ID: 915564505

View in Genome Browser
Species Human (GRCh38)
Location 1:156706174-156706196
Sequence GAAGCAGGGTGGAGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1770
Summary {0: 1, 1: 3, 2: 18, 3: 195, 4: 1553}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564505_915564518 -3 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC 0: 1
1: 3
2: 18
3: 195
4: 1553
Right 915564518 1:156706194-156706216 TTCGGGCTCACGTAATGCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
915564505_915564519 -2 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC 0: 1
1: 3
2: 18
3: 195
4: 1553
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564505_915564520 5 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC 0: 1
1: 3
2: 18
3: 195
4: 1553
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
915564505_915564517 -4 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC 0: 1
1: 3
2: 18
3: 195
4: 1553
Right 915564517 1:156706193-156706215 CTTCGGGCTCACGTAATGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 53
915564505_915564522 19 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC 0: 1
1: 3
2: 18
3: 195
4: 1553
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564505 Original CRISPR GAAGCAGGGTGGAGGGGTGG GGG (reversed) Intergenic
900136646 1:1120454-1120476 GAAGCAGGGGTGGGGGGTGGGGG + Intergenic
900204770 1:1427233-1427255 GGAGCAGGGTGGAGCGGGGAGGG - Intronic
900243098 1:1626068-1626090 GAAGCAGGATGGCAGGGAGGGGG + Intronic
900384017 1:2401221-2401243 GAAGGAGGGAGGAAGGGAGGAGG - Intronic
900391528 1:2436026-2436048 GAGGAAGGGAGGAGGGGAGGAGG - Intronic
900391554 1:2436106-2436128 GAGGAAGGGAGGAGGGGAGGAGG - Intronic
900391558 1:2436114-2436136 GGAGCAGGGAGGAAGGGAGGAGG - Intronic
900391573 1:2436158-2436180 GGAGCAGGGAGGAAGGGAGGAGG - Intronic
900391599 1:2436244-2436266 GGAGGAGGGAGGAGGGGAGGAGG - Intronic
900391681 1:2436478-2436500 GGAGGAGGGAGGAGGGGAGGAGG - Intronic
900471914 1:2859274-2859296 GAAGCAGGGAGGAAGGAAGGAGG + Intergenic
900620721 1:3586515-3586537 GACGTGGGGTGTAGGGGTGGGGG + Intronic
900780782 1:4615866-4615888 GAAGCAGGGTGGAGCAGAGGGGG + Intergenic
900806959 1:4773839-4773861 TATGCAGGGAGGTGGGGTGGGGG + Intronic
900896751 1:5488022-5488044 GAAGGATGGTGAATGGGTGGTGG - Intergenic
900993184 1:6107166-6107188 GAGGGAAGGTGGAGGGATGGGGG + Intronic
901062250 1:6477143-6477165 GAGGCAGTGTGGAGTGGGGGTGG - Intronic
901129823 1:6955299-6955321 GAAGAGGAGTGGAGGGGTGAGGG - Intronic
901207845 1:7507625-7507647 GAAGGAGGGAGGCAGGGTGGAGG + Intronic
901296042 1:8161654-8161676 AGAGCAGGGTGGTGGGATGGAGG - Intergenic
901357467 1:8663801-8663823 GGAGCATGCAGGAGGGGTGGAGG - Intronic
901440217 1:9273231-9273253 CAAGGCGGCTGGAGGGGTGGAGG + Intergenic
901455318 1:9359842-9359864 GAAGCCGGGGGGGTGGGTGGCGG + Intronic
901836376 1:11926376-11926398 GAAGGAGGAAGCAGGGGTGGCGG - Exonic
902398015 1:16142957-16142979 GCAGGAGGGTGGGTGGGTGGAGG + Intronic
902414366 1:16230259-16230281 GAAGCAGGGCTGAGGGCTGCAGG + Intergenic
902586368 1:17440844-17440866 GAAGTGGGGTGGAGAGGTGGAGG - Intergenic
902590347 1:17469516-17469538 GAAGAAGGGGGTGGGGGTGGGGG + Intergenic
902676386 1:18011401-18011423 GTTGCAGGGTGGGGGGATGGGGG + Intergenic
903016607 1:20366039-20366061 GAAGGAGGGGTGAGGGGAGGGGG - Intergenic
903027856 1:20442413-20442435 GAAGCAGGATGAGGGGGTGGGGG - Intergenic
903184848 1:21623070-21623092 GAAGCAGGATGGAGGAGAGGAGG - Intronic
903323564 1:22556524-22556546 GAAGGAGGAGTGAGGGGTGGTGG + Intergenic
903471461 1:23590551-23590573 GAAGCAGGGAGGAGGAGGCGGGG + Intronic
903561792 1:24233594-24233616 GAAGTGGGGTCGGGGGGTGGGGG - Intergenic
903573957 1:24326334-24326356 GAAGAGGGGTGGAGGGGAAGAGG - Intronic
903573986 1:24326414-24326436 GAAGAGGGGTGGAGGGGAAGAGG - Intronic
903578408 1:24353385-24353407 GGAGGATGGTGGATGGGTGGGGG + Intronic
903670254 1:25031193-25031215 GATGGAGGCTGGAGGGATGGAGG + Intergenic
903670325 1:25031469-25031491 GATGGAGGCTGGAGGGATGGAGG + Intergenic
903927749 1:26842915-26842937 GGTGCATGGTGGAGGGCTGGGGG + Intronic
903950082 1:26991580-26991602 GAGGAAGGGTGGAGGGGTTGGGG - Intergenic
904036131 1:27559761-27559783 GAAGCAGGGGGGTGGTGAGGAGG - Intronic
904058325 1:27686731-27686753 GATGCCGGGGGGAGGGGAGGAGG + Intergenic
904266986 1:29323808-29323830 GAGGGCGGGTGGAGGGGTTGGGG + Intronic
904311196 1:29630721-29630743 GAAGAAGGGGGGGGGGGAGGAGG - Intergenic
904355944 1:29939948-29939970 GATGCATGGAGGTGGGGTGGCGG - Intergenic
904401712 1:30261037-30261059 GAAACAGGTGGGAGGGGTGCAGG - Intergenic
904535772 1:31198618-31198640 GAAGTAGGGTGGAGGGCAGGGGG - Intronic
904621147 1:31776141-31776163 GAAGCAGGGAGAGTGGGTGGGGG - Intergenic
904688668 1:32277506-32277528 CAAGAGGGGTGCAGGGGTGGGGG - Intronic
904917287 1:33979278-33979300 GAAGCAGGGTGGAGTAGGGGTGG + Intronic
904949775 1:34227173-34227195 GAAGCAGGGAGGTTGGGTGGGGG + Intergenic
904966458 1:34378129-34378151 TGACCAGGGTGGAGGGCTGGAGG + Intergenic
905174394 1:36126751-36126773 GTAGGTGTGTGGAGGGGTGGGGG + Intergenic
905236058 1:36549386-36549408 GAAACTGGGTGGGGGGGCGGGGG - Intergenic
905308526 1:37034561-37034583 GAGGCAGGGCGCAGGGGAGGGGG - Intergenic
905670111 1:39785810-39785832 GAGGCTGGGTGGGGCGGTGGGGG - Intronic
906160219 1:43642598-43642620 GGAGCAGGGTGATGGAGTGGAGG + Intergenic
906232939 1:44180908-44180930 GAAGCGGGGAGGAGGGGAGGGGG + Intergenic
906323296 1:44829539-44829561 GAAACAGGGTGGATAGGAGGGGG + Intronic
906511283 1:46411674-46411696 GGAGCAGGGTGGTGGGGGGAGGG + Intronic
906522218 1:46474368-46474390 GACTCAGGGTAGAGGGGTAGAGG + Intergenic
906544887 1:46613787-46613809 GGGGCAGGGTGGAGGGGGGTCGG + Intronic
906591020 1:47024017-47024039 GAAGGAGGAGGGAGGGGCGGAGG + Intronic
906682501 1:47738933-47738955 GTAGATGGGTGGGGGGGTGGGGG + Intergenic
906690944 1:47792423-47792445 GAGGCAGGGAGGAGGGGAGGAGG + Intronic
906932530 1:50183704-50183726 GATGCAGGGAGGAGAGGGGGAGG - Intronic
907222946 1:52920995-52921017 GGAGCGGGGACGAGGGGTGGGGG - Intronic
907501647 1:54885844-54885866 GAAACAGGGTGCAGGTGGGGAGG + Intronic
907663467 1:56414538-56414560 GGGGCAGGGTGGGGGGCTGGTGG - Intergenic
908114205 1:60925080-60925102 GAGGCGGGGTGGGGGGGCGGTGG - Intronic
908158998 1:61387530-61387552 CAAGCTGGGTGGAGGAGAGGAGG - Intronic
908534573 1:65066512-65066534 GGAGGAGGGTGGAGGGAGGGCGG - Intergenic
908686534 1:66726183-66726205 CAAGCAGGCTGGAAGGGTGAAGG + Intronic
908758072 1:67487181-67487203 GAAGCAGGAGGAAGGAGTGGAGG - Intergenic
908781926 1:67698835-67698857 TAAGCAGGGTGTATGTGTGGAGG + Intergenic
908817549 1:68049969-68049991 GAAGGAGTGTGGAGGGGAGTGGG - Intronic
909207426 1:72777075-72777097 GGAGCAGGTTTGGGGGGTGGGGG - Intergenic
909377894 1:74961154-74961176 GAAGCAGGGAGAAAGGTTGGAGG - Intergenic
909931928 1:81506339-81506361 AAATGAGGGTGGAGGGGTAGAGG + Intronic
910038913 1:82823748-82823770 GAAGCAGGGTGGAGTTGGGGCGG - Intergenic
910415405 1:86992199-86992221 GAACAGGGGTGGAGGAGTGGGGG - Intronic
910587094 1:88891936-88891958 GACGCGGGGTGGGGGGCTGGGGG - Intronic
911008759 1:93255791-93255813 GAAGGAGGGGGGAGGGATAGTGG + Intronic
911283575 1:95961261-95961283 GAAGGATACTGGAGGGGTGGTGG - Intergenic
911449804 1:98048583-98048605 GGGGGAGGGTGGATGGGTGGGGG - Intergenic
911464264 1:98232748-98232770 AAAGCAGGGTGGTGGGGTGATGG + Intergenic
911871626 1:103107376-103107398 GAAGCGGAGGGGTGGGGTGGGGG + Intronic
912283613 1:108344471-108344493 GGAGGAGGGTGGAGGGTCGGAGG + Intergenic
912345157 1:108956877-108956899 GAGGCAGGGAGGCGGGGAGGCGG + Intronic
912429495 1:109621419-109621441 GAAGGTGGGGTGAGGGGTGGTGG + Intronic
912663876 1:111561512-111561534 GAAGGAGGGAGGAAGGGAGGAGG + Intronic
912687009 1:111775814-111775836 GAGGGAGGGTGGGGGGGTCGGGG - Exonic
912741154 1:112198888-112198910 GAGGCAGGGTGGAGGATGGGGGG - Intergenic
912812376 1:112803954-112803976 GATGCAGGGTGGGGGAGAGGGGG - Intergenic
912813862 1:112813604-112813626 GAAGCGGGGGGCAGGGGCGGGGG - Intergenic
913035355 1:114959721-114959743 GTAGTAGGGAGGAGGGGAGGGGG - Intronic
913111507 1:115661449-115661471 TAAGCAGGGCGGGTGGGTGGGGG - Intronic
913159545 1:116132781-116132803 GAAGCAGGGAGGAAGAGAGGTGG + Intronic
913616074 1:120560257-120560279 GGAGCAAGATGGAGCGGTGGAGG - Intergenic
914192687 1:145425224-145425246 GAGGCGGGGTGGGGGGTTGGGGG - Intergenic
914330282 1:146662921-146662943 TAAGAAGGGTAGAGGGGAGGTGG + Intergenic
914574202 1:148950641-148950663 GGAGCAAGATGGAGCGGTGGAGG + Intronic
914860105 1:151378845-151378867 TAAATACGGTGGAGGGGTGGGGG + Intergenic
915072255 1:153280028-153280050 GATGCAGAGAGAAGGGGTGGAGG + Intergenic
915297375 1:154930693-154930715 GCTGCAGGGTGGTGGGGTGGTGG - Intronic
915326088 1:155081949-155081971 GTCGCAGGGAGGAGGGGCGGAGG + Intronic
915426768 1:155833756-155833778 GAGGAAGGGAGGAGGGGAGGAGG + Intronic
915441877 1:155950653-155950675 GTAGATGGGTGCAGGGGTGGAGG - Intronic
915564505 1:156706174-156706196 GAAGCAGGGTGGAGGGGTGGGGG - Intergenic
915586708 1:156847659-156847681 GGAGCAGGTTGGGGGGGTGGGGG + Intronic
915624473 1:157106411-157106433 GAAGTAGGGGAGTGGGGTGGTGG - Intergenic
915632621 1:157163900-157163922 GCAGCAGTGCTGAGGGGTGGTGG + Intergenic
915913689 1:159929143-159929165 CCAACAAGGTGGAGGGGTGGAGG + Intronic
916091399 1:161310119-161310141 TAGTCTGGGTGGAGGGGTGGGGG + Intergenic
916336259 1:163674002-163674024 GAAGGAGGAGGGAGGGATGGAGG + Intergenic
916528045 1:165630451-165630473 GAGGCCGGGTGGAGGAGGGGTGG - Intergenic
916549510 1:165836665-165836687 GATTCAGAGTGGAGGGGTGATGG + Intronic
916579370 1:166093946-166093968 GGAGCAGGGTGGGGGTATGGGGG + Intronic
916704895 1:167339178-167339200 GAAGCAGGGTTGAGGGGAGGAGG - Intronic
916718557 1:167465205-167465227 CTAGCAGGGTGGTGGGGAGGGGG - Intronic
916779419 1:168008856-168008878 GGGGCAGGGTGGAGGCGGGGTGG - Intronic
916779431 1:168008881-168008903 GAGGGAGGGGGGAGGGGAGGGGG - Intronic
916793703 1:168146205-168146227 GGGGAAGGGTGGGGGGGTGGGGG + Intergenic
916980596 1:170132226-170132248 TAAGCAGAGTGGAGGAGGGGTGG - Intergenic
917432919 1:174989400-174989422 GAAGCTGGCTGGTGTGGTGGAGG - Intronic
917463783 1:175256250-175256272 GTTGCGGGGTGGAGGGTTGGGGG - Intergenic
917642732 1:176998524-176998546 GGACCTGGGTGGAGAGGTGGGGG + Intronic
918074298 1:181158964-181158986 GGAGCAGGGTGCAGGGGAGGGGG + Intergenic
918122333 1:181550544-181550566 GGAGCTGGCAGGAGGGGTGGGGG + Intronic
918135078 1:181664818-181664840 GAGGCAGGGTGAAGGTGTTGAGG + Intronic
918146384 1:181759632-181759654 GAAGCAGGTTGGGGGGAGGGTGG - Intronic
918674197 1:187261485-187261507 TAAGCCTGGAGGAGGGGTGGAGG + Intergenic
919022860 1:192130342-192130364 GAGGCAGGGTGGGGGGTAGGAGG + Intergenic
919728583 1:200899166-200899188 GAAGAAGGGAGGAGGAGTGGGGG + Intronic
919821584 1:201476438-201476460 GAAGCAGGGTGGGGAGGAGCAGG - Intergenic
919851221 1:201674289-201674311 GCAGCAGAGAGGAAGGGTGGTGG + Intronic
919939871 1:202278775-202278797 CAAGCAGGGTGGAGGAGAAGGGG + Intronic
920032297 1:203044707-203044729 GCAGCAGGGGGCAGGGGTGCGGG + Intronic
920216644 1:204365867-204365889 GTAAGAGTGTGGAGGGGTGGGGG + Intronic
920291181 1:204924175-204924197 GAGGCATGGGGGAGGGGAGGTGG - Intronic
920381105 1:205534989-205535011 CTAGCAGGGTAGAGGAGTGGTGG - Intergenic
920556245 1:206907075-206907097 GAAGCCGGGGGGTGGGGGGGTGG + Intronic
920694864 1:208174507-208174529 GAGGCAGGCTGGAGGTGTGCAGG + Intronic
920806551 1:209239986-209240008 CATTCAGAGTGGAGGGGTGGGGG - Intergenic
921007907 1:211112293-211112315 GGGGAGGGGTGGAGGGGTGGAGG - Intronic
921218288 1:212955122-212955144 GAAGAAGGGTGGTAGGGTGGCGG + Intronic
