Intronic
1014008710 6:116451454-116451476 AAGAAAGGTGAAGGGGTGGATGG + Intergenic
1014052399 6:116970064-116970086 AAGCTGGGTGGATGAGTGTGTGG - Intergenic
1014100545 6:117506699-117506721 TGGAAGGGTGGAAGGGTGGGAGG + Intronic
1014221545 6:118803439-118803461 GAGCATGGTGGGGGGGTGGGCGG + Intergenic
1015163965 6:130182621-130182643 AAGAAGGAGGGAGGGGAGGGAGG + Intronic
1015197309 6:130537502-130537524 AAGCAGTTTGTGGGGGTGGGTGG - Intergenic
1015282605 6:131449890-131449912 AGGCAGGGTTCAGGGGTGAGGGG - Intergenic
1015493633 6:133856260-133856282 AACCAAGGTGGAGGAGGGGGAGG - Intergenic
1016992965 6:149942382-149942404 CAGGAGGGTGGAGGGGCCGGAGG + Intronic
1017068669 6:150552440-150552462 AAGGTGTGTGGGGGGGTGGGGGG + Intergenic
1017642162 6:156504972-156504994 AAGCAGAGGGGAGAGGTTGGTGG - Intergenic
1017763293 6:157587648-157587670 AGGCAGTGTGGAGGGCAGGGCGG - Intronic
1017812923 6:157997023-157997045 AAGCTGGGTGGGGGGGGGTGGGG - Intronic
1017813554 6:158001134-158001156 ATGCAGGGTGCAGAGGAGGGCGG - Intronic
1017821809 6:158054261-158054283 TAGCTGGGTGGATGGGTAGGTGG - Intronic
1017920869 6:158870738-158870760 AAGAAGGGAGGAAGGGAGGGAGG - Intronic
1018132785 6:160748466-160748488 AGGGAGGGAGGAAGGGTGGGTGG + Intronic
1018143032 6:160858804-160858826 TGGCAGGGTGGGGGGGGGGGCGG - Intergenic
1018205725 6:161435937-161435959 GAGCAGGGGGGTGGGATGGGAGG + Intronic
1018719392 6:166561353-166561375 AAGAATGGTGGAGGGGAGGAAGG - Intronic
1018804018 6:167244772-167244794 AATGAGGGTGGAAGGGAGGGAGG + Intergenic
1018956749 6:168415514-168415536 AATGAGGGTGGAGGGCTGGGAGG + Intergenic
1018984155 6:168623236-168623258 GAGCAGGCTGGAGGGCTGCGGGG + Intronic
1019034001 6:169039501-169039523 TTGGAGGGTGGAAGGGTGGGAGG + Intergenic
1019101154 6:169631410-169631432 GAACTGGGTGGTGGGGTGGGGGG + Intronic
1019196631 6:170286981-170287003 AGGCAGGGAGGAAGGGTGGGAGG + Intronic
1019200736 6:170312834-170312856 GAGCAGAGTGAAGGGGTGAGGGG + Intronic
1019206418 6:170365712-170365734 TGGCAGGGGGGAGGGGGGGGAGG - Intronic
1019276014 7:176385-176407 AGGCAGGGTGCAGGGCAGGGAGG - Intergenic
1019299855 7:297398-297420 ACGCAGGGCTGAGGGGTGGCGGG + Intergenic
1019310433 7:357776-357798 AAGCAGGGTCCCAGGGTGGGTGG - Intergenic
1019328709 7:452369-452391 AAGCAGAGGGGAGGGGAGGGAGG + Intergenic
1019335953 7:482911-482933 CAGATGGGTGGATGGGTGGGTGG + Intergenic
1019446390 7:1073808-1073830 CAGCAGGGTGTCGGGGTCGGGGG - Intronic
1019446472 7:1074053-1074075 CAGCAGGGTGTCGGGGTCGGGGG - Intronic
1019501318 7:1366269-1366291 AGGCAGGGTGGCAGGGTGGCAGG + Intergenic
1019587776 7:1814316-1814338 AAGCAGGGTGGTGGGGGCTGGGG + Intergenic
1019603545 7:1897376-1897398 AGGAAGGGTGGAGGGGGCGGTGG - Intronic
1019697291 7:2452679-2452701 AAGAAGGGGGGAAGGGAGGGAGG - Intergenic
1019869628 7:3747777-3747799 AGGCAGGGAGGAGGGAAGGGAGG + Intronic
1019931015 7:4223135-4223157 AAGCAGGTTGGTGGGGGAGGAGG + Intronic
1019932032 7:4230164-4230186 AGGAAGGGTGGGTGGGTGGGTGG + Intronic
1019999234 7:4745376-4745398 ACGCAGGGTGGCGCGGGGGGCGG - Intronic
1020012909 7:4816194-4816216 GTGCAGGGTTGAGGGGTCGGGGG - Intronic
1020079993 7:5282108-5282130 CAGCTGGATGGAAGGGTGGGGGG + Intronic
1020110915 7:5447296-5447318 TAGATGGGTGGATGGGTGGGTGG + Intronic
1020131062 7:5558879-5558901 AAGCAGGAATGAGGGGTGGAGGG + Intronic
1020149816 7:5673259-5673281 AGGCAGGGTAGATAGGTGGGCGG - Intronic
1020255847 7:6502908-6502930 CAGCAGGGTGGATGGGTGGTGGG - Intronic
1020797733 7:12697146-12697168 AACCAGGGGGGAGGGGTGAGGGG - Intergenic
1021125904 7:16851059-16851081 AAGCGGCGTGGGGGGCTGGGGGG + Intergenic
1021240656 7:18196744-18196766 AAAAAGGGTGTAGGGGTGTGGGG + Intronic