921437980 1:215149198-215149220 GAAGGAGAATGGAGGGGTTGTGG + Intronic
921618066 1:217295496-217295518 TAAGCAGTGTGTAGTGGTGGTGG - Intergenic
921693062 1:218175329-218175351 GGAGCAGGGTAGTGGTGTGGAGG - Intergenic
922215381 1:223516049-223516071 GAGGCAGTGTGGGGAGGTGGCGG - Intergenic
922246437 1:223803002-223803024 TGAGAAGTGTGGAGGGGTGGAGG - Intronic
922605398 1:226887026-226887048 GAAGCAGGGTGGAGGGCTGCTGG + Intronic
922615250 1:226957285-226957307 GAACCAGGGAGGTGGGGGGGGGG - Intronic
922623371 1:227010133-227010155 GCAGTAGGGTGGAGAGCTGGTGG - Intronic
922661645 1:227435505-227435527 GAAAGAGGGTGGATGGGTGGAGG + Intergenic
923140254 1:231155881-231155903 GAAAGAGGGTGGAAGGGTGGGGG + Intergenic
923433938 1:233950606-233950628 GAGAAAGGGTGGAGGGATGGAGG - Intronic
923724638 1:236495547-236495569 GGAGGAGGGTGGAGGTGGGGTGG - Intergenic
924118874 1:240776415-240776437 GTAGGAGGGTGGAGGGAGGGAGG - Intronic
924202637 1:241675284-241675306 GAAGAAGAGAGGAGGGGAGGAGG - Intronic
924380750 1:243462088-243462110 GATGCAGGGTTGAGAAGTGGTGG - Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
924505838 1:244683022-244683044 GGAGCAGGGTGGAGGGTCAGTGG + Intronic
924724042 1:246651258-246651280 ACAGCAGCGTGGAGGGGTGGAGG - Intronic
924811160 1:247403580-247403602 GTAGAAGGGTGGGGAGGTGGAGG - Intergenic
1062833824 10:623542-623564 GATGCAGGGCTGAGGGGAGGAGG + Intronic
1062833835 10:623570-623592 GATGCAGGGCTGAGGGGAGGAGG + Intronic
1062844117 10:690966-690988 GAAGCGGGGTGGGGGGGTGGTGG - Intergenic
1062885151 10:1010793-1010815 GAGTCAGGATGGAGGGGTGCAGG - Intronic
1063089333 10:2848434-2848456 TAAGGGGGGTGGAGGGGTGGGGG - Intergenic
1063114357 10:3063666-3063688 GAGGCATGGAGGTGGGGTGGAGG + Intergenic
1063267281 10:4467440-4467462 GAAGGAGGGTGGAGAGGAGGAGG - Intergenic
1063311500 10:4956767-4956789 GCAGCAGAATGGAGGTGTGGTGG + Intronic
1064235576 10:13571094-13571116 GAAGGAGGGTGGGAGGGCGGTGG + Intergenic
1064397279 10:14992041-14992063 GCAGCAAGGTGGCGGGGTGTAGG + Intergenic
1065076189 10:22081848-22081870 AGAGTGGGGTGGAGGGGTGGAGG - Intergenic
1065180525 10:23120142-23120164 AAAGGAGGGTGGAGAGATGGAGG - Intronic
1065534006 10:26700249-26700271 CAAGCGGGGTGGGGGGGAGGGGG - Intronic
1065898034 10:30181864-30181886 GGGGCCGAGTGGAGGGGTGGAGG - Intergenic
1067056955 10:43058077-43058099 GAAGATGGGGGGAGGTGTGGGGG - Intergenic
1067196897 10:44127916-44127938 GAAGCAGGGTGGGGAGCTGGGGG - Intergenic
1067343276 10:45420916-45420938 GAAGTAGGGGCGAGGGGTGGGGG + Intronic
1067545432 10:47189401-47189423 AAAGCAGGGAGAAGGGGTGGAGG + Intergenic
1067628809 10:47944865-47944887 TGAGGAGGGTTGAGGGGTGGGGG - Intergenic
1067744733 10:48927220-48927242 GAAGCAGGGGGGAGGGTTCGGGG - Intronic
1068334083 10:55608297-55608319 GAAGCAGAGGGAAGGGGAGGGGG + Intronic
1068693312 10:59940201-59940223 TTAGCAGGGTGCAGTGGTGGTGG - Intergenic
1068903477 10:62297172-62297194 GCAGGAGAGTGGAGGGGTGGAGG - Intergenic
1069548453 10:69345541-69345563 GAAGGAGCGGGGAGGGGAGGGGG + Intronic
1069919633 10:71808647-71808669 GAAGAAGGGGGAAGGGGTTGGGG - Intronic
1070220780 10:74441998-74442020 GAAGCTGGGTTCAGTGGTGGTGG + Intronic
1070531274 10:77339530-77339552 CAAGCTGGGTGGTGGGGAGGTGG - Intronic
1070756405 10:78996156-78996178 GCAGGAGGGGGGAGGGGTCGGGG - Intergenic
1070775642 10:79108286-79108308 GAGGCTGGGAGAAGGGGTGGTGG + Intronic
1070795329 10:79213049-79213071 GACCCACGGTGGCGGGGTGGGGG - Intronic
1071223849 10:83502272-83502294 GAAGCAAGGTTGTGGGGAGGTGG - Intergenic
1071314984 10:84386933-84386955 GAAGTGGGGAGGATGGGTGGGGG + Intronic
1071524145 10:86348429-86348451 GGCACAGGGTGGATGGGTGGAGG + Intronic
1071825599 10:89322567-89322589 GAAGCACGGTGGTGGGGTCGGGG - Intronic
1071923220 10:90374965-90374987 GAAACAGTGTGGGGTGGTGGTGG - Intergenic
1071960449 10:90804582-90804604 GAAGGAGTGGGGAGGGGTGGTGG - Intronic
1072300405 10:94055392-94055414 GAACCCGGGGGGTGGGGTGGAGG - Intronic
1072803089 10:98407051-98407073 GAAGGAAGGTGAAAGGGTGGGGG + Intronic
1072806997 10:98429976-98429998 GTGGAGGGGTGGAGGGGTGGAGG - Intronic
1072843788 10:98805149-98805171 GAAGCTGGGTGCAGAGGAGGTGG + Intronic
1072886928 10:99285514-99285536 GGAGTAGGGTGGAGGGAGGGAGG + Intergenic
1073009605 10:100349038-100349060 GAAGCAGGCTGGACGGGGGATGG - Intronic
1073019576 10:100431844-100431866 GAGGCCGGGTGGGGGGGGGGGGG - Intergenic
1073149727 10:101303519-101303541 GAAGCAGGGAGGGGGAGAGGGGG - Intergenic
1073299494 10:102462138-102462160 GCACCAGGGTTGGGGGGTGGGGG - Intronic
1073340013 10:102737250-102737272 GAAGCAGGGAGAAGGGATGATGG + Intronic
1073500149 10:103929553-103929575 GAAGCACGAGGGTGGGGTGGAGG + Intergenic
1073525765 10:104180743-104180765 GAAACAGGGTGGTGGGCCGGCGG - Intronic
1073746405 10:106473149-106473171 GTTGGAGGGTGGAGGGCTGGGGG + Intergenic
1074375598 10:112938643-112938665 TAAGCAGGGTCTAGGGGTGGAGG + Intergenic
1074451708 10:113564529-113564551 GAAACAGGGTGTGGGGGAGGTGG + Intronic
1074611392 10:115025446-115025468 GAAACTGGCTGCAGGGGTGGGGG - Intergenic
1074711375 10:116180785-116180807 GAGGGGTGGTGGAGGGGTGGTGG - Intronic
1074875099 10:117607569-117607591 GAAGCAGGGAGATGGGATGGGGG - Intergenic
1074925251 10:118062444-118062466 GTAGTAGGGAGGAGGGGTGAGGG - Intergenic
1075055833 10:119217756-119217778 GAAGCAGGGTGCAGGGCAGATGG - Intronic
1075145469 10:119879312-119879334 GAATCATTGTGGAAGGGTGGAGG + Intronic
1075570543 10:123538675-123538697 GCAGCAGGATGGGGCGGTGGTGG - Intergenic
1075621353 10:123930254-123930276 GAAGCAGGGCTGTGGGATGGAGG - Intronic
1075702296 10:124477508-124477530 GCAGCAGGGCAAAGGGGTGGAGG - Intronic
1076021358 10:127076636-127076658 AAATCAGGGTGCTGGGGTGGGGG - Intronic
1076057456 10:127387184-127387206 GAATGAGGGTGGAGAGGTCGCGG - Intronic
1076358272 10:129868637-129868659 GAAGGAGGGTGCAGGGGGGAGGG + Intronic
1076359447 10:129876889-129876911 GTAGCTGGGTGGGGGGGGGGGGG - Intronic
1076824844 10:132961692-132961714 GCAGCAGGGGTGAGGGGTGGGGG - Intergenic
1076824858 10:132961732-132961754 GCAGCAGGGGTGAGGGGTGGGGG - Intergenic
1076824871 10:132961772-132961794 GCAGCGGGGGTGAGGGGTGGGGG - Intergenic
1076844962 10:133065512-133065534 GATGGATGGTGGATGGGTGGAGG + Intergenic
1076845160 10:133066161-133066183 GGTGGAGGGTGGAGGGGAGGAGG + Intergenic
1076845334 10:133066701-133066723 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1076845376 10:133066813-133066835 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1076993067 11:285531-285553 GAAGGTGGGTGGAGTAGTGGTGG - Intergenic
1077159385 11:1105790-1105812 GCAGCAGGGAGCAGGGGTGGGGG - Intergenic
1077214168 11:1388449-1388471 GAAGCAGGGCGGGCGGGTGCAGG + Intergenic
1077231463 11:1459796-1459818 GAGGCAGGCTGGGGGGCTGGGGG - Intronic
1077497348 11:2892601-2892623 GAAGGAGGAGGGAGGGGAGGAGG - Intronic
1077540119 11:3142733-3142755 GAAGTCGTGTGCAGGGGTGGAGG + Intronic
1077646215 11:3927604-3927626 GAAGCAGGGTGCAGTGATGGTGG + Intronic
1077923379 11:6657088-6657110 GCAGCTGGGTGGATGGATGGTGG + Intergenic
1078429737 11:11279973-11279995 GAAGCAGGGGGTGCGGGTGGAGG + Intronic
1078449068 11:11426832-11426854 GGAGCAGGGTAGAGGGGAGGGGG + Intronic
1078465867 11:11549860-11549882 GAAGAAGGGTGGAGGAGGGGAGG + Intronic
1078488590 11:11747761-11747783 GAAGGAGGGAGGAGGGAGGGAGG + Intergenic
1078659576 11:13276639-13276661 GGGGTAGGGTGGAGTGGTGGGGG - Intronic
1078859774 11:15236286-15236308 GTCTCAGGGTGGGGGGGTGGTGG + Intronic
1079390984 11:20022008-20022030 GAAGCAGGGAGCGGGGGTTGTGG - Intronic
1079826972 11:25208491-25208513 GAAGCAGGGGAGAAGGGTGAGGG + Intergenic
1079875612 11:25853403-25853425 GAAGCAGAGTGAAGAGGTGGGGG + Intergenic
1079875623 11:25853480-25853502 GAAGCAGAGTGAAGAGGCGGGGG + Intergenic
1080036911 11:27720254-27720276 GACGCGTGGTGGAGGGGAGGAGG - Intronic
1080414633 11:32057915-32057937 AGAGCAGGGTGGAGAAGTGGGGG - Intronic
1080447856 11:32353654-32353676 GAGGCTGGGTAGATGGGTGGAGG + Intergenic
1080550388 11:33369349-33369371 GAGGAAGGTTGGAGGAGTGGGGG - Intergenic
1080655116 11:34252540-34252562 CAGGCAGGTTGGAGGGTTGGGGG - Intronic
1080767702 11:35311920-35311942 GAGGCGGGGGGGGGGGGTGGGGG + Intronic
1080877150 11:36286447-36286469 AAATCAGCCTGGAGGGGTGGTGG + Intronic
1080928680 11:36784889-36784911 GAAGGAGGGGAGAGGGATGGGGG - Intergenic
1081469116 11:43353337-43353359 GAAGCAGGGTGGAGGGGAACAGG - Intergenic
1081824922 11:46040279-46040301 GAGGCAGGGTGGGGAGGTGCTGG + Intronic
1081856608 11:46308029-46308051 GAGGGAGGGAGGAGGGCTGGTGG + Intronic
1081911134 11:46700661-46700683 GAAGTGGGTTGGAGGTGTGGCGG - Intergenic
1082785322 11:57313415-57313437 GAACCAGGCTGGTGGGGCGGAGG + Exonic
1082928878 11:58579131-58579153 GGAGCCGGGCGGAGGGGAGGGGG + Exonic
1083619339 11:64041336-64041358 CACGGGGGGTGGAGGGGTGGGGG - Intronic
1083621771 11:64052877-64052899 GTAGCTGGGTGGAGTAGTGGTGG - Intronic
1083678285 11:64340086-64340108 GATGCAGGGAGGTGAGGTGGGGG + Intergenic
1083913056 11:65721035-65721057 GAGGCAGGGAGGAGGGGGAGGGG - Intergenic
1083980635 11:66165635-66165657 GCAACAGGGTGGATGGATGGTGG - Intronic
1083993577 11:66261156-66261178 GAGGCTGGGGAGAGGGGTGGGGG + Intronic
1084005107 11:66318292-66318314 GAAACAGTGTGGGGAGGTGGGGG + Intergenic
1084064256 11:66694264-66694286 GGACCAGGGTGCAGGGGAGGTGG - Exonic
1084104270 11:66970809-66970831 GAAGCAGTGAGGAGGGAAGGAGG + Intergenic
1084178770 11:67436528-67436550 GGAGGAGGCTGGAGGGATGGGGG - Intronic
1084219997 11:67671981-67672003 GAAGCAGGGGGTGGGGGTGAGGG - Intronic
1084227769 11:67728018-67728040 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
1084400080 11:68938380-68938402 CAAACAGTGGGGAGGGGTGGTGG + Intronic
1084599669 11:70137412-70137434 GATGGCGGGTGGGGGGGTGGGGG - Intronic
1084693613 11:70740969-70740991 GCAGCAAGGTGGAGGGGATGAGG + Intronic
1084774046 11:71363969-71363991 GAGGCAGGCTGGGGAGGTGGAGG + Intergenic
1084807460 11:71588847-71588869 GGAGCAAGGTGGCGGGGTGTAGG - Intronic
1084844549 11:71888856-71888878 GGAGCAAGGTGGCGGGGTGGAGG - Intronic
1084847403 11:71911312-71911334 GGAGCAAGGTGGCGGGGTGTAGG - Intronic
1084941347 11:72615012-72615034 GCAGGAGGGTGGAGGGATGGGGG - Intronic
1084953194 11:72677999-72678021 GAAGCAGGGGGTGGGGATGGAGG - Intergenic
1084964344 11:72736653-72736675 GAGGCAGGATGGGGGTGTGGGGG - Intronic
1085079760 11:73624523-73624545 GAGGGAGGGAGGAGGGGAGGAGG + Intergenic
1085170849 11:74448749-74448771 CCAGGAGGATGGAGGGGTGGTGG - Intergenic
1085248991 11:75129301-75129323 TAGGCAAGGTGGAGGGGAGGAGG + Intronic
1085267646 11:75246742-75246764 GAGGCAGGGGTGAAGGGTGGAGG - Intergenic
1085307524 11:75496358-75496380 GAAGCAAGTTGGGGAGGTGGGGG + Intronic
1085360693 11:75882692-75882714 GGAGCTGCGTGGAGGGGAGGAGG - Intronic
1085515907 11:77111924-77111946 GGAGCAGGGAGCAGGGGTGGGGG + Intronic
1085777871 11:79382645-79382667 GAAGCAGGGAGAAGGGATGGAGG + Intronic
1087812513 11:102623508-102623530 GTAGGAGGCTGGAGGGGTGATGG - Intronic
1088098985 11:106132921-106132943 AAAGGAAGGTGGAAGGGTGGAGG + Intergenic
1088136299 11:106559823-106559845 GAGGATGGGTGGAGGGTTGGGGG - Intergenic
1088148926 11:106720359-106720381 GCAGCATGGTGCTGGGGTGGAGG + Intronic
1088356030 11:108944667-108944689 GAAGGAGGGAGGATGGGAGGTGG + Intergenic
1088921965 11:114266217-114266239 GAAACAGCGAGGTGGGGTGGGGG - Intronic
1089352657 11:117830253-117830275 AAAGCAGGGCGGGGAGGTGGGGG - Intronic
1089355097 11:117844423-117844445 GAGGCAGGGGGATGGGGTGGAGG - Intronic
1089491999 11:118889688-118889710 GAAGCTGGTTTGAGGGGTGCTGG - Intronic
1089563387 11:119357115-119357137 GGGGGAGGGTGGAGGAGTGGGGG + Intronic
1089606369 11:119643813-119643835 GAATCAGTGTCGGGGGGTGGGGG + Intronic
1089694816 11:120210678-120210700 AAAGCGGGGGGGGGGGGTGGCGG + Intergenic
1089824212 11:121258981-121259003 GAGGCAGGGAGGTGGGGGGGGGG - Intergenic
1090061339 11:123466648-123466670 GACCCAGGGAGTAGGGGTGGGGG + Intergenic
1090083336 11:123629110-123629132 GAAGCAGGCTGGGGTGCTGGGGG + Intergenic
1090268838 11:125371537-125371559 GAAGGAGACTGGAGGGGAGGAGG - Intronic
1090299949 11:125626418-125626440 GAAGGAGGAGGGAGAGGTGGGGG - Intronic
1090514984 11:127415576-127415598 AAAGAAGGGTGGGGGGTTGGGGG - Intergenic
1090642192 11:128739413-128739435 GCAGGGGGGTTGAGGGGTGGGGG - Intronic
1090664592 11:128906048-128906070 GAAAGGGGCTGGAGGGGTGGGGG - Intronic
1090838024 11:130467414-130467436 AAAGCAGGGTGGAAGGACGGCGG + Intronic
1090901212 11:131033415-131033437 GAAGCAGGTTGGAGAGATGAGGG - Intergenic
1091312443 11:134584397-134584419 GCAGCAGGGGGGTGGGGTTGAGG - Intergenic
1091396117 12:155153-155175 GGTGCAGGGTGGAGGTGAGGAGG + Intronic
1091792627 12:3280511-3280533 CAGGCAGGGAGGAGGGGTGGCGG + Intronic
1091853538 12:3720376-3720398 GAAGGAAGGGGGAGGGGGGGAGG + Intronic
1092157703 12:6295171-6295193 GCAGCAGGGTTGGGGGGTGGGGG - Intergenic
1092371007 12:7916444-7916466 AAAGGAGGGTGGCGGGGTGGGGG + Intergenic
1092516898 12:9224307-9224329 GTCGCGGGGTGGAGGGATGGGGG - Intergenic
1093076875 12:14768253-14768275 GAATGAGGGGGGCGGGGTGGGGG - Intronic
1093100629 12:15024442-15024464 ATGGCAGGGTGGAGGGTTGGAGG - Intergenic
1093235718 12:16606532-16606554 AAAGAAGAGGGGAGGGGTGGGGG - Intronic
1094295076 12:28896753-28896775 GAAGCCTGGTAGAGGGGTGTGGG - Intergenic
1094493377 12:30975199-30975221 GGTGCAGGGTGGAGGGGCAGAGG + Intronic
1095409806 12:41909272-41909294 GACGCGGGGTGGGGTGGTGGGGG - Intergenic
1095566825 12:43634060-43634082 GAAGCAGAGTGGAGGGCTGGGGG - Intergenic
1095802600 12:46283915-46283937 GCAGCAGGCTGGAGGGATAGGGG + Intergenic
1095998018 12:48105851-48105873 ACAGCAGGGGGGAGGGGAGGTGG + Intronic
1096215632 12:49796279-49796301 GTAGCAGGGTGAAGGGCTGGTGG + Exonic
1096355572 12:50938193-50938215 GTAGGGGGGTGGGGGGGTGGAGG - Intergenic
1096356878 12:50948860-50948882 GGAGGAGGGGGGAGGGGAGGGGG + Intergenic
1096385929 12:51195567-51195589 GGTGCAGAGTGGAGGGGTGGAGG + Intronic
1096649429 12:53054548-53054570 GGACCAGAGTGGTGGGGTGGGGG + Intronic
1096864578 12:54554677-54554699 GAAGCAGGGAGGCAGAGTGGTGG + Intronic
1097093635 12:56527747-56527769 GGGGCATGGTGGGGGGGTGGCGG - Intronic
1097161495 12:57049388-57049410 GAACCCGGGTGGAGGAGCGGAGG + Intronic
1097173161 12:57128602-57128624 GAGGCGGGGAGGGGGGGTGGGGG - Exonic
1097173205 12:57128713-57128735 GAAGCGGGGGGGTGGGGTGAAGG + Exonic
1097190051 12:57215350-57215372 GAACCTGGGTGCCGGGGTGGGGG - Intergenic
1097197391 12:57250816-57250838 GAAGCGGGGGGTGGGGGTGGGGG - Intronic
1097226432 12:57479176-57479198 GAAGATGGGTCGAGAGGTGGAGG + Exonic
1097338142 12:58407654-58407676 TTAGCAGGGTGGAGGGTGGGAGG - Intergenic
1097819818 12:64117088-64117110 TAATCAGGGTGGTGGGGTGTTGG + Intronic
1098260753 12:68668031-68668053 GAAGGATGGGGGAGGGGTAGTGG - Exonic
1098489566 12:71059690-71059712 AAAGCAGCGGGGAGAGGTGGGGG + Intronic
1098621265 12:72602566-72602588 GAAGCAGGGGGCAGAAGTGGTGG + Intronic
1099133204 12:78862773-78862795 GAAGGAGGATGGTGAGGTGGAGG - Intergenic
1099133455 12:78864516-78864538 GAAGCGGGGTGGAGGCGGGTTGG - Intronic
1099236181 12:80084551-80084573 GAAGCAGGGTGGGGAGCAGGTGG - Intergenic
1099974315 12:89530390-89530412 AATGCAGGGTGGACAGGTGGAGG - Intergenic
1100362099 12:93888627-93888649 AAGGCAGGGTGGTGGGGTGTGGG + Intronic
1100403154 12:94249921-94249943 GCACCAGTGTGGGGGGGTGGGGG + Intronic
1100603502 12:96132386-96132408 GAAGGAGGGTGCTGGGGAGGAGG - Intergenic
1100885803 12:99068679-99068701 GATGCAGGTGGGAGGGGTGGGGG + Intronic
1101029295 12:100644241-100644263 GAAGCAGGGTGGTGGGATTTAGG + Intergenic
1101587598 12:106098668-106098690 AAAGGTGGGTGGAGGGGTGGGGG - Intronic
1101743747 12:107522096-107522118 CTCGCAGGGTGGTGGGGTGGGGG + Intronic
1101879395 12:108616292-108616314 GAAGGAGGTTGCAGGGCTGGTGG - Intergenic
1102052981 12:109876602-109876624 GAAGAAGGGAGGAAGGGAGGGGG + Intronic
1102180058 12:110905508-110905530 GATGAAAGGTGGAGGAGTGGAGG + Intronic
1102215181 12:111156220-111156242 GAAGCAGGGATGAGGGCAGGAGG - Intronic
1102225853 12:111227762-111227784 GGAGCTGGTTGGAGGGGTGAGGG - Intronic
1102316877 12:111895522-111895544 GCAGCAGGGTGGGGGGTGGGGGG - Intronic
1102394383 12:112574637-112574659 GGAGGAGGGAGAAGGGGTGGTGG + Intronic
1102552548 12:113702226-113702248 GAAGGAGGGAGGAAGGATGGAGG - Intergenic
1102899684 12:116626596-116626618 GAAAGAGGATGGAGGGGTGATGG + Intergenic
1103188281 12:118980342-118980364 GAAGCGGGGTTGGGGGGAGGGGG + Intergenic
1103238920 12:119397812-119397834 GAGGGAGGGGGGAGGGGGGGAGG + Intronic
1103286583 12:119806624-119806646 GAAGGAGGTTGTTGGGGTGGGGG - Intronic
1103397943 12:120622326-120622348 GGAGCAGGATGTCGGGGTGGAGG + Intergenic
1103408908 12:120696562-120696584 TGAACAGGGTGGAGGGGTGTGGG + Exonic
1103478024 12:121232807-121232829 GAAGGTGGGAGGAGGGCTGGGGG - Intronic
1103560452 12:121790702-121790724 GAAGCAGGGCTCAGGGGAGGTGG - Intronic
1103611538 12:122127128-122127150 GAAGCCGGGTGTATGGCTGGGGG + Intronic
1103788268 12:123449966-123449988 GGAGCATGGTGGTGGTGTGGAGG - Intergenic
1103975471 12:124699956-124699978 GGAGCGGGGAGGAGGGGTGAAGG - Intergenic
1103987018 12:124774175-124774197 GCTGTAGAGTGGAGGGGTGGGGG - Intergenic
1103987676 12:124778511-124778533 GAAGCGGGGTGTAGGGGCTGGGG + Exonic
1104192285 12:126493611-126493633 AAAACAGGGTGGAGGAGGGGTGG + Intergenic
1104595358 12:130116810-130116832 GAAGCTGGGTGGGAGGGTGGGGG + Intergenic
1104670127 12:130674775-130674797 GATGGAGGGTGCAGGGGCGGGGG - Intronic
1104714774 12:131009028-131009050 GGAGCAGGGTTGCGGGGCGGGGG + Intronic
1104841301 12:131827349-131827371 GAAGCGGGGGGGGGGGGGGGGGG + Intergenic
1104932008 12:132344948-132344970 GCGGCAGGATGGAGGGGAGGTGG - Intergenic
1105519904 13:21122720-21122742 GGAGTAGGGGGGAGGGGCGGAGG - Intergenic
1105747212 13:23388727-23388749 GAAGCAGGGAGGGTGGGAGGGGG + Intronic
1105886874 13:24649869-24649891 GAGGAAGGGTGGAGGAGAGGAGG - Intergenic
1105886876 13:24649877-24649899 GAGGTAGGGAGGAAGGGTGGAGG - Intergenic
1105896465 13:24720629-24720651 GAAGCAGGTTCAATGGGTGGTGG - Intergenic
1105978361 13:25493807-25493829 AAAGGAGTGTGGAGGGGAGGTGG + Intronic
1106144769 13:27040899-27040921 GAAGGAGGCTGCAGGGCTGGAGG - Intergenic
1106358277 13:29005519-29005541 AAAGCAGGGTGGAGAGGAGTCGG + Intronic
1106602938 13:31202564-31202586 GAAGGATGGTGGGGTGGTGGTGG + Intronic
1106666015 13:31851694-31851716 GAAGCAGTGTGGCATGGTGGTGG + Intergenic
1106907682 13:34425726-34425748 GCAGCAGGGCAGTGGGGTGGGGG - Intergenic
1107049542 13:36032553-36032575 GATGGCGGGTGGTGGGGTGGGGG - Intronic
1107466680 13:40657400-40657422 GCAGGGGGTTGGAGGGGTGGAGG - Intronic
1107918041 13:45172880-45172902 AAAGAAAGGTGGAGGGTTGGAGG - Intronic
1108074818 13:46668724-46668746 GTGGCGGGGTGGCGGGGTGGCGG + Intronic
1108171101 13:47742877-47742899 AGTGCAGGGTGGAGGGGAGGTGG + Intergenic
1108208274 13:48112943-48112965 GAAGCAGGGAGGCTGGGGGGAGG + Intergenic
1108218248 13:48206853-48206875 GTTGCGGGGTGGAGGGTTGGGGG + Intergenic
1108497395 13:51039265-51039287 GAAGCTGGGTGGAGGGTATGTGG + Intergenic
1108971119 13:56378466-56378488 GAAGAAGGGAGGAGGGAGGGAGG + Intergenic
1109008588 13:56910152-56910174 GGGGCCGGGTTGAGGGGTGGTGG - Intergenic
1109693804 13:65927477-65927499 GATGCAGGGTGGAGGGGTCATGG + Intergenic
1110553008 13:76828276-76828298 GAAGGAGGGGAGAGGGGAGGGGG + Intergenic
1110653550 13:77971178-77971200 GAAGCAAGGTGGCGGGGTTTAGG + Intergenic
1110706600 13:78606072-78606094 GTAGCCTGGGGGAGGGGTGGTGG + Intergenic
1111678394 13:91414838-91414860 GAAGGTGGGTTGGGGGGTGGAGG + Intronic
1112229161 13:97570290-97570312 AAAGGCGGGGGGAGGGGTGGTGG + Intergenic
1112302130 13:98240029-98240051 GAAGGAGGCAGGAGGGGAGGTGG + Intronic
1112404195 13:99103639-99103661 AAAGGAGGGAGGAGGGGAGGAGG - Intergenic
1112404602 13:99107857-99107879 GAGGAAGGGAGGAGGGGAGGAGG + Intergenic
1112566813 13:100558961-100558983 GAATTGGGGTGTAGGGGTGGTGG + Intronic
1112682966 13:101788157-101788179 GGGGCAGGGGGCAGGGGTGGTGG - Intronic
1113571657 13:111362294-111362316 GATGCTGGGAGGTGGGGTGGGGG + Intergenic
1113632769 13:111899372-111899394 GCAGCAGTGGGGCGGGGTGGGGG - Intergenic
1113674117 13:112196358-112196380 GGAGCAGGGAGGAGGGAGGGAGG - Intergenic
1113950535 13:114069062-114069084 CACGCAGGGAGGAGGCGTGGGGG + Intronic
1114298404 14:21351586-21351608 GAAGAAGGGGGGAGGGGTCCCGG - Exonic
1114484911 14:23056750-23056772 GGAGCAGACAGGAGGGGTGGAGG + Intronic
1114602669 14:23969356-23969378 GAGACAGGGAGGAGGGCTGGGGG - Intergenic
1114607037 14:24006485-24006507 GAGACAGGGAGGAGGGCTGGGGG - Intergenic
1114612344 14:24051449-24051471 GAGACAGGGAGGAGGGCTGGGGG - Intergenic
1114664526 14:24369867-24369889 GAAGCAGGGGGCCAGGGTGGGGG + Exonic
1115445062 14:33480541-33480563 GAGGGAGGGAGGAAGGGTGGGGG - Intronic
1115490011 14:33950227-33950249 GGAGCTGGGGCGAGGGGTGGGGG + Intronic
1115508815 14:34119761-34119783 GAAGCAGGCTGAAGGGAAGGGGG + Intronic
1115739094 14:36368502-36368524 GAAGCAGTGTGGTGGGGGTGGGG + Intergenic
1115962522 14:38851765-38851787 GAAGCAGGGGGGTGGGGTGGGGG - Intergenic
1116422468 14:44748801-44748823 TAAGAAGGGTGGGGGGGTGGTGG + Intergenic
1116630168 14:47320588-47320610 GAGACAGGATGGAGGGATGGAGG - Intronic
1116711851 14:48378221-48378243 GAAGTAGGGAAGAGGGGTGGGGG + Intergenic
1116985374 14:51213767-51213789 GTTGTAGGGTGGAGGGGAGGGGG - Intergenic
1117078303 14:52126155-52126177 GGAGCAGTGTGGAGGGCAGGGGG - Intergenic
1117145572 14:52833852-52833874 CCGGCAGGGGGGAGGGGTGGGGG - Intergenic
1117194798 14:53329162-53329184 GAAGCAGTGTGGAGTAGTGCTGG + Intergenic
1117519037 14:56531837-56531859 GCAGCAGAGTGGAGGGGGTGGGG - Intronic
1117653091 14:57926715-57926737 GAAGTAGGGTTGGGGGGGGGGGG + Intronic
1118427020 14:65676595-65676617 GAAGAAGGAAGGAGGGGTGGGGG - Intronic
1118491368 14:66263799-66263821 GAAGCAGGGAGCAGGGGAGGTGG + Intergenic
1118760770 14:68879186-68879208 GAGGGAGGGTGGGGGGGCGGGGG + Intronic
1119218938 14:72891442-72891464 GGTGCAGGGAGGAGGGGTAGCGG - Intronic
1119358321 14:74025888-74025910 GAGGCTGAGTGGCGGGGTGGGGG + Intronic
1119382752 14:74239496-74239518 GAAGCCCGGCGGGGGGGTGGGGG + Exonic
1119446177 14:74665321-74665343 CATGCAAGGTGGAGAGGTGGAGG - Intronic
1119605803 14:76015345-76015367 GAAGCAGAGGGGAGAGGAGGAGG - Intronic
1119867795 14:77988595-77988617 GAGGCAGAGTGGGGAGGTGGAGG + Intergenic
1119898133 14:78238143-78238165 GGGGCAGGGTGGTGTGGTGGGGG - Intergenic
1120201174 14:81539898-81539920 GAAGAAGGTGGGAGGGGTGGAGG + Intergenic
1120250795 14:82060175-82060197 GAAGCAAAGAGGAGGGGTGGTGG + Intergenic
1121183660 14:91947993-91948015 GGAGCAGCGGGGTGGGGTGGGGG + Intergenic
1121260352 14:92561368-92561390 GAAGCAGGCTGCAGGGAGGGAGG - Intronic
1121332538 14:93058460-93058482 GAGGCGGGGTGGAGGGGGTGCGG + Intronic
1121332548 14:93058488-93058510 GAGGCAGGGTGGAGGGGGTGCGG + Intronic
1121332583 14:93058596-93058618 GAGGCAGGGTGGAGGGGGTGCGG + Intronic
1121332643 14:93058768-93058790 GAGGGAGGGTGGAGGGGGTGCGG + Intronic
1121332693 14:93058905-93058927 GAGGCGGGGTGGAGGGGGTGCGG + Intronic
1121332725 14:93058991-93059013 GAGGCGGGGTGGAGGGGGTGCGG + Intronic
1121332840 14:93059326-93059348 TAAGCAGGGGGGAGGGGGTGCGG + Intronic
1121565866 14:94908713-94908735 GAAGAAAGGAGGTGGGGTGGGGG - Intergenic