1021266042 7:18523901-18523923 AAGCAGGGCGGAGCGGGGAGGGG - Intronic
1021329948 7:19324028-19324050 AAGGAGGGAGGAGGGAGGGGAGG + Intergenic
1021925777 7:25532276-25532298 AAGCATGGTGGAGTGGGGAGTGG - Intergenic
1022482789 7:30754699-30754721 AAGATGGATGGATGGGTGGGTGG - Intronic
1022501635 7:30885704-30885726 CAGCAGGGTTGGGGGGGGGGTGG - Intronic
1022504118 7:30899989-30900011 AAGCAGGGCAGAGGAGAGGGTGG + Intergenic
1022846257 7:34213142-34213164 TAGTAGGGTGGATGGGTGGGGGG + Intergenic
1022943255 7:35258684-35258706 AAGGAGGGTGCAGGAGTGTGAGG - Intergenic
1023234138 7:38066079-38066101 CAGCAGGGTAAAGTGGTGGGGGG - Intergenic
1023660819 7:42469252-42469274 AAGCAGGCTCTGGGGGTGGGAGG + Intergenic
1023682261 7:42699430-42699452 CAGCGGGGTTGGGGGGTGGGCGG + Intergenic
1023813655 7:43931602-43931624 AACCGGGGTGGGGGGGCGGGGGG + Intronic
1023837946 7:44079531-44079553 TAGCAGGGTGAGTGGGTGGGTGG - Intronic
1023874527 7:44279554-44279576 AAGCTGGGTAGGGTGGTGGGAGG - Intronic
1024120392 7:46231270-46231292 TAGCAGGGTGGAGGGGAGCCTGG + Intergenic
1024257154 7:47547698-47547720 AAGGACTGTGGAGGGGTGGATGG - Intronic
1025117165 7:56268302-56268324 AAGCAGGGAGGAAGGGAGGGAGG - Intergenic
1025198773 7:56949639-56949661 GAGGAGGGAGAAGGGGTGGGAGG - Intergenic
1025198921 7:56950108-56950130 CAGCTGGATGGAAGGGTGGGGGG - Intergenic
1025230793 7:57202159-57202181 AAGCTGGTTGGGGGGATGGGGGG + Intergenic
1025635605 7:63317287-63317309 AAGGAAAGTGGAGGGGAGGGAGG + Intergenic
1025647091 7:63430893-63430915 AAGGAAAGTGGAGGGGAGGGAGG - Intergenic
1025673025 7:63626825-63626847 CAGCTGGATGGAAGGGTGGGGGG + Intergenic
1025673173 7:63627294-63627316 GAGGAGGGAGAAGGGGTGGGAGG + Intergenic
1025919374 7:65896535-65896557 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1026145127 7:67740079-67740101 AGGCAGGATGGAAGGGTGGTGGG - Intergenic
1026436282 7:70401676-70401698 GAGCAGGCTGCAGAGGTGGGAGG + Intronic
1026447967 7:70501980-70502002 AAGCAGCCTGGCTGGGTGGGAGG - Intronic
1026662814 7:72317150-72317172 AAGAAGGGAGCAGGGGAGGGAGG + Intronic
1026766624 7:73164220-73164242 AAGCAGGGAACAGGAGTGGGTGG + Intergenic
1026981378 7:74528784-74528806 CAGCCGGGTGGGTGGGTGGGTGG + Intronic
1027043102 7:74973919-74973941 AAGCAGGGAACAGGAGTGGGTGG + Intronic
1027080545 7:75228440-75228462 AAGCAGGGAACAGGAGTGGGTGG - Intergenic
1027137759 7:75637335-75637357 AACCTGGGTGCAGGGCTGGGAGG + Intronic
1027189388 7:75988690-75988712 AAGCCGGGTGGAGGGGTGGAGGG + Intronic
1027189440 7:75988793-75988815 AGGCCGGGTGGGGGGGTGGAGGG + Intronic
1027189508 7:75988943-75988965 AGGCCGGGTGGGGGGGTGGAGGG + Intronic
1027355096 7:77346941-77346963 AGGCAGGGGGGTGGGGCGGGGGG - Intronic
1027389645 7:77692180-77692202 AAGCAGGGTGTAGGGTAGGTAGG + Intergenic
1028161805 7:87494135-87494157 CAGCAGTGTGGAGGGGAGGGTGG + Intergenic
1028211159 7:88076501-88076523 GGGCAGGGTGGAGGGGCGGCAGG - Intronic
1028444801 7:90909432-90909454 AAGCATGTTGCGGGGGTGGGGGG - Intronic
1029125235 7:98290950-98290972 TAGCTGGGTGGTGGGGTGGGGGG + Intronic
1029152109 7:98488037-98488059 GTGCAGGGTGGTGGGCTGGGAGG - Intergenic
1029232033 7:99078502-99078524 GAGGAGGGTGCAGGGGAGGGGGG - Intronic
1029279902 7:99428882-99428904 AAGCAGGGTGGGAGGGGCGGGGG + Intronic
1029433494 7:100547897-100547919 AAGAAGGGTGGAGTGGTGGTGGG - Intronic
1029628872 7:101737817-101737839 AAAGAGGGAGGAGGGGAGGGAGG + Intergenic
1029747909 7:102526743-102526765 AAGCAGGCAGGAGGGCCGGGTGG - Intergenic
1029755780 7:102572742-102572764 GTGCGGGGTGGGGGGGTGGGGGG - Intronic
1029765858 7:102625833-102625855 AAGCAGGCAGGAGGGCCGGGTGG - Intronic