1121630045 14:95415279-95415301 GTGGCAGGGTGGGTGGGTGGGGG - Intronic
1121638693 14:95471156-95471178 GAAGCTGGGAGCAGGTGTGGAGG - Intronic
1121645840 14:95516644-95516666 GACGCAGGGAGGAGGGAAGGAGG - Intronic
1121686239 14:95837310-95837332 GCAGGAGAGTTGAGGGGTGGAGG + Intergenic
1121738740 14:96236710-96236732 TAAACAGGGTGGAGGGATGATGG - Intronic
1121765797 14:96484353-96484375 GGAGCAGGGTGGAGTTGGGGAGG - Intronic
1121800311 14:96769081-96769103 GAAGGAGGGAGGAAGGGAGGAGG - Intergenic
1122156692 14:99754344-99754366 GAGGCAGGGGGCAGGGGAGGTGG - Intronic
1122227784 14:100289981-100290003 GGAGCAAGGTGAAGGGGCGGGGG - Intergenic
1122258589 14:100498963-100498985 CAAGCAGGGTGTAGGGGTAGAGG + Intronic
1122719677 14:103715312-103715334 GAGGCAGGGTCAAGGGGCGGGGG - Intronic
1122770850 14:104097054-104097076 GAAGGAGGGTGGTGGGGGTGAGG - Intronic
1122817369 14:104320318-104320340 GGAGCGAGGGGGAGGGGTGGAGG - Intergenic
1122885145 14:104707543-104707565 GAACCAGGGAGCAGGGGTGGGGG - Exonic
1122920246 14:104876941-104876963 GAAGCAGGCAGGAAGGCTGGAGG + Intronic
1122938077 14:104969070-104969092 GAAGCATCGGGGAGGGGCGGGGG - Intronic
1123025707 14:105422739-105422761 TAGGCAGGGTGAAGGTGTGGTGG + Intronic
1123467414 15:20527151-20527173 GCAGCAGGAGGTAGGGGTGGGGG + Intergenic
1123650700 15:22473891-22473913 GCAGCAGGAGGTAGGGGTGGGGG - Intergenic
1123741109 15:23282733-23282755 GCAGCAGGAGGTAGGGGTGGGGG - Intergenic
1123745889 15:23319825-23319847 GCAGCAGGAGGTAGGGGTGGGGG + Intergenic
1123766751 15:23488002-23488024 GAAGCATGGAAGAGGGGTGAGGG + Intergenic
1123905310 15:24914912-24914934 GAAGCAGGGTTGGGGTGTAGTGG + Intronic
1123943104 15:25226048-25226070 GGAGCCTGGTGGAGGGGAGGGGG + Intergenic
1124100032 15:26684299-26684321 GACGCAGGGTGGAGGTCTGGTGG + Intronic
1124278161 15:28343142-28343164 GCAGCAGGAGGTAGGGGTGGGGG + Intergenic
1124304540 15:28568466-28568488 GCAGCAGGAGGTAGGGGTGGGGG - Intergenic
1124969187 15:34468241-34468263 GAAGCAGGGTGGATCACTGGAGG - Intergenic
1125003655 15:34795608-34795630 GCAGCCGGGGGCAGGGGTGGGGG + Exonic
1125320697 15:38484474-38484496 GGAGGAGGGTGGGGGGGAGGAGG + Exonic
1125379863 15:39076160-39076182 AAAGCAGGGTGTGGTGGTGGAGG - Intergenic
1125478269 15:40062414-40062436 AAAGCATGGAGGAGTGGTGGTGG + Intergenic
1125751586 15:42032935-42032957 CATGCAGTGGGGAGGGGTGGGGG - Intronic
1126192892 15:45897522-45897544 GGAGAAGGTTGGAGTGGTGGAGG + Intergenic
1127519739 15:59731736-59731758 GAAGCAGGGTGAAGGGCTGCAGG + Intergenic
1127802490 15:62489522-62489544 GGGGCAGGGTGGAGGGGAGAAGG - Intronic
1128347045 15:66860877-66860899 GAAGGAGGGCAAAGGGGTGGGGG + Intergenic
1128620108 15:69141659-69141681 ATGGCAGGGTGGGGGGGTGGGGG - Intergenic
1128789056 15:70419316-70419338 GAAGCAGAGAGGAGGGGAGAGGG + Intergenic
1129193987 15:73953450-73953472 GCAGCAGGGTGGAGTGGGTGTGG + Intergenic
1129244688 15:74272141-74272163 GAGGCAGGTTGGAGGGGCTGAGG - Intronic
1129281682 15:74490046-74490068 GGAGGAGGGTGGGGGTGTGGGGG - Intergenic
1129300198 15:74621046-74621068 GAGGCAGGGAAGAGGGATGGGGG - Intronic
1129458617 15:75688904-75688926 GAAGCAGGGGGCAGGTGGGGTGG - Exonic
1129667089 15:77585269-77585291 AGAGCAGGGTGGTGGGGTGGAGG + Intergenic
1129725175 15:77897968-77897990 GAAGCAGGGGGCAGGTGGGGTGG + Intergenic
1129799743 15:78405347-78405369 GCAGCAGGCTGCAGTGGTGGTGG - Intergenic
1129901878 15:79157656-79157678 TCAGTGGGGTGGAGGGGTGGGGG + Intergenic
1130758989 15:86797729-86797751 AAAGCATGGGGCAGGGGTGGTGG + Intronic
1130923080 15:88365385-88365407 GAGGGAGGGCAGAGGGGTGGGGG + Intergenic
1130939538 15:88496254-88496276 GAAGCAGAGGGGAGGGGAGTAGG - Intergenic
1131001942 15:88946024-88946046 GAAGCAGGGTGTAGGGGCAAAGG + Intergenic
1131067758 15:89444766-89444788 AAAGTAGGGTGGAGGGGGGAGGG - Intergenic
1131288137 15:91080394-91080416 AAAGCAGGGTGGAGCGGGAGGGG - Intergenic
1131399212 15:92111095-92111117 GAAGCACAGTGGTGGGGCGGGGG - Intronic
1131541589 15:93279581-93279603 GGAGTAGGGGTGAGGGGTGGGGG - Intergenic
1131546180 15:93317340-93317362 GAAGCTGGGTGGAAGGCTGTGGG + Intergenic
1131597469 15:93813053-93813075 GAAGCAGAGTGGAGTCGTGGGGG - Intergenic
1131714603 15:95094802-95094824 GTGGAGGGGTGGAGGGGTGGAGG - Intergenic
1131714607 15:95094810-95094832 GGGGAGGGGTGGAGGGGTGGAGG - Intergenic
1131785394 15:95906557-95906579 GGAGCAGAAGGGAGGGGTGGGGG + Intergenic
1131857160 15:96609840-96609862 GAAGGAGGGAGGAGGGACGGTGG - Intergenic
1131900046 15:97077907-97077929 GAAGGTGGGTGGAGGGTTGTTGG - Intergenic
1131977704 15:97961794-97961816 GAAGCGGGTAGGAGGGGAGGAGG - Intronic
1132071287 15:98778574-98778596 GGAGCAGGGTTGAGGAGTGGGGG + Intronic
1132178871 15:99736425-99736447 GAAGCGGGATGAAAGGGTGGTGG + Intergenic
1132211324 15:100024792-100024814 AAAGCAGGGGAGTGGGGTGGAGG - Intronic
1132372355 15:101307644-101307666 GGAGCCGTGTGGTGGGGTGGGGG - Intronic
1132569685 16:638619-638641 GAAGGTGGGGGCAGGGGTGGGGG + Intronic
1132592902 16:734090-734112 GAACAAGGGTGGAGGTGTGCTGG + Intronic
1132757756 16:1494139-1494161 GGACCAGGGTTGAGGGGTGTGGG + Intronic
1132782963 16:1638592-1638614 GAAGCAGGGCTGAGGGGCGCTGG - Intronic
1132802711 16:1762205-1762227 GAAGCGGTGTGGAGGGGTGTCGG - Intronic
1132844583 16:1993929-1993951 GAAGCAGGGTGCAGGTGGAGAGG - Exonic
1133002397 16:2857972-2857994 GAAGGAGGGTGGAGGTGAGAGGG + Intronic
1133069392 16:3235569-3235591 GTAGGGGGGTGGCGGGGTGGGGG - Intronic
1133172892 16:3992714-3992736 GGAGCAGGGTGCATGGGTCGGGG + Intronic
1133279327 16:4656103-4656125 CAAGCAGGGCGGTGGGGTGGAGG + Intronic
1133565998 16:6993961-6993983 TATGCAGGGAAGAGGGGTGGAGG + Intronic
1133665161 16:7960023-7960045 GAGGCTGGGTGGAGAGGAGGAGG + Intergenic
1133883808 16:9807335-9807357 GAGGAAGGGTGGAGGGGGAGAGG + Intronic
1133890286 16:9872783-9872805 GAGGCCAAGTGGAGGGGTGGGGG + Intronic
1133909990 16:10057001-10057023 GTAGAAGGCTGGAGGGGTGGAGG - Intronic
1134106124 16:11486868-11486890 GATGATGGGTGGGGGGGTGGGGG + Intronic
1134761932 16:16722214-16722236 GCAGCAGGGTGGAGAGGGGATGG + Intergenic
1134984126 16:18636956-18636978 GCAGCAGGGTGGAGAGGGGATGG - Intergenic
1135189622 16:20344183-20344205 GAATGGGGGTGGAGGGGGGGTGG + Intronic
1135302861 16:21345808-21345830 GAAGGAGGGGGGAGGGGAGGAGG - Intergenic
1135725982 16:24854178-24854200 GGAGGAGGGAGGAGGGGCGGCGG - Intronic
1135757702 16:25111820-25111842 GAAGCGGGGTCGACGGGCGGCGG - Exonic
1135912958 16:26578142-26578164 GAAACTGGGAGGAGGGGTGGTGG - Intergenic
1136363087 16:29793995-29794017 GAAGCAAGTTGCAGGGATGGAGG + Intronic
1136546589 16:30958218-30958240 GAATCCGGGCGGGGGGGTGGGGG - Intronic
1137044184 16:35641049-35641071 GAAGCAGGGTGTGGGGCAGGTGG + Intergenic
1137500805 16:49010553-49010575 AAAGCAGGAAGGAGCGGTGGAGG + Intergenic
1137506844 16:49061423-49061445 GCAGCAGAGTGGAGTAGTGGTGG + Intergenic
1138085608 16:54131279-54131301 GAAGGAGGCTGGAGGGAAGGAGG + Intergenic
1138134025 16:54506294-54506316 GAAGGGGGGTGGAGGGGAGGTGG - Intergenic
1138199832 16:55080441-55080463 GGATGAGGGTTGAGGGGTGGGGG + Intergenic
1138219911 16:55241744-55241766 AAAGCAGGATGGGGAGGTGGTGG + Intergenic
1138287649 16:55822478-55822500 GAAGCTGAGTGGAGGCGTGGTGG + Intronic
1138295336 16:55880463-55880485 GAGCAAGGGTGGAGGGGAGGAGG - Intronic
1138474481 16:57262861-57262883 GATGCCGGCTGGAGGCGTGGGGG - Intronic
1138486698 16:57349845-57349867 GAAGGAGGGAGGAGGGAAGGGGG - Intergenic
1138663572 16:58542577-58542599 GGAGGTGGGTGGGGGGGTGGGGG + Intronic
1138766530 16:59612262-59612284 GGGGCGGGGTGGAGGGGGGGGGG - Intergenic
1138947061 16:61864360-61864382 GAAGCAGTGTGATGGGGAGGGGG - Intronic
1139375052 16:66491637-66491659 CAGACAGGGTGGAGGGATGGGGG + Intronic
1139655760 16:68386557-68386579 GAACCAGAGGGGTGGGGTGGGGG - Intronic
1139671344 16:68493912-68493934 GACTGAGCGTGGAGGGGTGGTGG + Intergenic
1139701556 16:68710966-68710988 GAAGGAGGGGGGAGGGGGGAGGG + Intronic
1139705455 16:68737755-68737777 GAAGCGGGGTGTAGGGGGTGGGG + Intronic
1139837271 16:69849217-69849239 CTAGCAGGGAGGAGGGGTGGAGG + Intronic
1139956485 16:70695691-70695713 GAAGCCAGGTGCAGGGGGGGAGG - Intronic
1140003271 16:71047987-71048009 TAAGAAGGGTAGAGGGGAGGTGG - Intronic
1140038524 16:71389888-71389910 GAAGCAGGGTTTGGGGGAGGTGG - Exonic
1140056707 16:71531674-71531696 CAAGCAGGATGGAGGGAGGGAGG + Intronic
1140253727 16:73317268-73317290 GAAGCCGGGGGGTGGGGTGGGGG + Intergenic
1140662415 16:77199977-77199999 AAAGGAGGGTGGAGGGGTGTCGG + Exonic
1140870512 16:79102049-79102071 GGAGTAGGGGGGAGGGGGGGAGG + Intronic
1140906742 16:79415674-79415696 CAAGCAGAAGGGAGGGGTGGAGG - Intergenic
1141075946 16:81006857-81006879 GGAGCACGGTGGAGCGGTGGAGG - Exonic
1141421533 16:83920997-83921019 GAAGATGGGTGGATGGATGGTGG + Exonic
1141423716 16:83932544-83932566 GAGCCAGGGCTGAGGGGTGGAGG - Intronic
1141506558 16:84482098-84482120 GAAGCAGGGGGAAGCGGGGGAGG - Intronic
1141664262 16:85457744-85457766 GTGGCAGGCTGTAGGGGTGGAGG + Intergenic
1141668743 16:85480450-85480472 GAAACAGGGTGGAGTGGAGGTGG - Intergenic
1141688658 16:85584390-85584412 GAGGCAGCGTGGAGGGAAGGCGG - Intergenic
1141762624 16:86038748-86038770 GGAGAAGGGTGGCAGGGTGGAGG - Intergenic
1141765890 16:86059876-86059898 GAAGCTGGGTGGAGGTGAGGGGG + Intergenic
1141772128 16:86095937-86095959 GAAGCTGGGCTGAGGAGTGGTGG - Intergenic
1141948211 16:87324557-87324579 GAAGCAAGGTGGAAAGGTGCTGG - Intronic
1141971500 16:87487245-87487267 GCAGGAGTGTGGTGGGGTGGTGG - Intronic
1142004036 16:87680586-87680608 GAGCCATGGTGCAGGGGTGGGGG + Intronic
1142008252 16:87700611-87700633 GAAACAGGGTGGAGGGAGGAGGG + Intronic
1142030656 16:87836824-87836846 GAAGGAGGGAGGAGAGGAGGAGG + Intronic
1142147891 16:88500096-88500118 GAAGCCGGGTGGGAGGGCGGAGG - Intronic
1142219052 16:88844049-88844071 GAAGCAGGTAGAAGGGATGGAGG + Intronic
1142252246 16:88997342-88997364 GAAGATGGGTGAAGGGGTGCAGG - Intergenic
1142265371 16:89061971-89061993 GCAGCAGGGGTGAGGGGTGCAGG - Intergenic
1142287865 16:89178796-89178818 AAAGCAGCCTGGAGAGGTGGAGG + Intronic
1142581967 17:948828-948850 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142581989 17:948884-948906 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142581997 17:948903-948925 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582005 17:948922-948944 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582013 17:948941-948963 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582084 17:949111-949133 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582112 17:949187-949209 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582140 17:949263-949285 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582168 17:949339-949361 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582196 17:949415-949437 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582223 17:949491-949513 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582238 17:949529-949551 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582259 17:949586-949608 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582274 17:949624-949646 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582295 17:949681-949703 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142598634 17:1041881-1041903 GAAGAAGGGTGAAGGGGTCAAGG + Intronic
1142666357 17:1465990-1466012 GATGCAGGCAGGAGTGGTGGGGG + Intronic
1142683296 17:1562496-1562518 GAAGCGGGGAGGAGGGAGGGTGG - Intronic
1142903551 17:3027766-3027788 GGAGCAGAGGGGAGGGATGGAGG + Intronic
1142903985 17:3030878-3030900 AAAGGAGGGTGGAGCTGTGGAGG - Intronic
1142958190 17:3535275-3535297 GAAGGAGGGAGGAAGGGAGGAGG - Intronic
1142982427 17:3679875-3679897 GAAGCAGGGTGGCGGCCTGCAGG - Intronic
1142982453 17:3679973-3679995 GAAGCAGGGTGGAGGACTCAGGG - Intronic
1142982640 17:3680618-3680640 GAAGCAGGGTGGTGGCCTGCAGG - Intronic
1142982654 17:3680661-3680683 GAAGCAGGGTGGTGGCCTGCAGG - Intronic
1143022658 17:3924852-3924874 GAAGCAGAGTGGAGTGGAGGGGG + Intronic
1143033755 17:3982662-3982684 GAGGCTGGGTGGAGGCATGGAGG - Intergenic
1143115855 17:4581617-4581639 CAAGCAGTGTGCAGGTGTGGGGG + Intergenic
1143275963 17:5710990-5711012 GAAGCAGGGTGCTGGGGATGGGG - Intergenic
1143325905 17:6098139-6098161 GAGACAGGGGGGCGGGGTGGGGG + Intronic
1143379913 17:6489582-6489604 GAGGCAGGGCTGAGGGGTGGAGG - Intronic
1143485748 17:7252607-7252629 GAGGCACGGTGGCGGGGCGGGGG + Intronic
1143504557 17:7356526-7356548 GAGGGAGGGAGGATGGGTGGTGG - Intronic
1143515493 17:7417532-7417554 GAAGCGGGGTGGTGGCGTCGGGG + Exonic
1143585706 17:7849165-7849187 GGAGGAGGCTGGCGGGGTGGCGG + Exonic
1143598076 17:7927615-7927637 GAATCAGGGTGGTGGGGGTGAGG - Intronic
1143659060 17:8313566-8313588 GAACCAGGGAGTAGGGGTGGGGG - Intronic
1143665256 17:8354424-8354446 GAAGAAGGGAGGCAGGGTGGTGG + Intergenic
1143775278 17:9195198-9195220 GGCCCAGGGTGGAGGGGTGGAGG - Intronic
1144096649 17:11906040-11906062 GAGGCAGAGTGGAGGGGACGAGG - Intronic
1144141614 17:12355044-12355066 GGAGTAGGGAGGAGGGATGGGGG - Intergenic
1144204106 17:12967075-12967097 GAAGAAGGGTGCTGGGGTTGGGG - Intronic
1144222503 17:13112823-13112845 GAGGCAGGGTGGATGGGAGATGG - Intergenic
1144559007 17:16306451-16306473 CAAGGTGGGTGGTGGGGTGGTGG - Intronic
1144575977 17:16429738-16429760 GCAGGAGGGTGGAGGTGAGGAGG + Intronic
1145816442 17:27798368-27798390 GCACCATGGCGGAGGGGTGGGGG - Intronic
1145846301 17:28041873-28041895 GAAGCCGGGTGGGGGGGAGGGGG + Intronic
1145902613 17:28498285-28498307 GAGGCCGGGTGGAGGTGGGGTGG - Intronic
1145916262 17:28575776-28575798 GATGCAGGGTGGGGGTGGGGAGG + Intronic
1145936593 17:28717953-28717975 GCAGAAGGGTGGAGAGGAGGGGG - Intronic
1145950381 17:28812473-28812495 GAGCCAGGGTGGAGGTGAGGGGG - Intronic
1146178140 17:30679674-30679696 GGAGCAGGAAGGAGGGGGGGAGG + Intergenic
1146403655 17:32519409-32519431 GAAGCAGGGAGGAGGGGAGGCGG + Intronic
1146473634 17:33144426-33144448 GAAGCAGGATGGAGTGCTGTAGG - Intronic
1146582608 17:34052526-34052548 GAAAGAGGGTGGAAGGATGGTGG - Intronic
1146620781 17:34395543-34395565 GAACCATGGTGGGGAGGTGGTGG + Intergenic
1146624933 17:34428007-34428029 GAGGGAGGGAGGAGAGGTGGAGG - Intergenic
1146789441 17:35743171-35743193 GAACCAGGGGGCAGGGGTGCAGG - Exonic
1147191640 17:38741431-38741453 GCACCTGGGTGGAGGGGTTGAGG - Intronic
1147219990 17:38922894-38922916 ACAGCAGGGTGGAGAGGAGGAGG + Intergenic
1147315933 17:39620205-39620227 GGATGGGGGTGGAGGGGTGGGGG + Intergenic
1147662635 17:42125165-42125187 GACCGAGGGTGGAGGGGTTGTGG + Intronic
1147889061 17:43704504-43704526 GAGGCATGGGGGAGGGGTGTTGG - Intergenic
1147935464 17:44008098-44008120 AGAGCAGGGTGTAGGGGTGAGGG - Intronic
1147945451 17:44077888-44077910 GATGCAGAGTGGAGGGGAGGTGG - Exonic
1147955914 17:44134380-44134402 GAAGCAGGGTGGAGCAGAGTAGG + Intergenic
1147967508 17:44200781-44200803 GAGGCTGTCTGGAGGGGTGGGGG - Intergenic
1147971281 17:44220007-44220029 GAAGGAGGGGAGGGGGGTGGTGG + Intronic
1148083037 17:44977859-44977881 GCAGCAGGCAGGAGAGGTGGAGG + Intergenic
1148724583 17:49779476-49779498 GGGGCAGGGTGGAGGGTGGGTGG + Intronic
1148783720 17:50135195-50135217 GAGGTGGGGTGGAGGGGTGGGGG + Exonic
1149073116 17:52567267-52567289 GTAGCAAGGTAGAGGGTTGGGGG - Intergenic
1149572263 17:57680876-57680898 GGAGCAGGGTGGGGGGCAGGGGG - Exonic
1149772955 17:59335421-59335443 GAAGCAGAGTGGACAGGTTGGGG - Intronic
1150287588 17:63962733-63962755 GAAGCACAGGGTAGGGGTGGAGG - Intronic
1151011350 17:70501047-70501069 AAAGCAGAGAGGAGGGGAGGAGG + Intergenic
1151013721 17:70531014-70531036 GCTGGAGGGTGGGGGGGTGGAGG + Intergenic
1151013725 17:70531022-70531044 GTGGGGGGGTGGAGGGGTGGAGG + Intergenic
1151013772 17:70531124-70531146 GGTGGGGGGTGGAGGGGTGGAGG + Intergenic
1151190688 17:72395700-72395722 GAAGCAGGATGGAGTCATGGTGG - Intergenic
1151276538 17:73038751-73038773 GAGGGAGGGAGGAGGGATGGAGG + Intronic
1151386544 17:73758549-73758571 GAAGGAGGAGGGAGGGATGGTGG + Intergenic
1151427933 17:74043273-74043295 GAGGCAGGGAGGAAGGATGGGGG + Intergenic
1151490618 17:74430834-74430856 GTAGCAAGGTGGAGGAGCGGGGG - Intronic
1151541033 17:74764625-74764647 CCTGCAGGGTGAAGGGGTGGGGG - Intronic
1151719173 17:75845906-75845928 GAAGCAGGCTGGGGGGCTGGTGG + Exonic
1151894350 17:76969927-76969949 GAATGTGGGTTGAGGGGTGGTGG - Intergenic
1151962049 17:77410682-77410704 GAAGCAGGGTGGAGCGCCTGGGG + Intronic
1152128598 17:78462252-78462274 GTAGGGGGGTGGGGGGGTGGGGG + Intronic
1152134397 17:78495326-78495348 AAAGCAGGGTTGGGGGGTTGGGG - Intronic
1152141890 17:78541251-78541273 GCAGATGGGTGGGGGGGTGGGGG + Intronic
1152318149 17:79592914-79592936 GAAGCAGGGGTGTGGGGTAGTGG - Intergenic
1152325610 17:79634144-79634166 GAAGCATGGGAGAGGTGTGGAGG - Intergenic
1152337588 17:79707222-79707244 GAAGAAGGGAGGAGGAGCGGAGG - Intergenic
1152344181 17:79741655-79741677 GAAACAGGATGGTGGGCTGGGGG - Intronic
1152362398 17:79838892-79838914 GAGGCGGGGTGGAGGTGGGGTGG - Intronic
1152730631 17:81967944-81967966 CCAGCAGGCTGGACGGGTGGGGG - Intergenic
1152759512 17:82100670-82100692 ACAGCAGAGTGCAGGGGTGGAGG - Intergenic
1152772345 17:82177925-82177947 GAAGCGGGGTGCAGGGCTGTAGG - Intronic
1152851392 17:82638309-82638331 GAAGGAAGGTGGGGTGGTGGTGG + Intronic
1152881234 17:82816823-82816845 GAAGCAGGGGGCAAGTGTGGTGG - Intronic
1152926285 17:83089217-83089239 GGAGCAGTGGGTAGGGGTGGAGG - Intronic
1153090893 18:1341195-1341217 GATGTGGGGTGGAGGGATGGGGG + Intergenic
1153528708 18:6021759-6021781 GCAGCGGGGTGGGGGGGTGGCGG + Intronic
1153557728 18:6333622-6333644 GAAGCAGGATGCAGGTGGGGTGG + Intronic
1153914558 18:9734077-9734099 GAAGCTGGGGGGCAGGGTGGCGG + Intronic
1153914562 18:9734085-9734107 GGGGCAGGGTGGCGGGGAGGAGG + Intronic
1153980234 18:10302605-10302627 GAGCCAAGGTGGAGGGCTGGGGG + Intergenic
1154492330 18:14931903-14931925 GCAGGAGGGAGGTGGGGTGGGGG - Intergenic
1154492346 18:14931938-14931960 GGAGGAGGGAGGTGGGGTGGGGG - Intergenic
1155066532 18:22273754-22273776 GGAGGAGGGAGGAGGGGAGGAGG - Intergenic
1155518323 18:26644470-26644492 GAAGCAGGGGGCAGGTGCGGTGG + Intronic
1155542513 18:26883202-26883224 GGAGCAGGATGAACGGGTGGAGG + Intergenic
1155548572 18:26940602-26940624 GAAGCAGGGGTTATGGGTGGAGG + Intronic
1156504744 18:37582690-37582712 GAAGCAGGATGAAGGGCAGGAGG - Intergenic
1156521195 18:37723592-37723614 GAAGAAGGGAGGAGGGAAGGAGG + Intergenic
1157040790 18:44036617-44036639 AAAGCAGGATGGGGGGGGGGGGG - Intergenic
1157196882 18:45626807-45626829 GGGTCGGGGTGGAGGGGTGGGGG - Intronic
1157310181 18:46546843-46546865 GAGGCAGAGGGGAGGGGTGCTGG + Intronic
1157385832 18:47259616-47259638 GAAGCAGTTTGGGGGGGTGGTGG + Intergenic
1157390185 18:47295361-47295383 AAAGGAAGGTGAAGGGGTGGGGG - Intergenic
1157417635 18:47519273-47519295 GAACTAGGGTGGGTGGGTGGAGG + Intergenic
1157426873 18:47591651-47591673 GAAGCAGGGTGGAGGCAGGGAGG + Intergenic
1157493535 18:48139700-48139722 GAGGGAGGCTGGAGGGGTGGTGG - Intronic
1157890466 18:51411170-51411192 GATGCAAGATGGAGGAGTGGGGG + Intergenic
1157918771 18:51695179-51695201 TGTGCAGGGTGGAGGGGAGGAGG + Intergenic
1158031120 18:52966429-52966451 AAAGTAGGGTTTAGGGGTGGAGG - Intronic
1158043249 18:53123408-53123430 GAAGCAGAGTGGGGGTGTGAAGG + Intronic
1158103794 18:53861405-53861427 GAAGGAGGGAGGAGGGAGGGAGG + Intergenic
1158103820 18:53861469-53861491 GAAGGAGGGAGGAGGGAGGGAGG + Intergenic
1158103845 18:53861538-53861560 GAAGGAGGGAGGAGGGAGGGAGG + Intergenic
1158421835 18:57301800-57301822 GCAGCAGGGTGTGGGGGCGGTGG - Intergenic
1158547663 18:58409859-58409881 CAAGCAAGGTGGAGAGGGGGTGG - Intergenic
1158816427 18:61103180-61103202 GAAGCAGGGAGGAGCAGAGGGGG + Intergenic
1158851025 18:61496003-61496025 GAGGAAGGGTGGAGGGGAGAGGG - Intronic
1158862538 18:61606728-61606750 GAACGTGGGTGGTGGGGTGGTGG + Intergenic
1159343604 18:67169361-67169383 GAAGGAGGGAGGAGGGAGGGAGG + Intergenic
1159545948 18:69839501-69839523 GAAGCAGGGCAGAGGAGGGGAGG - Intronic
1159652027 18:70988769-70988791 GAAGCATGGTGGGGGGCTGGGGG - Intergenic
1159695632 18:71553323-71553345 GAAGCCTGCTGCAGGGGTGGAGG + Intergenic
1159843326 18:73426527-73426549 GAAGCAGGCTGCAGGGTAGGAGG + Intergenic
1159859627 18:73631700-73631722 GTACCAGGCTGGAGGGGTTGGGG + Intergenic
1159972311 18:74669432-74669454 GAATGGAGGTGGAGGGGTGGGGG - Intronic
1160319253 18:77875078-77875100 GGAGGAGGGTGGAGAGGTGGAGG - Intergenic
1160498335 18:79388158-79388180 GGAGTCTGGTGGAGGGGTGGGGG + Intergenic
1160513387 18:79465383-79465405 GAGGCAGGCTGGATGGGTGGAGG - Intronic
1160541909 18:79628525-79628547 GATGCCGGGGGGAGGGCTGGAGG + Intergenic
1160705123 19:525943-525965 GGAGCAGAGGGGAGGGGAGGAGG + Intergenic
1160764712 19:802317-802339 GAACGTGGGTGGAGGGGAGGCGG + Intronic
1160916847 19:1500822-1500844 GGAGGAGGGAGGAGGGGAGGAGG + Intergenic
1160916859 19:1500844-1500866 GGAGGAGGGAGGAGGGGAGGGGG + Intergenic
1160990094 19:1856938-1856960 GGAGCAGGTTGCCGGGGTGGGGG + Intronic
1161088073 19:2344204-2344226 GGAGCAGGGTGATGGGGTGGAGG - Intronic
1161314239 19:3610437-3610459 GAGGCAAGGCAGAGGGGTGGGGG + Intergenic
1161314951 19:3613401-3613423 GGAGCAGGATGGAGGGGCCGTGG - Intronic
1161329019 19:3677763-3677785 GATGGAGGATGGAGGGATGGAGG + Intronic
1161329213 19:3678413-3678435 GATGAAGGATGGAGGGATGGAGG + Intronic
1161329221 19:3678443-3678465 GATGGAGGATGGAGGGATGGAGG + Intronic
1161329226 19:3678458-3678480 GATGGAGGATGGAGGGATGGAGG + Intronic
1161350047 19:3786302-3786324 GAAGAAGGGTCGGGGAGTGGGGG + Intronic
1161407952 19:4100975-4100997 GCAGCAGGGAGGAGAGCTGGAGG + Intronic
1161444382 19:4310315-4310337 GGGGCAGGGTAGTGGGGTGGGGG - Intronic
1161566599 19:5006079-5006101 GAAGAAGGATGGGGGGCTGGTGG + Intronic
1161591603 19:5131562-5131584 GAGGCAGGGAGGAGGGGGGCAGG + Intronic
1161657626 19:5525707-5525729 GATGAAAGGTGGATGGGTGGGGG - Intergenic
1161679702 19:5673698-5673720 GATGGAGGATGGATGGGTGGTGG - Intergenic
1161857450 19:6773699-6773721 GGCCCAGGCTGGAGGGGTGGTGG + Intronic
1161878052 19:6927192-6927214 GAAGAAGGGAGGAGGGAGGGAGG - Intronic
1162096386 19:8312267-8312289 GAAGCAGGAGGGTGGGGTGATGG + Intronic
1162205804 19:9055118-9055140 AAAACAGTGTGGAGGGCTGGGGG + Intergenic
1162237729 19:9321773-9321795 GGAGGAGGGTGGGGGGGAGGAGG - Intergenic
1162337669 19:10071572-10071594 GATGGAGGGTGCAGGGGTTGGGG - Intergenic
1162380523 19:10329163-10329185 TTTGCAGGGTGGCGGGGTGGAGG - Intronic
1162767714 19:12930158-12930180 GAAGCATGGTGGAGGCATGGTGG - Intronic
1162784231 19:13024178-13024200 GAAAAAGGGTGAAGGGGTTGTGG + Intronic
1162918754 19:13888338-13888360 GAGGCAGGTGGGAGGGGAGGAGG - Intronic
1162933642 19:13969712-13969734 AAAGCAGGGTTGGGGGGTGTCGG + Intronic
1162969215 19:14170070-14170092 GATTCAGGGTGAAGGGCTGGGGG - Intronic
1163023414 19:14495858-14495880 GAAGCGGGGGTGGGGGGTGGTGG - Intronic
1163096678 19:15063207-15063229 GAAGGAGGGGGGAGGGGAGAGGG - Intergenic
1163273402 19:16267619-16267641 CAAGCAGGTTGGATGGGAGGAGG + Intergenic
1163383641 19:16985685-16985707 GATGAAGGGTGGATGGATGGAGG + Intronic
1163435526 19:17292938-17292960 GATGCAGGGTAGATGGGAGGAGG - Intronic
1163461044 19:17437771-17437793 GCAGAAAGGTGGAGAGGTGGGGG + Intronic
1163551767 19:17969493-17969515 GTGGAGGGGTGGAGGGGTGGAGG - Intronic