1030138717 7:106284607-106284629 GAGGAGGATGGAGGGCTGGGCGG - Intronic
1030441849 7:109596558-109596580 AGACAGGGAGAAGGGGTGGGGGG + Intergenic
1030682265 7:112446554-112446576 AAGCAGGGTGGAGGTGCTGGTGG + Intronic
1030991549 7:116307152-116307174 TAGAAGGGTGATGGGGTGGGAGG + Intronic
1031078764 7:117238703-117238725 AGGCAGGCTGGAGAGGTGAGAGG - Intergenic
1031109033 7:117583315-117583337 AGGAAGGGTGGAGCGGGGGGGGG - Intronic
1031528852 7:122852700-122852722 GAGCAAGGGGGAGAGGTGGGAGG + Intronic
1031769135 7:125820622-125820644 AAGGAGGGTGGGTGGTTGGGAGG + Intergenic
1031846547 7:126811971-126811993 TTGAAGGGTGGAGGGGTGAGAGG + Intronic
1031910914 7:127515893-127515915 AAGAATGGGGGAGGTGTGGGGGG - Intergenic
1032015715 7:128379252-128379274 AAGCAGAGTGGTGAGGGGGGCGG + Intergenic
1032197471 7:129797634-129797656 AAGCTGGGGGCGGGGGTGGGAGG + Intergenic
1032438356 7:131920909-131920931 TAGGTGGGTGGATGGGTGGGTGG + Intergenic
1032494311 7:132349352-132349374 AAACAGGGTGTGGGGGTAGGGGG + Intronic
1032525777 7:132577375-132577397 AAGCAGGGAGGGCGGGAGGGAGG - Intronic
1032851443 7:135798993-135799015 AGGCAGGGTGGATGGGTGGGAGG - Intergenic
1032918377 7:136517908-136517930 AAGGAGAGAAGAGGGGTGGGAGG - Intergenic
1033091687 7:138391715-138391737 ATGCAGGGGGCAGAGGTGGGAGG + Intergenic
1033137647 7:138798233-138798255 AAGGAGGGAAGAGAGGTGGGAGG + Intronic
1033143975 7:138855094-138855116 AGTCAGGGTGAAGGGGAGGGAGG + Intronic
1033149647 7:138902355-138902377 AGGCAGGGTAGGGAGGTGGGTGG - Intronic
1033277723 7:139985304-139985326 AGTCAGGCTAGAGGGGTGGGGGG - Intronic
1033439635 7:141367080-141367102 CAGCAGGGGGGAGGGGTGGGGGG + Intronic
1033447626 7:141436539-141436561 GTGAAGGGTAGAGGGGTGGGTGG + Intronic
1033661704 7:143407537-143407559 AAATGGGGTGGAGAGGTGGGTGG - Intronic
1033969763 7:147025302-147025324 TAGGAGAGGGGAGGGGTGGGGGG + Intronic
1034065799 7:148135851-148135873 GAGCAGAGGGGAGGGGAGGGGGG + Intronic
1034278042 7:149832675-149832697 AGGCAGGGTGGGATGGTGGGAGG - Intergenic
1034422038 7:150995564-150995586 AGGAAGGGTGCAGGGGTGGGAGG - Intronic
1034435543 7:151061292-151061314 AAGCAGGCTGGCTGGGTGGAGGG - Intronic
1034489050 7:151383162-151383184 AAACGGGGCGGCGGGGTGGGGGG + Intronic
1034560750 7:151877807-151877829 AAGCAGGGTGGGGTGGGGTGGGG - Intergenic
1034995118 7:155572108-155572130 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1035047965 7:155981580-155981602 TAGATGGGTGGAAGGGTGGGTGG - Intergenic
1035111572 7:156486638-156486660 AAGCAGGGTGGAGGGGAGAAGGG - Intergenic
1035208703 7:157311817-157311839 AAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1035235975 7:157497922-157497944 TGCCAGGCTGGAGGGGTGGGTGG - Intergenic
1035290729 7:157837081-157837103 TAGGTGGGTGGATGGGTGGGTGG - Intronic
1035318501 7:158013412-158013434 AGGCAGGCTGGAGGGATGGATGG - Intronic
1035481913 7:159193599-159193621 AAGCAGGCAGGAGGGGAAGGAGG + Intergenic
1035496597 7:159333225-159333247 GAGCAGGGTGGAAGGTAGGGAGG - Intergenic
1035527428 8:324715-324737 TAGGTGGGTGGAGGGGTGGATGG + Intergenic
1035584383 8:760808-760830 GAGCAAGTGGGAGGGGTGGGGGG - Intergenic
1035987854 8:4454219-4454241 AAGGAGGGTGGCGGTGTTGGGGG - Intronic
1035993354 8:4516690-4516712 AGGCAGTGTGTAGGGGTTGGAGG - Intronic
1036190692 8:6667636-6667658 AAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1036525316 8:9529401-9529423 AAGCAGGGGTGGGGGGTGGTGGG - Intergenic
1036653883 8:10663029-10663051 AAGCTGGGTGGGGAGGTGAGAGG + Intronic
1036661803 8:10714009-10714031 ACCCAGGGTGGAGGGGTGGAGGG + Intergenic
1036737463 8:11331158-11331180 AGGCTGGGTGGAGCGGAGGGCGG - Exonic