1163551771 19:17969501-17969523 CCAAGAGGGTGGAGGGGTGGAGG - Intronic
1163561301 19:18021067-18021089 GCATTAGGGTGCAGGGGTGGCGG - Intergenic
1163588615 19:18177647-18177669 GAACCAGGGTGCATGGGTTGGGG + Intronic
1163683468 19:18696914-18696936 GAATCACAGGGGAGGGGTGGGGG + Intronic
1163715720 19:18870884-18870906 GAGGCAGGGAGGAGGGGAAGAGG - Intronic
1163786762 19:19278830-19278852 GAAGCAGGAAGGAGGGGAGCAGG + Intronic
1163916736 19:20246733-20246755 GGAGCAGGGTGGTGGGGTTCAGG - Intergenic
1164441812 19:28284861-28284883 GAAGGAGGGTGGAGAGAAGGAGG + Intergenic
1164441820 19:28284876-28284898 GAAGGAGGGTGGAGGGAAGGGGG + Intergenic
1164558190 19:29269487-29269509 GAGGCATGGGGGAGAGGTGGGGG + Intergenic
1164575137 19:29401480-29401502 GCAGCAGAGTGGAGTGGAGGAGG + Intergenic
1164732771 19:30518848-30518870 GAACCAGGGCAGAGGGATGGGGG + Intronic
1164757387 19:30700332-30700354 GAAGGAGGGGGGAGGGAGGGAGG - Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165085804 19:33346153-33346175 GAAGCAGGGGGCAGGGGGTGGGG + Intergenic
1165172883 19:33906219-33906241 GGGGGAGGGTGGTGGGGTGGGGG - Intergenic
1165331864 19:35144632-35144654 GAAGCAGGGCGGGGGGTGGGGGG + Intronic
1165420655 19:35720587-35720609 GAAGGGGGTGGGAGGGGTGGAGG - Exonic
1165462010 19:35949488-35949510 GAAGCAGGAAGGATGGGAGGAGG + Intergenic
1165743436 19:38217052-38217074 GAAGGATGGGGGAGGGGAGGAGG - Intronic
1165824102 19:38695839-38695861 TCAGCATGGTGGCGGGGTGGGGG - Intronic
1165858706 19:38895241-38895263 GCAGCAGGGTGGATGGGAGGTGG - Intronic
1165941399 19:39416411-39416433 GAGGGTGAGTGGAGGGGTGGGGG + Exonic
1165943734 19:39428817-39428839 GATGCCAGGAGGAGGGGTGGAGG - Intergenic
1166198127 19:41219734-41219756 GAAGCTGAGGGCAGGGGTGGGGG + Intronic
1166214269 19:41325391-41325413 GAAGCAGGGAGAAGGGACGGGGG - Intronic
1166305263 19:41933976-41933998 GAGGCAGAGTGGAGGGGTGGGGG + Intergenic
1166377219 19:42334313-42334335 GGAGGAGGGTGGGGTGGTGGGGG - Intronic
1166517312 19:43457077-43457099 GAAGGAGGTTGGAGGGGTTGCGG + Intergenic
1166677389 19:44748431-44748453 GAGGCGGGGTCGGGGGGTGGGGG - Intronic
1166686043 19:44796899-44796921 GAAGCGGGGCGGTGGGGGGGAGG + Intronic
1166688805 19:44810862-44810884 GATGCAGGGAGAAGGGATGGAGG + Intronic
1166798366 19:45441382-45441404 GTAGCAGGGTGGATGGCGGGGGG + Intronic
1166807567 19:45496582-45496604 GAAACAGGGCGGAGGTGAGGGGG - Intronic
1166884964 19:45954562-45954584 GATGGAGGGCTGAGGGGTGGGGG + Intronic
1167575485 19:50315637-50315659 GGAGCAGTGGGGGGGGGTGGGGG + Exonic
1167852697 19:52214068-52214090 GAAGCATTGAGGAGGGGAGGTGG + Intronic
1168100864 19:54140249-54140271 CAAGGCGGGTGGCGGGGTGGGGG - Intronic
1168267509 19:55230739-55230761 GCAGCAGGGCGGGGGGGTGGGGG - Intronic
1168284096 19:55321895-55321917 GAAGGAGAGTGGAGGGGAGGAGG - Intronic
1168427864 19:56253319-56253341 TGGGCAGGGAGGAGGGGTGGAGG + Intronic
1168636292 19:57999838-57999860 GAAGCCTGGAGGAGGGGAGGAGG - Exonic
925313765 2:2906691-2906713 GGAGGAAGGTGTAGGGGTGGTGG - Intergenic
925643189 2:6006915-6006937 GTTGGAGGGTGCAGGGGTGGGGG - Intergenic
925948911 2:8893053-8893075 GAGGCAGGGGGAGGGGGTGGGGG + Intronic
925948925 2:8893078-8893100 GAGGCAGGGGGAGGGGGTGGGGG + Intronic
926726870 2:16005308-16005330 GAGGGAGGGGGGAGGGGTGGGGG - Intergenic
926953641 2:18271425-18271447 GGAGCAGGGTGGAGGAGGGCTGG - Intronic
927100105 2:19781501-19781523 GAAGCAGGGTGTGAGGGTGTAGG - Intergenic
927458430 2:23277121-23277143 GGAGCAGATTGGAGGGGAGGAGG + Intergenic
927482501 2:23465399-23465421 CAGGCAGGCTGGAGGTGTGGGGG + Intronic
927513082 2:23656722-23656744 GAAGCTGGGCGGAGGTGAGGTGG + Intronic
927513452 2:23658559-23658581 GAAGCAGTCTGGAGGGGAAGGGG + Intronic
927751802 2:25676172-25676194 GAGTCAGGGCAGAGGGGTGGTGG - Intergenic
927809211 2:26172756-26172778 GAAGCTGGCGGGAGGGGAGGCGG + Intergenic
928016951 2:27666367-27666389 GAGGCCGGGGGGCGGGGTGGGGG - Intronic
928893405 2:36233825-36233847 GAACCGGGGTGGAGAGGTGGAGG + Intergenic
929005381 2:37388400-37388422 GAAGCAGGGTGGAATGCTGCAGG - Intergenic
929211880 2:39366260-39366282 GAAGCAGGGTGGTGGGGTGGGGG + Intronic
929423445 2:41818946-41818968 GAGGAGGGGAGGAGGGGTGGAGG + Intergenic
930238089 2:48906864-48906886 GAATGAGGGTGGAGGGAGGGAGG + Intergenic
930582399 2:53228221-53228243 AGAGAAGGGTGGACGGGTGGGGG - Intergenic
930590000 2:53315827-53315849 GAAGGGGGGTGGAAGGGGGGTGG + Intergenic
930656572 2:54013161-54013183 GAAGCTGGGGCGGGGGGTGGGGG - Intronic
930709562 2:54537544-54537566 GAAGAATTGTGGTGGGGTGGAGG + Intronic
930852494 2:55975590-55975612 GAGTCGGGGTGGGGGGGTGGGGG + Intergenic
931029457 2:58155761-58155783 GAAACGGGGCGGCGGGGTGGGGG - Intronic
931176266 2:59858104-59858126 GAGGCAGTGTGGAGAGATGGAGG - Intergenic
931197245 2:60064329-60064351 GACGCAGTGGGGAGGGGTGGAGG + Intergenic
931530467 2:63208928-63208950 GAAGCAGTGTGGGAGGGTGCAGG - Intronic
931590678 2:63880168-63880190 GGAGGAGGGGGGAGGGGTAGGGG - Intronic
931677356 2:64710747-64710769 GAAGCAGAGGGGAGAGGTGTGGG + Intronic
931763516 2:65435932-65435954 GAGCCAGGCGGGAGGGGTGGGGG - Intergenic
932140574 2:69273686-69273708 GAGGAGGGGTGGAGGGGTGTGGG - Intergenic
932400971 2:71481097-71481119 GAACCTGGGAGGAGGGTTGGTGG + Intronic
932456190 2:71851445-71851467 GGTGGAGGGTGTAGGGGTGGGGG + Intergenic
932491467 2:72125487-72125509 TGAGGAGAGTGGAGGGGTGGGGG + Intergenic
932751478 2:74374251-74374273 GCAGCAGGCTGCTGGGGTGGGGG - Intronic
932790302 2:74649058-74649080 GATGCAGGTTGGAGGTGGGGTGG + Intergenic
933647035 2:84821307-84821329 GAGGCTGGGTGGGGGGGTTGGGG - Intergenic
933721166 2:85398597-85398619 CAAGCAGGGTGGAGGGGAGAAGG - Intronic
933730937 2:85455854-85455876 GAGGCAGGGTGGGGAGGAGGGGG + Intergenic
933810186 2:86028229-86028251 GAAGCAGGATGCAGGGGTCAGGG - Intronic
933840770 2:86284136-86284158 GAGGCAGTGTGGAGGAGTGTGGG - Intronic
933842491 2:86298644-86298666 GATGCAGGGTGGAGGGTAGAGGG - Intronic
934559809 2:95307187-95307209 GAGTCTGGGTGGAGTGGTGGTGG - Intronic
934692871 2:96375261-96375283 GAAGCAGGGTTGTGGGGGGAAGG - Intergenic
934763689 2:96869278-96869300 GCAGCCGGGAGGAGGGGTTGGGG + Intronic
935107797 2:100061845-100061867 GTAGCACAGTGGAGGGGGGGGGG + Intronic
935171790 2:100615850-100615872 AAAGCAGGGTGCGGGGTTGGGGG + Intergenic
935175336 2:100643966-100643988 GAGGAAGGGAGCAGGGGTGGTGG - Intergenic
935618387 2:105108582-105108604 GACGCAGGGTGGAGGTGGGAAGG - Intergenic
936076261 2:109403664-109403686 AATGCAGGGTGCTGGGGTGGAGG + Intronic
937046343 2:118853997-118854019 GAAGGAGGTGGGCGGGGTGGGGG - Intergenic
937091470 2:119209268-119209290 GGAGCAGGGTGAGGGGCTGGGGG - Intergenic
937268392 2:120631630-120631652 GAGCTAGGGTGGCGGGGTGGGGG + Intergenic
937307324 2:120880441-120880463 GAAGGAGGATGGCGGGGTGATGG - Intronic
937379687 2:121365413-121365435 GAAGCAGGGCGGAGGGTGGGAGG - Intronic
937613853 2:123896427-123896449 GACGCAATGTGGGGGGGTGGGGG - Intergenic
937870696 2:126783955-126783977 CAAACAGAGTGCAGGGGTGGGGG + Intergenic
937899963 2:127012285-127012307 GTGGCAGGGAAGAGGGGTGGTGG + Intergenic
937905651 2:127051582-127051604 CAAGCAGGGTGGGCGGGTGGTGG - Intronic
937967466 2:127525086-127525108 GAAGTAGGGGGGTGGGGTAGGGG + Intronic
938081979 2:128374927-128374949 GGAGCAGGGTAGGTGGGTGGGGG + Intergenic
938097457 2:128473095-128473117 GAAGCGGGAAGGAGGGGAGGAGG - Intergenic
938258334 2:129877716-129877738 GAAGCAGGGAGGGGAGGGGGCGG + Intergenic
938374897 2:130798706-130798728 GAAGGTGGGTGGGAGGGTGGTGG - Intergenic
938422464 2:131155765-131155787 GATGCAGGGTGCAGGAGTGACGG - Intronic
938706964 2:133940254-133940276 AAAGAAGGGTTGAGGGCTGGAGG - Intergenic
938823701 2:134983582-134983604 GAAGCAGGGAGGATGACTGGGGG + Intronic
938965924 2:136388579-136388601 GGGGCAGGGTGGGGGGGGGGGGG - Intergenic
938966346 2:136392063-136392085 GAAGCAGGGAGGAGGGGATAGGG - Intergenic
939012818 2:136866509-136866531 GAAAAAAGGTGGAGGGGTGTGGG + Intronic
939568203 2:143809848-143809870 TAAGCAGGGTGGGGGGGGTGGGG + Intergenic
939914417 2:148021369-148021391 GGAGGAGGGTGGAGGGAGGGAGG - Intronic
939983204 2:148805618-148805640 GAGGGAGAGTGGAGGGGAGGAGG - Intergenic
939986237 2:148832166-148832188 GAAGCAGAGTGTAGGGGTCAGGG + Intergenic
940611027 2:155992216-155992238 GAAGGGAGGTGGAGGTGTGGTGG - Intergenic
940872142 2:158869009-158869031 GGAGCAAGGTGGCGGGGTGTAGG - Intergenic
940946423 2:159623151-159623173 GAAGGAGGGAGGAGGGAAGGAGG + Intergenic
941015336 2:160349820-160349842 AAAGCGGGGTGGGGGGGTGGAGG + Intronic
941119859 2:161515642-161515664 GTAGCAGGGTGGGGGGCTAGGGG + Intronic
941574393 2:167212892-167212914 GCAGAGGGGTGGGGGGGTGGGGG - Intronic
941925677 2:170892047-170892069 GAAGCTGGGTGGAGGGAAGGAGG + Intergenic
942022803 2:171883684-171883706 GAATGAGGGTGAAGTGGTGGAGG - Intronic
942275932 2:174323659-174323681 AAAACAGGGTGGGGGGTTGGGGG + Intergenic
942279568 2:174346450-174346472 GACGCAGGGTGGGGGTGGGGCGG - Intergenic
942303685 2:174586184-174586206 GAGGCGGGGTGGACGTGTGGGGG + Intronic
942344977 2:174993233-174993255 GAAGCAGGTTGTGGGGGTGGTGG - Intronic
942454050 2:176125503-176125525 GAAGCTGGGTGGGGGGAAGGGGG - Intergenic
942487981 2:176459248-176459270 GAAGCAGTGGGGTCGGGTGGGGG + Intergenic
942539266 2:176998354-176998376 GAAGTAAGGGGGGGGGGTGGGGG + Intergenic
943170596 2:184393081-184393103 GAGGCAGGCTTGAGGGGAGGAGG + Intergenic
943484210 2:188458833-188458855 GAAGCAGAGTGTAGGGATGGGGG - Intronic
943692069 2:190880136-190880158 GAGGCGGGGTGGGGGGGTTGCGG - Intergenic
943785646 2:191875581-191875603 GAAGCAGAGAGGCAGGGTGGAGG + Intergenic
944382110 2:199122982-199123004 GAAGCAGGGATGAGAGATGGAGG + Intergenic
944491661 2:200263767-200263789 GGAGCAGGAGGAAGGGGTGGTGG - Intergenic
944777436 2:202981161-202981183 GACCCAGGGTGGAGAGTTGGGGG + Intronic
945909820 2:215635708-215635730 GAAGCATGGTGGAGGGGTTCAGG + Intergenic
946010065 2:216557496-216557518 CAAGCAGGGTTGAGGGATGTAGG - Intronic
946071238 2:217035942-217035964 GGGGCAGGGAGTAGGGGTGGAGG + Intergenic
946108589 2:217393872-217393894 GCAGAGGGGTGGAGGGGTGCAGG - Intronic
946135114 2:217639611-217639633 GAAGGAGGGAGGAAGGGGGGAGG + Intronic
946180718 2:217947297-217947319 GCAGGAGGCTGAAGGGGTGGGGG + Intronic
946187603 2:217989870-217989892 GAAGCTGTGTGGAGGGTTTGTGG - Intronic
946326337 2:218986304-218986326 GAACGAGGCTGGAGAGGTGGAGG + Intergenic
946470897 2:219960103-219960125 TTGGCAGGGTGGTGGGGTGGAGG + Intergenic
946573146 2:221046113-221046135 GAAGCAAGGAGGAGTGGAGGAGG + Intergenic
946686973 2:222280305-222280327 GAAGGAGGGAGGAGGGGGAGGGG + Intronic
947389986 2:229628958-229628980 GGAGCAGGGTGAGGGGGTGTTGG - Intronic
947614293 2:231545262-231545284 AAAGCATGGTGAGGGGGTGGAGG - Intergenic
947712764 2:232325523-232325545 GAACCAGGGAGGAGAGGTGCTGG + Intronic
947732452 2:232438966-232438988 GACCCAGGGAGGAGGGGTGCTGG + Intergenic
947739955 2:232480485-232480507 GGAGCGGGGTGGAGGGGAGGAGG + Intronic
947780712 2:232759351-232759373 GAGGAGGGGAGGAGGGGTGGGGG - Intronic
948148657 2:235727679-235727701 GAAGCGGAGAGGAGGAGTGGTGG - Intronic
948347548 2:237311600-237311622 GAACCCGGGAGGAGGGGTTGTGG + Intergenic
948562585 2:238864487-238864509 GGAGCAGAGTGCAGGGTTGGAGG + Intronic
948726475 2:239937071-239937093 GGAGCAGAGGGGAGGGCTGGGGG + Intronic
948738242 2:240025172-240025194 GTGGCAGGGTGGCGGGGTGGCGG - Intronic
948765412 2:240216723-240216745 GATGCAGGGTGGGGGTGGGGTGG + Intergenic
948916156 2:241035914-241035936 GCCACGGGGTGGAGGGGTGGGGG + Intronic
949069245 2:242013512-242013534 GCAGAAGGATGGAGGGGTGCAGG - Intergenic
1168877619 20:1182172-1182194 GAAGGATGACGGAGGGGTGGGGG + Intronic