1036797520 8:11766993-11767015 AAGAAGGAAGGAAGGGTGGGAGG + Intergenic
1037029301 8:14083305-14083327 TAGCAGGATGTGGGGGTGGGAGG + Intergenic
1037403309 8:18515460-18515482 TAGAGGGTTGGAGGGGTGGGTGG + Intergenic
1037441095 8:18917070-18917092 CAGCTGGGTGGATGGGAGGGAGG - Intronic
1037658621 8:20908378-20908400 ATGCAGGGTGGAAAAGTGGGGGG + Intergenic
1037693993 8:21207906-21207928 AAGCTGGCTGTGGGGGTGGGGGG - Intergenic
1037814470 8:22104490-22104512 CAGCAGGGAGGTGGGGTGGGCGG + Exonic
1037839207 8:22232061-22232083 AAGCAGCGTGGAGGAGAGAGAGG + Exonic
1037911919 8:22748667-22748689 AGGGAGGGTGGGGAGGTGGGTGG + Intronic
1038045951 8:23765632-23765654 AAGAAGGGTGGGGGTGGGGGCGG + Intergenic
1038319304 8:26513529-26513551 AGGCAGGGTGGACAGGAGGGGGG - Intronic
1038513030 8:28158525-28158547 GAGCGGGGTTGGGGGGTGGGAGG - Intronic
1038641968 8:29336141-29336163 AAGCAGGCGGGTTGGGTGGGAGG - Exonic
1038641982 8:29336259-29336281 AAGCAGGCGGGTTGGGTGGGAGG - Exonic
1038857277 8:31347614-31347636 GGGCAGGGTGGGGAGGTGGGTGG + Intergenic
1038865776 8:31437241-31437263 GAGGGGGGTGGGGGGGTGGGGGG + Intergenic
1039010872 8:33091208-33091230 AAAGAAAGTGGAGGGGTGGGAGG + Intergenic
1039059910 8:33565264-33565286 AAGGAGGAAGGCGGGGTGGGGGG + Intronic
1039189551 8:34957362-34957384 GAGAAGGGTGGAAGGGTGGGAGG - Intergenic
1039267909 8:35847262-35847284 GAGGTGGGTGGAGGGGTGCGGGG + Intergenic
1039325004 8:36475248-36475270 AAAAAGGGGGGAGGGGTGGGTGG + Intergenic
1039369087 8:36966398-36966420 AAGGAGGGTGGGAGGGTGGGGGG + Intergenic
1039608702 8:38902210-38902232 AAGAAGGGTGTGGGGGGGGGTGG + Intronic
1039979246 8:42392256-42392278 AAGGAGGGGGCAGGGGCGGGCGG - Intronic
1040629578 8:49195204-49195226 AAGCTGGCTGTAGGGGTGAGGGG + Intergenic
1040923281 8:52648506-52648528 AAGCTGTGTAGAGGGGAGGGAGG + Intronic
1041007352 8:53508117-53508139 AAAGTGGGTGGTGGGGTGGGTGG - Intergenic
1041959828 8:63600301-63600323 CAGGAGTGTGGAGTGGTGGGAGG + Intergenic
1042049508 8:64688375-64688397 AAGGAGGGTGGGAGGGAGGGAGG - Intronic
1042892823 8:73631989-73632011 AAGAAGGGGGGAGGAGAGGGAGG + Intronic
1043738337 8:83775313-83775335 TAGCATGGTGGGGGGGTGGTGGG - Intergenic
1043837182 8:85061273-85061295 CAGGAGGGGTGAGGGGTGGGTGG + Intergenic
1044423799 8:92028109-92028131 AGGGAGGGAGGAGGGGAGGGAGG + Intronic
1044546590 8:93466742-93466764 AGGCTGGGTGGGTGGGTGGGGGG + Intergenic
1044587781 8:93884160-93884182 AAGCAGCGAGGTGGGGTGGCTGG - Intronic
1044735666 8:95275653-95275675 AAGGAAGGTGGTGGGGAGGGAGG - Intergenic
1044832373 8:96262274-96262296 AGGGAGGGTGGCGGGGAGGGGGG + Intronic
1044918697 8:97145177-97145199 AAGCAGGGAGGATGAGAGGGAGG - Intronic
1045557010 8:103224413-103224435 AAGCAGAGTGGGCGGGTGGGGGG + Intronic
1045860577 8:106811473-106811495 AATGAGGCTGGAGAGGTGGGTGG - Intergenic
1045986157 8:108251770-108251792 AAGGAGGATGTGGGGGTGGGAGG + Intronic
1046236319 8:111428173-111428195 AAGAAGGGAGGAAGGGTGGGAGG - Intergenic
1046368943 8:113274869-113274891 AAGCAGGGAGGGAGGGAGGGAGG + Intronic
1046559198 8:115816344-115816366 ATGCGGGGTGGAGGGGGTGGGGG - Intergenic
1046586541 8:116155306-116155328 AAGGAGAGAGAAGGGGTGGGGGG + Intergenic
1047276969 8:123413230-123413252 AAGCAGGGAGGAGTTGGGGGGGG - Intronic
1047362049 8:124178340-124178362 AGGCAGGGCTGAGGGGTGCGGGG - Intergenic
1047376535 8:124302896-124302918 AAACAGGGGGGTGGGGAGGGTGG + Intergenic
1047762357 8:127963567-127963589 AAAAAGGGTGGAGGGGGGTGGGG - Intergenic
1047981345 8:130186467-130186489 AAGCAGTAGGGTGGGGTGGGAGG - Intronic
1048416154 8:134229844-134229866 CAGCGGGGAGCAGGGGTGGGGGG + Intergenic
1048440481 8:134455898-134455920 AAGCAGGGTGTGGGCTTGGGAGG + Intergenic
1048461081 8:134622634-134622656 GAGCTGGGTGGAGAGGGGGGAGG - Intronic
1048468527 8:134687042-134687064 CTGCAGGGTGGAGGGGAGGTGGG - Intronic
1048701256 8:137092204-137092226 AAGGAGGATGGAGGGGAGGCGGG + Intergenic
1048714334 8:137251164-137251186 CAGAAGGGTGCAGGGGTTGGAGG + Intergenic
1048851607 8:138650582-138650604 AGGCAGGGTGGATGAGAGGGAGG - Intronic
1048860641 8:138722337-138722359 ATGGAGGGTGGGGGCGTGGGAGG + Intronic
1048890233 8:138940510-138940532 GAGAAAGGTGGGGGGGTGGGGGG - Intergenic
1048991252 8:139761530-139761552 AGGCAGGGTGTGGGGTTGGGAGG - Intronic
1049025072 8:139982883-139982905 CAGCATGGTGGAGGGGAGTGTGG - Intronic
1049065060 8:140306896-140306918 AAGCAGTGTGGTGGGATGAGTGG + Intronic
1049165564 8:141123559-141123581 ATGCAGGGTGGAGGGTTCTGGGG + Intronic
1049214821 8:141402723-141402745 AAGCAGGGGGGAGGGGTGGGGGG - Intronic
1049236621 8:141515374-141515396 GAGCAGGGTGCACGGATGGGTGG - Intronic
1049366204 8:142238107-142238129 GTGCAGGGTGGAGGGGGGGCGGG - Intronic
1049369592 8:142257512-142257534 AAGCAGAGGGGAGTGGTGGGTGG - Intronic
1049440828 8:142608855-142608877 CCGGAGGCTGGAGGGGTGGGTGG - Intergenic
1049445706 8:142630393-142630415 TAGGAGGGTGGATGGGTGGGTGG - Intergenic
1049469268 8:142768215-142768237 GAGGAGGGAGGTGGGGTGGGGGG + Intronic
1049477030 8:142801632-142801654 TAGGTGGGTGGATGGGTGGGTGG + Intergenic
1049477142 8:142802026-142802048 TGGAAGGGTGGATGGGTGGGTGG + Intergenic
1049477159 8:142802082-142802104 TAGAAGGGAGGAGGGGTGGGTGG + Intergenic
1049540810 8:143207997-143208019 AAGCAAGGAGGAGGGGAGGGAGG - Intergenic
1049554441 8:143275087-143275109 AAGGCAGGTGGAGGGGAGGGAGG - Intronic
1049578007 8:143398429-143398451 CAGCAGGGAGGAAGTGTGGGAGG + Intergenic
1049657407 8:143804888-143804910 GGGCAGGGGGGATGGGTGGGTGG + Intronic
1049720128 8:144111831-144111853 GACCAGGTGGGAGGGGTGGGTGG - Intronic
1050091230 9:2017301-2017323 AAGTAGGGTGGAGGGGTGGGAGG + Intronic
1050406513 9:5314344-5314366 AAGCAACTTGGAGGGGTGGGTGG - Intergenic
1050486834 9:6143196-6143218 AGGCAGGGTGGAGAAGTGAGTGG - Intergenic
1050785637 9:9398094-9398116 AAGCAGGGAGGGAGGGAGGGAGG - Intronic
1051629576 9:19128937-19128959 CAGCAGAGAGGAGGGTTGGGAGG + Intronic
1051750079 9:20332055-20332077 AAGCAGGGTGGTGTGGGTGGTGG - Intergenic
1051792001 9:20815512-20815534 AAGGAGTGGGCAGGGGTGGGTGG - Intronic
1052042550 9:23755814-23755836 CAGCAGGGTGGTTGGGTGGGTGG - Intronic
1052092415 9:24345146-24345168 AGGGAGGGTGGAGGTGTTGGGGG + Intergenic
1052694040 9:31853834-31853856 AAGCAGTTTGGAGAGGTGGCAGG + Intergenic
1052868005 9:33477596-33477618 AAGGAGGGTGGGAGGGAGGGAGG - Intergenic
1052903773 9:33817141-33817163 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1052940306 9:34127094-34127116 CAGGGGGGTGGGGGGGTGGGGGG + Intronic
1053305418 9:36981186-36981208 AAGCAGGGCTGAGGGGGGGGGGG - Intronic
1053329155 9:37188484-37188506 AGGAAGGGGGGAGGGGTAGGGGG - Intronic
1053351820 9:37418242-37418264 TAGCAGGGTGGAGCTGTGGCCGG - Intergenic
1053729981 9:41043954-41043976 AGGGTGGGTGGAGAGGTGGGTGG + Intergenic
1053786294 9:41655077-41655099 CAGCAGGCTGTGGGGGTGGGGGG + Intergenic
1054158759 9:61659122-61659144 CAGCAGGCTGTGGGGGTGGGGGG - Intergenic
1054175007 9:61869021-61869043 CAGCAGGCTGTGGGGGTGGGGGG + Intergenic
1054256431 9:62818258-62818280 AGGGACGGTTGAGGGGTGGGGGG - Intergenic
1054334875 9:63797361-63797383 AGGGACGGTTGAGGGGTGGGGGG + Intergenic
1054453041 9:65413418-65413440 CAGCAGGCAGGATGGGTGGGTGG - Intergenic
1054454328 9:65421795-65421817 AAGGTGGGTGGATGGATGGGTGG + Intergenic