1169064394 20:2686171-2686193 GGAGGAGGGTGGGGGAGTGGGGG - Intergenic
1169087815 20:2838289-2838311 GAAGCAGGTGTGAGAGGTGGCGG + Exonic
1169107123 20:3005749-3005771 GAAGCAGGGGGTAATGGTGGTGG + Intronic
1169805135 20:9551500-9551522 AAAGAATGGTGGAGGGTTGGGGG + Intronic
1169867619 20:10218196-10218218 GAAGCAGCGTCGAGGGCTTGTGG - Intergenic
1170032711 20:11959365-11959387 GAAGGAGGGTGGAGGAGGAGGGG + Intergenic
1170232026 20:14059604-14059626 GAAGCTGGGTGGAGTGGTTCAGG + Intronic
1170394966 20:15916158-15916180 GAAGGTGGGTGGTGGGGTAGGGG - Intronic
1170443878 20:16405285-16405307 GAAGAAGGCAGGAGGGGTGAAGG + Intronic
1170545444 20:17432031-17432053 GAGACAGCGTGGAGGGGTGCTGG - Intronic
1170566854 20:17612435-17612457 GCAGCAGCGTAGAGGCGTGGAGG - Intergenic
1170736446 20:19017429-19017451 AAAGCATGGTGGTGGGGTGGTGG + Intergenic
1170783836 20:19450444-19450466 GAGGGAGGTTGGAGGGGTGTGGG + Intronic
1170922980 20:20696630-20696652 CAATAGGGGTGGAGGGGTGGAGG - Intronic
1171299821 20:24050391-24050413 GAAGCAGTCTGGTGGGGGGGCGG + Intergenic
1171724503 20:28603418-28603440 GAAACAGGGCGGAGGCGTGGAGG + Intergenic
1171858835 20:30376580-30376602 GAAACAGGGCAGAGGCGTGGAGG - Intergenic
1171966771 20:31536454-31536476 GAAGCAGGGAGCAGGAGAGGGGG - Intronic
1171990844 20:31695155-31695177 ATACCAGGGTGGATGGGTGGTGG - Intronic
1172033771 20:31998024-31998046 GGGGCAGGGTGTTGGGGTGGGGG + Exonic
1172039877 20:32036305-32036327 GAAGCAGGGAAGTGGGGAGGAGG + Intergenic
1172099677 20:32477689-32477711 GATGCAGGCTGGTGGGCTGGTGG + Intronic
1172113995 20:32563084-32563106 GAAGGAGGGTGGAGGGAGGGTGG + Intronic
1172220106 20:33268092-33268114 GAAGCAGGATGGGGTGGTGGAGG - Intergenic
1172573981 20:35992748-35992770 CAACCAGGGTCGGGGGGTGGGGG - Intronic
1172603224 20:36197785-36197807 GATGCAGGGTGCAGGGATGATGG - Intronic
1172618429 20:36305389-36305411 TGAGCAGGGTGGGTGGGTGGTGG + Intergenic
1172762560 20:37332573-37332595 GCGGCAGGGAAGAGGGGTGGTGG + Intergenic
1172879123 20:38187020-38187042 GAAAGGGGGAGGAGGGGTGGAGG + Intergenic
1173059523 20:39648128-39648150 GCTGGAAGGTGGAGGGGTGGGGG + Intergenic
1173424701 20:42932493-42932515 GAAGCAAGGTGGAGGGGTGGTGG + Intronic
1173517640 20:43676248-43676270 GGAGGAGGGTGGAGGGTGGGAGG - Intronic
1173530638 20:43766825-43766847 GCAGCACGATGCAGGGGTGGGGG - Intergenic
1173591548 20:44228846-44228868 CATGCCGGGTGGGGGGGTGGGGG - Intergenic
1173733232 20:45342604-45342626 GATGCAGCCTGAAGGGGTGGGGG + Intronic
1173772204 20:45670496-45670518 GGGGCAGGGGGGAGGGGGGGTGG - Intergenic
1173811514 20:45958765-45958787 GAAGCAGGAGGAAGGGATGGGGG - Intronic
1173843204 20:46172476-46172498 ATCGCAGGGTGGAGGAGTGGTGG - Intergenic
1173867382 20:46321267-46321289 GAAGCAGGATGGAGGAGTCCAGG - Intergenic
1174011331 20:47452055-47452077 GAACCATGGTGGGGTGGTGGCGG - Intergenic
1174112461 20:48205891-48205913 GAAGGAGGGAGGAGGAGGGGCGG - Intergenic
1174168775 20:48603628-48603650 GAAGGAGGGAGGAGGAGGGGCGG + Intergenic
1174287335 20:49482714-49482736 GGAGCCTGGTGGAGAGGTGGGGG - Intergenic
1174468821 20:50739855-50739877 GAAGTAGAGGGGAAGGGTGGGGG + Intronic
1174535175 20:51245868-51245890 GAGGCAGGGAGGAAGGGAGGAGG - Intergenic
1174725127 20:52853330-52853352 GCAGCAGAGTGGAGGGGGAGGGG - Intergenic
1174824115 20:53753853-53753875 TAAGCAGGGTGGGGCGGGGGTGG - Intergenic
1174960515 20:55151758-55151780 GAGGGAGGGGGGAGGGGAGGGGG - Intergenic
1175213988 20:57380442-57380464 GAAGCAGGATGGAGCTGTGGTGG + Intergenic
1175224876 20:57439223-57439245 GTAGGAGGGTGGGGGTGTGGGGG - Intergenic
1175284197 20:57826902-57826924 GAAGCAGAATGGAGAGGTGAGGG - Intergenic
1175307025 20:57983068-57983090 AAAGCAGGGTGTCTGGGTGGTGG - Intergenic
1175385633 20:58593181-58593203 GAAGAAGGCTGGAAGGGTGGAGG - Intergenic
1175419630 20:58823138-58823160 GCAGCAGGATGGAGGGGCAGGGG - Intergenic
1175544420 20:59769022-59769044 GTCTCAGGGTGGTGGGGTGGCGG - Intronic
1175765865 20:61592619-61592641 AAAGCAGGGTGGAGGGGGAAAGG - Intronic
1175787373 20:61720446-61720468 GGTGCAGAGTGGAGGGGTGAAGG + Intronic
1175788228 20:61725201-61725223 GAAGCAGGAGGAATGGGTGGAGG - Intronic
1175809846 20:61852132-61852154 GAATATGGGTGGTGGGGTGGGGG - Intronic
1175822182 20:61916166-61916188 GGAGCAGGGGAGTGGGGTGGAGG + Intronic
1175902195 20:62364373-62364395 GAAGCTGGGTGGAAGGTTGCGGG + Intronic
1175909099 20:62396154-62396176 CAAGCAGTGTGGTGGGGAGGAGG + Intronic
1175934531 20:62509010-62509032 GGTGGAGGGTGAAGGGGTGGAGG - Intergenic
1175934558 20:62509085-62509107 GGTGGAGGGTGGAGGGGTGGAGG - Intergenic
1175934565 20:62509100-62509122 GGTGGAGGGTTGAGGGGTGGAGG - Intergenic
1175934592 20:62509175-62509197 GGTGGAGGGTGGAGGGTTGGAGG - Intergenic
1175934656 20:62509362-62509384 AGTGGAGGGTGGAGGGGTGGAGG - Intergenic
1175934676 20:62509414-62509436 GGTGGAGGGTGGAGGGGTGAAGG - Intergenic
1175934686 20:62509437-62509459 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175934692 20:62509452-62509474 GATGGTGGCTGGAGGGGTGGAGG - Intergenic
1175934698 20:62509467-62509489 GGTGGAGGGTGGAGGGATGGTGG - Intergenic
1175934704 20:62509482-62509504 GATGGTGGCTGGAGGGGTGGAGG - Intergenic
1175934713 20:62509505-62509527 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175934725 20:62509536-62509558 GTGGAGGGGTGGAGGGGTGGAGG - Intergenic
1175934729 20:62509544-62509566 GATGGAGGGTGGAGGGGTGGAGG - Intergenic
1175934739 20:62509567-62509589 GTGGAGGGGTGGAGGGGTGGAGG - Intergenic
1175934747 20:62509583-62509605 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175934819 20:62509782-62509804 GGTGTAGGATGGAGGGGTGGAGG - Intergenic
1175934828 20:62509805-62509827 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175934880 20:62509963-62509985 GGTGGAGGGTGGAGGGGTGGAGG - Intergenic
1175934909 20:62510032-62510054 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175934928 20:62510078-62510100 GGTGAAGGATGGAGGGGTGGAGG - Intergenic
1175934937 20:62510101-62510123 GATGGAGGATGGAGGGGTGGAGG - Intergenic
1175934960 20:62510178-62510200 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175934966 20:62510193-62510215 GGTGGAGGGTGGAGGGGTGGAGG - Intergenic
1175934994 20:62510269-62510291 GGTGGAGGGTGGAGGGGTGGAGG - Intergenic
1175935001 20:62510284-62510306 GATGGAGACTGGAGGGGTGGAGG - Intergenic
1175935038 20:62510391-62510413 GATGGAGGGTGGAGGGGTGGAGG - Intergenic
1175935051 20:62510422-62510444 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175935057 20:62510437-62510459 GATGGAGGGTGGAGGGGTGGAGG - Intergenic
1175935138 20:62510667-62510689 GTGGATGGGTGGAGGGGTGGAGG - Intergenic
1175935169 20:62510738-62510760 GGTGGAGGATGGAGGGGTGGAGG - Intergenic
1175935200 20:62510831-62510853 GCAGAAGGATGGAGGAGTGGAGG - Intergenic
1176020812 20:62961523-62961545 GTAGCAGGGTGGATTGGTGCAGG + Intronic
1176057312 20:63155539-63155561 GCAGCAGGGTACAGGGGTGCAGG + Intergenic
1176159503 20:63641218-63641240 GAAGCTGGGGGCGGGGGTGGGGG + Exonic
1176227170 20:64007372-64007394 GAGGCAGAGGGGAGGGGAGGCGG - Intronic
1176235399 20:64051323-64051345 GCAGGAGGGTGCAGGGGGGGTGG + Intronic
1176298000 21:5084655-5084677 GAGGCTGGGAGGAGGGGTTGAGG - Intergenic
1176304012 21:5114106-5114128 GAAGCAGCTGGGAGTGGTGGGGG + Intergenic
1176451016 21:6861249-6861271 GCAGCCGGGTGGAGGGAGGGGGG + Intergenic
1176829184 21:13726300-13726322 GCAGCCGGGTGGAGGGAGGGGGG + Intergenic
1177046898 21:16182547-16182569 GAAGGAGGAAGGAGGGATGGAGG - Intergenic
1177667610 21:24181409-24181431 GTAGGGGGGTGGGGGGGTGGTGG - Intergenic
1177741399 21:25158480-25158502 GAAGAGGGGTGGAGGGAGGGAGG + Intergenic
1178795935 21:35744387-35744409 AAAGCAGGGAGGAAGGGAGGGGG - Intronic
1178806893 21:35846810-35846832 CAGGCAGGGGGCAGGGGTGGGGG - Intronic
1178925191 21:36768909-36768931 GAAGCCAGGTGGAGGGTTGCTGG - Intronic
1178946883 21:36956189-36956211 GAAACTGGGAGGAGGGGTAGGGG + Intronic
1179405964 21:41126073-41126095 GACACACGGTGAAGGGGTGGAGG - Intergenic
1179412031 21:41169000-41169022 ACAGCATGGTGGTGGGGTGGGGG - Intronic
1179454663 21:41490834-41490856 GAAGAAAGGTGCAGAGGTGGAGG + Intronic
1179560149 21:42210712-42210734 GGTGCAGGGTGGAGGGAGGGGGG - Intronic
1179729293 21:43358683-43358705 GAAGGTGGGTGGGGGAGTGGGGG + Intergenic
1179731123 21:43367929-43367951 GATGCAGGGTGGTGGTGTGAGGG - Intergenic
1179731354 21:43369466-43369488 GCTGCAGGGTCGAGGCGTGGAGG + Intergenic
1179853018 21:44147844-44147866 GAAGCAGCTGGGAGTGGTGGGGG - Intergenic
1179859029 21:44177294-44177316 GAGGCTGGGAGGAGGGGTTGAGG + Intergenic
1179874847 21:44262379-44262401 GGTGGAGGGTGGAGGGGTGGAGG + Intergenic
1179874851 21:44262387-44262409 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1180026162 21:45163531-45163553 GGTGCAGGGTGGAGGTGGGGGGG - Intronic
1180082774 21:45494253-45494275 GAAGCAGGGGTGGAGGGTGGAGG - Intronic
1180104250 21:45607566-45607588 GAGGCAGGAGGGAGGGGAGGAGG + Intergenic
1180298052 22:10962092-10962114 GAAACAGGGCGGAGGTGTGGAGG + Intergenic
1180410360 22:12601706-12601728 GAAACAGGGCAGAGGCGTGGAGG - Intergenic
1180651331 22:17379409-17379431 GCCGCAGGGAGGAGGGGTGAGGG + Intronic
1180715133 22:17866401-17866423 AGTGCAGGGTGGAGGCGTGGAGG + Intronic
1180923815 22:19538263-19538285 GAGGGAGGGTGGAGGGGGGAGGG + Intergenic
1180965542 22:19786334-19786356 CAAGCAGGGTGGATGGCAGGCGG - Exonic
1181045663 22:20213148-20213170 AAAGCAGGGGTGAGGGCTGGGGG - Intergenic
1181167801 22:20992759-20992781 AAGGCAGGGTGGAATGGTGGGGG - Intronic
1181337378 22:22148201-22148223 GCAGAAGGATGGAAGGGTGGAGG + Intergenic
1181490006 22:23255773-23255795 GAAGCAGGGAGCAGGGGTCGGGG - Intronic
1181519405 22:23436597-23436619 GAGCCGGGGGGGAGGGGTGGGGG + Intergenic
1181527882 22:23500494-23500516 GAAGGAAGGTGGAGGGGAGAGGG + Intergenic
1181586449 22:23855353-23855375 GAGGCGGGGTGGGGGGGGGGGGG + Intergenic
1181668102 22:24412243-24412265 GAAGCAGGGGACTGGGGTGGGGG - Intronic
1181681787 22:24500426-24500448 GATGCAGGCTGGAGGGATGTGGG - Intronic
1181779011 22:25179189-25179211 GAAGCTGGGGGCGGGGGTGGGGG + Intronic
1181924662 22:26348739-26348761 GAAGAAGGGAGGAAGGGAGGGGG + Intronic
1181993047 22:26852259-26852281 GAAGCAGGGAGGAGGAGGAGAGG - Intergenic
1181993193 22:26853854-26853876 GAAGCAGGATGGTGGGGGTGAGG + Intergenic
1182031931 22:27165911-27165933 GAAGAAGGGAGGAGGGGTGGCGG + Intergenic
1182050717 22:27310627-27310649 GAAGGAGGGGGGAGGGAGGGAGG + Intergenic
1182656277 22:31892722-31892744 GCAGCAGGTTGTGGGGGTGGAGG - Intronic
1182694011 22:32184465-32184487 CAATCTGAGTGGAGGGGTGGGGG + Intergenic
1182895553 22:33856319-33856341 CAAGCTGGGTGGGTGGGTGGTGG + Intronic
1183038146 22:35155747-35155769 TAAACAGGGAGGAGGGGTTGGGG + Intergenic
1183220670 22:36510602-36510624 GAAGCAGGGTGTGGGTGAGGTGG - Intergenic
1183228292 22:36564893-36564915 GGCGCAGGGTGGCGGGGTGGGGG + Intronic
1183257371 22:36771158-36771180 GAAGCAGGGAGGAGGGGCCCTGG - Intronic
1183306726 22:37086725-37086747 GTAGCAGGGTGGAGGGGTCTGGG - Intronic
1183325343 22:37188354-37188376 GGAGCAGGGAGGAGGGGAAGTGG - Intronic
1183365736 22:37405828-37405850 AAAAAAGGGTGGAGGGGGGGTGG + Intronic
1183794170 22:40101277-40101299 GAAGCAGGGGCCAGGAGTGGTGG - Intronic
1184300549 22:43556204-43556226 GAGGCAGGGGTCAGGGGTGGGGG + Intronic
1184392380 22:44211908-44211930 GAAGCAGTGTGGAAAGGTTGAGG - Intronic
1184409112 22:44316398-44316420 GAACCAGGGTGGGGGGTGGGGGG + Intergenic
1184433668 22:44456882-44456904 GATGCAAGCTGGAGGGGAGGTGG + Intergenic
1184461504 22:44640430-44640452 GGAGGAGGGAGGAGGGGAGGAGG + Intergenic