1054478533 9:65590127-65590149 CAGCAGGCTGTGGGGGTGGGGGG - Intergenic
1054662530 9:67711772-67711794 CAGCAGGCTGTGGGGGTGGGGGG - Intergenic
1054698520 9:68388113-68388135 AGGGTGGGTGGAGAGGTGGGTGG - Intronic
1055101262 9:72468004-72468026 GATCAGTGTGGAGGGGAGGGAGG + Intergenic
1055343283 9:75308521-75308543 AGGCAGTGTGGATGGGGGGGTGG - Intergenic
1055958230 9:81794296-81794318 AAGAAGGCTGGGGAGGTGGGTGG - Intergenic
1056465371 9:86848556-86848578 GAGGAGGGTAGAGAGGTGGGAGG - Intergenic
1056604881 9:88077594-88077616 AGGCAGGTTTGAAGGGTGGGGGG - Intergenic
1056722090 9:89081454-89081476 ACTCAGGGTGTGGGGGTGGGAGG - Intronic
1056827880 9:89889475-89889497 AAGCAGGCTGGAGGGGAAGGAGG + Intergenic
1056885777 9:90442376-90442398 AAGCAGGATGGAGGGGTCGGAGG - Intergenic
1056893048 9:90514023-90514045 CAGGAGGGTGTAGGGGTGGATGG - Intergenic
1057179771 9:93023387-93023409 ACGGAGTGTGGAGGCGTGGGGGG + Intronic
1057479506 9:95433764-95433786 AGGGAGGGTGGAAGGGAGGGAGG - Intergenic
1057730341 9:97602924-97602946 AAGCTGGGTGGTGGGGGTGGTGG - Intronic
1058590184 9:106557245-106557267 AAGCTGGGTGGTGTGGGGGGGGG - Intergenic
1058663633 9:107289067-107289089 AAGGAGGGAGGAAGGGAGGGAGG - Intronic
1058855661 9:109059332-109059354 ATGTAGGGTGGAGGGGGAGGAGG - Intronic
1058875860 9:109244318-109244340 AAGAAGGGATGAGGGGAGGGAGG + Intronic
1058877700 9:109258798-109258820 AGGCAGGGAGGAGGGGTGCGAGG + Intronic
1058883452 9:109305204-109305226 AGGTGGGGTGGTGGGGTGGGAGG + Intronic
1058900793 9:109440524-109440546 AGGCAGGCTGGTGGGGTGGTAGG - Intronic
1058984735 9:110200177-110200199 AAGAAGGGAGGAAGGGAGGGAGG + Exonic
1059011650 9:110467937-110467959 AGGCAGGGGGTTGGGGTGGGAGG - Intronic
1059022677 9:110593675-110593697 TGGGAGGGTGGGGGGGTGGGAGG - Intergenic
1059053970 9:110959333-110959355 AAGAAGGGAGGAAGGGAGGGAGG + Intronic
1059140820 9:111851657-111851679 AGGCAAAGGGGAGGGGTGGGGGG + Intergenic
1059387637 9:113977127-113977149 CTGCAGGGTGGAGGGGAGGAGGG + Intronic
1059457652 9:114409820-114409842 AAGCAAGGTGGAGTGGGGTGAGG - Intronic
1059517021 9:114905508-114905530 AAGGAGGGGTGAGGGGTGAGGGG + Intronic
1059633792 9:116153706-116153728 AAGAAGGAGGGAGGGGAGGGGGG + Intergenic
1059876921 9:118645366-118645388 AGGGAGGATGGAGGGATGGGAGG - Intergenic
1060041721 9:120306264-120306286 AACCAGGGTGGAGCAGTGTGTGG + Intergenic
1060119577 9:120975633-120975655 AGGCAGAGTGGAGGGTTGGTGGG - Intronic
1060225514 9:121787692-121787714 CAGAAGGGTGGAGAGGTGGAAGG - Intergenic
1060229937 9:121818964-121818986 GGGTAGGGTGGAGGGGTGAGAGG + Intergenic
1060271050 9:122141897-122141919 AAGCAAGGTGGGGAGGGGGGAGG + Intergenic
1060563739 9:124570240-124570262 AAGCAGGCTGGAGGGGAAAGGGG - Intronic
1060693724 9:125688282-125688304 TAGCAGGGTGTGGTGGTGGGTGG - Intronic
1061081452 9:128373178-128373200 AAGGTGGGTGGGTGGGTGGGTGG - Intronic
1061108439 9:128550449-128550471 AGGCAGGGTGAGTGGGTGGGAGG + Intergenic
1061330897 9:129891737-129891759 AAGGAGGAGGTAGGGGTGGGAGG + Intronic
1061387124 9:130296860-130296882 AAGTAGGGGGGAGGTGTGGGGGG + Intronic
1061491035 9:130944478-130944500 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491042 9:130944494-130944516 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491049 9:130944510-130944532 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491057 9:130944526-130944548 TGGAAGGGTGGAGGGGTGGAGGG + Intergenic
1061491075 9:130944566-130944588 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491083 9:130944582-130944604 TGGAAGGGTGGAGGGGTGGAGGG + Intergenic
1061562628 9:131415952-131415974 AAACATGGGGGTGGGGTGGGGGG - Intronic
1061680898 9:132242044-132242066 GAGCAGGGTGGCGGGGCGCGGGG - Exonic
1061753687 9:132798188-132798210 ACGCAGGGTTGAGGAGTGAGGGG + Intronic
1061854131 9:133432564-133432586 TAGGAGGGTGGACAGGTGGGTGG - Intronic
1061916678 9:133759235-133759257 AGGGAGTGGGGAGGGGTGGGGGG - Intergenic
1061945860 9:133907976-133907998 AGGAAGGGGGGTGGGGTGGGAGG - Intronic
1061947106 9:133914641-133914663 AAGCAGGAAGCAGGGGAGGGGGG + Intronic
1061963192 9:133998548-133998570 AGGATGGGTGGAGGGATGGGTGG - Intergenic
1061963218 9:133998636-133998658 AGGATGGGTGGAGGGATGGGTGG - Intergenic
1061963244 9:133998724-133998746 AGGATGGGTGGAGGGATGGGTGG - Intergenic
1061963270 9:133998812-133998834 AGGATGGGTGGAGGGATGGGTGG - Intergenic
1061963296 9:133998900-133998922 AGGATGGGTGGAGGGATGGGTGG - Intergenic
1062020149 9:134315569-134315591 AAGCAGATTCGAGGGCTGGGCGG + Intergenic
1062055372 9:134467207-134467229 TAGCAGGGTGGAGGGGTCCCTGG - Intergenic
1062061951 9:134501715-134501737 CAGCAGGGGTGAGGGGCGGGTGG - Intergenic
1062103756 9:134741603-134741625 AGGCAGGAGGGTGGGGTGGGAGG + Intronic
1062149573 9:135010694-135010716 AAGCAGGGTGTAGTGGGGTGAGG + Intergenic
1062156325 9:135050664-135050686 AAGCAGCGTGGTGAGCTGGGCGG + Intergenic
1062251810 9:135601564-135601586 GAGCTGGGGGGTGGGGTGGGGGG + Intergenic
1062454691 9:136629940-136629962 TTGCAGGGGGGAGGGGAGGGGGG + Intergenic
1062506623 9:136880809-136880831 ATCCTGGGTGGAGGGTTGGGTGG + Intronic
1062529331 9:136992984-136993006 AAGCAGGGAGGAAGGACGGGTGG + Intronic
1062597324 9:137305133-137305155 AAGCAGGGAGGGAGGGTGGCGGG + Intergenic
1203467835 Un_GL000220v1:104278-104300 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1203475656 Un_GL000220v1:148250-148272 AAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1203363398 Un_KI270442v1:237268-237290 CAGCTGGGTGGAGGGTGGGGTGG + Intergenic
1185445744 X:257182-257204 AGGCAGGGTGGACAGGAGGGTGG + Intergenic
1185445857 X:257783-257805 GAGAGGGGTGGAGGGGTGCGAGG + Intergenic
1185598853 X:1325377-1325399 AAGGAGAGGGGAGGGGAGGGAGG + Intergenic
1185603672 X:1355187-1355209 GAGGAGGGTGGAGGGGGAGGAGG + Intronic
1185603680 X:1355203-1355225 GAGGAGGGTGGAGGGGGAGGAGG + Intronic
1185603688 X:1355219-1355241 GAGGAGGGTGGAGGGGGAGGAGG + Intronic
1185689228 X:2139552-2139574 TAGATGGGTGGATGGGTGGGTGG - Intergenic
1185689263 X:2139715-2139737 TAGATGGGTGGATGGGTGGGTGG - Intergenic
1185700660 X:2228091-2228113 AAGGAGGGAGGAAGGGAGGGAGG + Intronic
1185766947 X:2733085-2733107 AAGCAGGAAGAAGGGATGGGAGG - Intronic
1185963495 X:4573220-4573242 AAGGAGGGTGGAAGGGAGGGAGG + Intergenic
1186155233 X:6718592-6718614 AGGAAAGGTGGAAGGGTGGGAGG + Intergenic
1186349799 X:8730586-8730608 GAGCTGGGTCAAGGGGTGGGGGG - Intronic
1186610572 X:11134638-11134660 CAGTATGGAGGAGGGGTGGGAGG + Intergenic
1186685130 X:11917733-11917755 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1186744652 X:12554996-12555018 AAGCAGAGTGGAGTGGTCAGGGG - Intronic
1186878156 X:13837699-13837721 AAGCAAGTTGGTGGGGGGGGGGG + Intronic
1187325798 X:18286642-18286664 AGGCAAGGTTGAGGTGTGGGAGG - Intronic
1187719390 X:22135469-22135491 CACCAGGGTGGAGGGTGGGGTGG + Intronic
1188177160 X:27005230-27005252 GAGCAGGGTGTATGGGTGGGAGG - Intergenic
1188404143 X:29786017-29786039 AAGGCGGGCGGGGGGGTGGGGGG + Intronic
1188478281 X:30610603-30610625 AAGCAGGCTGGAGGGGAAAGAGG - Intergenic
1188699774 X:33243879-33243901 CAGAAGGGTGGAGGCATGGGAGG + Intronic
1188972856 X:36638636-36638658 AAGCAGGATAGAGGGGCTGGAGG - Intergenic
1189284210 X:39840159-39840181 GAGCAGGCTGGGGGTGTGGGGGG + Intergenic
1189333285 X:40155628-40155650 AAGTAGGGAGGGGGTGTGGGGGG + Intronic
1189456694 X:41197335-41197357 AAGGCGGGGGGTGGGGTGGGGGG - Intronic
1189488063 X:41447774-41447796 AAGAAGTGTGGAGGCATGGGAGG + Exonic
1189763239 X:44343701-44343723 ACGGAGGGAGGAGGGGCGGGGGG + Intergenic
1190010256 X:46778527-46778549 AAGCAGGCTGGAGGGGAAAGAGG - Intergenic
1190103443 X:47541049-47541071 AAGGAGGGTGGATGTGTGTGTGG + Intergenic
1190108018 X:47573008-47573030 AGACAAGGTGGAGGCGTGGGAGG + Intronic
1190128688 X:47726809-47726831 GAGCAGGGTGGTGGGGGGAGGGG - Intergenic
1190176695 X:48156462-48156484 ATGCACTGTGGGGGGGTGGGTGG - Intergenic
1190282382 X:48939628-48939650 AAGGAGGTTGGTGGGGTAGGGGG - Intronic
1190304823 X:49075956-49075978 AAGATGGGGGGTGGGGTGGGCGG + Intronic
1190720442 X:53143382-53143404 ACGCAGGATGGCGTGGTGGGAGG + Intergenic
1190952876 X:55163059-55163081 GAGGAAGGTGGAGGGGTTGGAGG + Intronic
1191707097 X:64104873-64104895 AAGGAGGGAGGGGGGGTGAGGGG + Intergenic
1191834439 X:65448854-65448876 AAGAAGGGAGGAAGGGAGGGAGG + Intronic
1192033797 X:67543672-67543694 CAACAGGGTGGAGGCGAGGGAGG - Intergenic
1192139551 X:68636045-68636067 AAGCAGATTGGAGGGGTAGAGGG + Intergenic
1192145708 X:68680852-68680874 AGGCAGGGTGAAGGGGTAAGTGG + Intronic
1192170879 X:68854010-68854032 ATGCAAGGAGGAGGGGTGGAAGG - Intergenic
1193379960 X:80808043-80808065 GGGCAGGGGGGAGGCGTGGGAGG - Intronic
1193859987 X:86653387-86653409 AAGCGTGGTGGAAGGGTGCGGGG + Intronic
1194179172 X:90692069-90692091 AAGCTTGGGGGAAGGGTGGGCGG - Intergenic
1194453927 X:94079517-94079539 AAGCAGGGAGGAGGAGAGGGAGG - Intergenic
1195000314 X:100637005-100637027 AAGGAGAGGGGAGGGGTGGGGGG - Intronic
1195080497 X:101365510-101365532 AAGCAGGGTGTACAAGTGGGAGG + Intronic
1195534150 X:105992049-105992071 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1196438195 X:115693588-115693610 AAGCAGGATGGAGGGGAAAGGGG + Intergenic
1197186250 X:123590481-123590503 AAGCACAGAGGATGGGTGGGAGG - Intergenic
1197187231 X:123601391-123601413 AAGGAGGGAGTAGGGGAGGGAGG + Intronic
1197735051 X:129844020-129844042 GAGATGGGTGGAGGAGTGGGCGG - Intergenic
1198080137 X:133231877-133231899 AAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1198112058 X:133510358-133510380 AAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1198137428 X:133767948-133767970 GAATAGGGTGGCGGGGTGGGGGG + Intronic
1198273781 X:135081545-135081567 AAGCAGGGTCTAGGTTTGGGTGG + Intergenic
1198394609 X:136208924-136208946 ATTCTGGGGGGAGGGGTGGGAGG + Intronic
1199143178 X:144335071-144335093 AAGAAGGGGGGAGGGGTGGAGGG - Intergenic
1199344673 X:146724289-146724311 AAGGAGGGAGGGTGGGTGGGAGG + Intergenic
1199547194 X:149018739-149018761 AAGCAGGGAGGATGAGTGGCGGG + Intergenic
1199649573 X:149939141-149939163 AACCAGTGGGGAGGGGTTGGGGG + Intergenic
1199811799 X:151356988-151357010 AAGCTGGGAGGAAGGGAGGGTGG - Intergenic
1199827260 X:151512812-151512834 AAGCAGGCTGGAGGGGAAAGAGG + Intergenic
1200051466 X:153434043-153434065 GAGCAGGGTCCAGAGGTGGGAGG + Intergenic
1200259610 X:154606099-154606121 AAGGAGGGTTGAGGGGGGGAGGG - Intergenic
1200281572 X:154781326-154781348 AAGAAGGGCGGCGGGGAGGGGGG + Intronic
1200329279 X:155279113-155279135 AGGCAGGCTGAATGGGTGGGAGG - Intronic
1200525839 Y:4274236-4274258 AAGCTTGGGGGAAGGGTGGGCGG - Intergenic
1200619957 Y:5431297-5431319 TAGCAGGGATGGGGGGTGGGAGG - Intronic
1201077230 Y:10197134-10197156 AAGCAACGTGGGGCGGTGGGAGG - Intergenic
1201387746 Y:13461218-13461240 AAGGAGGGTGGAAAGGAGGGAGG + Intronic
1201517645 Y:14835335-14835357 AAGGAGGGAGGAGGGGTGGGAGG + Intronic