1184479589 22:44738688-44738710 ATAGGAGGGTGTAGGGGTGGGGG + Intronic
1185079358 22:48701249-48701271 CATGCAGGGTGGAGGGAGGGTGG - Intronic
1185111291 22:48901550-48901572 GAAGCAGGGAGGAGGCTTGGTGG + Intergenic
1185111617 22:48903218-48903240 GAAGCAGGGAGGAGGCTTGGTGG - Intergenic
1185196889 22:49477197-49477219 GATGGATGGTGGATGGGTGGTGG + Intronic
1185228473 22:49667422-49667444 GAGCCGGGGTGGAGGGGTGTGGG - Intergenic
1185310695 22:50152717-50152739 GCAGCCGGGTGGAGGGCAGGTGG - Intronic
1185326108 22:50226572-50226594 GGGGCAGGGTGGGGGGTTGGGGG + Intronic
1185400603 22:50613659-50613681 GAAGTGGGATGCAGGGGTGGGGG - Intronic
1185410026 22:50676965-50676987 GAAGCTGGGTGGAGAGGGAGTGG + Intergenic
949411823 3:3773903-3773925 GAAGAAGTGGGGAGGGGTGAAGG - Intronic
949575294 3:5332949-5332971 GAAGCATGTTGGAGGAGGGGCGG + Intergenic
949884498 3:8682594-8682616 GGAGCAAGGTGGCGGGGTGTAGG - Intronic
950040408 3:9916158-9916180 GAAGGAGGGTGAGGCGGTGGGGG + Exonic
950124951 3:10505310-10505332 GTGGCAGCGTGGAGGGGGGGTGG - Intronic
950135899 3:10580614-10580636 GAGGCAGGGAGGAGGGGCTGCGG - Intronic
950256755 3:11512225-11512247 GAAGGAGGGGAGAGGGGTGTGGG - Intronic
950265623 3:11570784-11570806 GAAGCAGGGAGGAGGTGAGGAGG - Intronic
950340544 3:12240299-12240321 GAAGCAGAATGCAGGGATGGTGG - Intergenic
950433506 3:12965449-12965471 GAAGCTTGGGGGAGGGGTAGAGG - Intronic
950456347 3:13095050-13095072 GAAGCAAGGTGGAGAGGAGGGGG - Intergenic
950472630 3:13195928-13195950 GAAACTGGGTGGAGGGGACGTGG + Intergenic
950634065 3:14302919-14302941 GCAGTGGGGTAGAGGGGTGGCGG + Intergenic
950677523 3:14563630-14563652 AAGGCAGGGAGGAGGGGTGTAGG + Intergenic
950688032 3:14632854-14632876 GAAGGAGGGTGGGGGTGTTGTGG - Intergenic
950708478 3:14798459-14798481 GACGCAGGGTGGTGAGCTGGGGG + Intergenic
950725619 3:14915070-14915092 GCAGCAGAGTTGAGGGCTGGAGG + Intronic
951710888 3:25584141-25584163 GAGGGAGGGAAGAGGGGTGGAGG - Intronic
952278838 3:31903843-31903865 AAAGCAGGGTGACGGGGTTGCGG + Intronic
952644435 3:35639087-35639109 GGAGCAGGGAGGCGGTGTGGCGG + Intronic
952918577 3:38267954-38267976 GGGTCAGGGTGGAGGGGTAGGGG + Intronic
953357356 3:42266226-42266248 GAGGCGGGGTGGGGGGGTTGGGG + Intergenic
953961322 3:47268268-47268290 GAGACAGGGTGGTGGTGTGGTGG + Intronic
953989410 3:47472736-47472758 GAAGAAGGTGGTAGGGGTGGTGG - Intronic
954121723 3:48503836-48503858 CAAGGAGGGTGCTGGGGTGGAGG + Intronic
954219630 3:49145079-49145101 GAAGGGGGGCTGAGGGGTGGGGG - Intergenic
954431083 3:50471145-50471167 GTGGCTGGGTAGAGGGGTGGAGG + Intronic
954579545 3:51695834-51695856 GGTGCAGGGTGGGGTGGTGGTGG + Intronic
954660756 3:52225681-52225703 GGGGCAGGGTGGAGTGGAGGGGG - Exonic
954675251 3:52311972-52311994 GAAGCAGGTTGGGGGGGCGGTGG - Intergenic
954865188 3:53722948-53722970 CAAGCAGGCTGGAGAGGTAGAGG - Intronic
955168544 3:56540118-56540140 GAAGGAGGGAGGATGGATGGAGG - Intergenic
955419868 3:58725395-58725417 GAAGCAGGGGGAAAGGGTGCTGG - Intronic
955675537 3:61444360-61444382 AAAGCAGGGTGGAGGGAGGGAGG - Intergenic
955758270 3:62249392-62249414 GGAGCAGGGTGGAGGGAAGGGGG + Intronic
955888074 3:63621339-63621361 GAAGCTGGGTGAAGGGTTCGTGG + Intergenic
956321945 3:68007594-68007616 GAGGGAGGGAGGTGGGGTGGAGG - Intronic
957044450 3:75363085-75363107 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
957047255 3:75385657-75385679 TAAATGGGGTGGAGGGGTGGGGG - Intergenic
957076243 3:75605267-75605289 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
957503600 3:81090886-81090908 GAGACAGGGGGCAGGGGTGGTGG + Intergenic
957810365 3:85214532-85214554 GGACCAGGGTTGGGGGGTGGGGG - Intronic
959022040 3:101198308-101198330 GGGGGAGGGGGGAGGGGTGGGGG - Intergenic
959296811 3:104545808-104545830 GAAGCAGGGTGGAGTGGGGAGGG - Intergenic
959637751 3:108594406-108594428 GAGGGAGGGGGGAGGGGAGGGGG - Intronic
959932429 3:111999072-111999094 GCAGCAAGGGGGATGGGTGGCGG - Exonic
960051367 3:113241937-113241959 GAGGCAGGGTGGAGAGAGGGAGG + Intronic
960338351 3:116445587-116445609 GGGGGAGGGTGGGGGGGTGGGGG - Intronic
960610498 3:119550931-119550953 GTAGCAGGATGGAGGGGGGCAGG - Intronic
961008351 3:123419930-123419952 TGTGCTGGGTGGAGGGGTGGGGG - Intronic
961115900 3:124329829-124329851 GATGCAGGGTGGATCAGTGGGGG - Intronic
961164142 3:124751893-124751915 GTGGCAGGGTGGCGGGGCGGGGG - Intergenic
961164148 3:124751901-124751923 GGGGCAGGGTGGCAGGGTGGCGG - Intergenic
961261066 3:125602294-125602316 GTAGCAGGGAGCAGGGGTGCGGG + Intergenic
961305165 3:125953793-125953815 GAAGGAGGGCGGGGGGCTGGGGG + Intergenic
961552690 3:127678109-127678131 GCAGGAGGGTGGAGGGTGGGTGG + Intronic
961794346 3:129398912-129398934 GAAGCAGGCAGCCGGGGTGGTGG - Intergenic
961824624 3:129592562-129592584 GCAGCAGGGAGGAGGGGAGCAGG + Intronic
961828541 3:129611632-129611654 GATGCAGTGTGGAGGGGCAGCGG - Intergenic
961847602 3:129780418-129780440 ATAGAGGGGTGGAGGGGTGGAGG - Intronic
961876443 3:130027119-130027141 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
961879323 3:130049758-130049780 TAAATGGGGTGGAGGGGTGGGGG - Intergenic
961957008 3:130814903-130814925 GCAGCAGTGGGGCGGGGTGGGGG + Intergenic
962072209 3:132044683-132044705 GAGGGAGGGGGGAGGGGAGGGGG + Intronic
962205481 3:133430846-133430868 GGACCAGGGTGGAGGAGCGGAGG - Intronic
962314344 3:134349892-134349914 GAAGCAAGGTGGTGGGGCTGCGG - Intergenic
962559532 3:136591256-136591278 GGAGGAGGGAGGAGGGGAGGAGG + Intronic
962848524 3:139290600-139290622 GCGGCAGGGTGGAGGGGGGCAGG - Intronic
962979877 3:140478796-140478818 GAAGAAGGGAGGAAGGGAGGAGG + Intronic
963102963 3:141623312-141623334 GAGGCAGGGTGGAGGGACAGAGG - Intergenic
963104966 3:141639137-141639159 GAGGCTGAGTGGGGGGGTGGGGG + Intergenic
963303882 3:143628170-143628192 GATGGAGGATGGAGGGATGGAGG + Intronic
963893887 3:150664984-150665006 GAAGGGAGGTGCAGGGGTGGGGG + Intronic
964050619 3:152388895-152388917 GAAGGAAGGTGAAGTGGTGGAGG + Intronic
964460277 3:156917494-156917516 GAAGCAGGGGGAAGGGTGGGGGG + Intronic
964618910 3:158700885-158700907 GAAGCAGGGTGGAGGGGCATGGG - Intronic
964671382 3:159229798-159229820 GGAGCGGGGAGGAGGGGGGGAGG - Intronic
964828018 3:160850964-160850986 AAAACAGGGAGGTGGGGTGGGGG - Intronic
964896551 3:161603595-161603617 GGAGGAGGGAGGAGGGGGGGAGG - Intergenic
964961545 3:162433974-162433996 GAAGAGGAGTGGAGGAGTGGAGG + Intergenic
965365051 3:167787739-167787761 GCAGGAGGGTGAAGGGGTGAGGG + Intronic
965597082 3:170420082-170420104 GAGACACGCTGGAGGGGTGGCGG - Intronic
965653269 3:170955735-170955757 GGAGGAGGGTGGTGGGGTGAGGG - Intergenic
966452439 3:180077607-180077629 CAATCATGGTGGAAGGGTGGAGG + Intergenic
966452704 3:180079611-180079633 GAATCATGGTGGAAGGGTGGAGG + Intergenic
966468711 3:180262771-180262793 GAAGGAGTGTGGGGGGATGGTGG + Intergenic
967000338 3:185327940-185327962 GAAGCAGGAAGGAGGGAGGGAGG + Intronic
967020404 3:185517400-185517422 GTAGCAGGGTGGAGAGGTGTGGG + Intronic
967214902 3:187201535-187201557 GAGACAGGGTGGCGGGATGGAGG - Intergenic
967680860 3:192362382-192362404 GTCGTGGGGTGGAGGGGTGGGGG - Intronic
967809900 3:193749307-193749329 GAAAGGGGGTGGTGGGGTGGAGG + Intergenic
967891900 3:194369622-194369644 TAAGCAGAGAGGAGGGATGGGGG + Intronic
968011321 3:195280067-195280089 GAAGCTGGGTGGGGGGGTTGGGG + Intronic
968079740 3:195837619-195837641 GCAGCAGGGTTGCGGGTTGGGGG + Intergenic
968605234 4:1532263-1532285 GGAGCAGGGCCGAGGGCTGGTGG + Intergenic
968812514 4:2806324-2806346 GAGGCAGGGTGGGGAGGAGGTGG + Intronic
968887211 4:3341313-3341335 GAGGGAGGGTGGAGAGATGGGGG + Intronic
968887276 4:3341476-3341498 GAGGGAGGGTGGAGAGATGGGGG + Intronic
968887304 4:3341543-3341565 GAGGGAGGGTGGAGAGATGGGGG + Intronic
968887339 4:3341636-3341658 GAGGGAGGGTGGAGAGATGGGGG + Intronic
968887363 4:3341688-3341710 GAGGGAGGGTGGAGAGATGGGGG + Intronic
968887398 4:3341781-3341803 GAGGGAGGGTGGAGAGATGGGGG + Intronic
968889223 4:3359036-3359058 GGAGGAGGGAGGAGGGGAGGAGG - Intronic
968988712 4:3894324-3894346 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
969019693 4:4131566-4131588 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
969024399 4:4161968-4161990 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
969025302 4:4167914-4167936 GGAGCAAGGTGGTGGGGTGTAGG + Intergenic
969095591 4:4730090-4730112 GATGCAGGGTGTAGGGCTGATGG - Intergenic
969193042 4:5538096-5538118 GAAGCAGGGAGGGAGGGAGGAGG + Intergenic
969244811 4:5925257-5925279 GAAGCAGCAAGGAGGTGTGGTGG + Intronic
969296900 4:6275582-6275604 GATGCACGGGGGTGGGGTGGGGG + Intronic
969305915 4:6326258-6326280 GAAGCAGGGAGGAGCGGAGATGG + Intronic
969627007 4:8310790-8310812 GATGCAGGGTCAAGAGGTGGGGG + Intergenic
969643680 4:8413629-8413651 GTGGAGGGGTGGAGGGGTGGAGG - Intronic
969647956 4:8444276-8444298 GAAGGGGAGTGGAGGGTTGGGGG + Intronic
969785590 4:9454726-9454748 GGAGCAAGGTGGCGGGGTGTAGG - Intergenic
969789011 4:9479136-9479158 GGAGCAAGGTGGCGGGGTGTAGG - Intergenic
969855562 4:9996469-9996491 GCAGCAGGATGGAGGGTGGGAGG + Intronic
969918247 4:10511072-10511094 GAAGCCGGGAGGTGGGGCGGGGG + Intronic
969964089 4:10976317-10976339 GAAGGTAGGTGGAGGGGTGAAGG + Intergenic
970004420 4:11396906-11396928 GAGGCAGCGGGGAGGAGTGGAGG - Exonic
970191606 4:13523718-13523740 GAAGTGGGGTGGGGGGGTGCGGG + Intergenic
971079632 4:23195262-23195284 GCAGCAGGGAGGAGGGGCTGGGG + Intergenic
971217410 4:24674091-24674113 GAAGGAGGGTGGAGGGGAAGAGG - Intergenic
971248210 4:24949432-24949454 GTGGCAGGGAGGGGGGGTGGTGG + Intronic
971349325 4:25842619-25842641 GAGGGAGGGTGTGGGGGTGGAGG - Intronic
971756622 4:30717029-30717051 GAAGCCGGGGGGGGGGGGGGGGG + Intergenic
972127773 4:35790295-35790317 GAAGAAGAGGGGAGGGGAGGGGG + Intergenic
972292309 4:37700756-37700778 GGAGAAGTGTGGAGGGGTGAGGG - Intergenic
973237103 4:47917188-47917210 GTTGCAGGGTGGGGGGCTGGTGG - Intronic
973544373 4:51966144-51966166 GAAGGAGGGAGGAGGGAAGGAGG - Intergenic
973544402 4:51966233-51966255 GAAGGAGGGAGGAGGGAAGGAGG - Intergenic
973778455 4:54265649-54265671 GAAGAAGGGAGGAGGGGAGATGG + Intronic
973931400 4:55796286-55796308 GAAGCAGGTGGAAGGGGTGGAGG - Intergenic
974428553 4:61768787-61768809 GAGGCACGGAGAAGGGGTGGGGG + Intronic
974454209 4:62105266-62105288 GTAGCAGGGTGAAGGGTGGGAGG - Intergenic
975289535 4:72660714-72660736 GGAGCAGGGTGGATGGGAGTTGG + Intergenic
975400325 4:73929960-73929982 CAAGGAGGGTGGAGGGTGGGAGG + Intergenic
975473414 4:74794776-74794798 GAATCCGCGTGGAGGGGTGTCGG + Intergenic
975765768 4:77666224-77666246 GCGGGAGGGTGGAGGGCTGGGGG + Intergenic
976009626 4:80471607-80471629 GGAGCAGGGTGGCGGGGGGTGGG + Intronic
976184415 4:82430235-82430257 GACGCCGGGAGGAGGGGCGGGGG + Intergenic
976245521 4:83002460-83002482 GAAGGAGGGAGGAGGGAAGGAGG + Intronic
976405828 4:84659583-84659605 TAGGCAGGGTTGAGGGGTGGGGG + Intergenic
977206907 4:94173519-94173541 GAAGCAGGGAGGAAGGAGGGAGG + Intergenic
977230590 4:94448000-94448022 AAAGCTGGGTTGGGGGGTGGGGG - Intergenic
977290732 4:95161857-95161879 GAGGCTGAGGGGAGGGGTGGGGG + Intergenic
977293977 4:95191972-95191994 TTAGCAGGGGGGAGGGGAGGAGG - Intronic
977393030 4:96437440-96437462 GAAACAGGGTAGGGGGTTGGAGG + Intergenic
978107816 4:104925757-104925779 GTGGCAGGGAGCAGGGGTGGTGG + Intergenic
978262042 4:106771515-106771537 GAAGGGTGGTGGAGGGGTGAGGG + Intergenic
978581827 4:110239396-110239418 GGGGCAGGGTGGGGTGGTGGTGG + Intergenic
979187538 4:117816434-117816456 AAAGCAGGGTGGGGAGGTGGCGG - Intergenic
979252990 4:118584892-118584914 CAAGCAGGGTGGATGTGTGGTGG + Intergenic
979523626 4:121696168-121696190 GAAGTCGGGGGGCGGGGTGGGGG + Intronic
979640835 4:123011825-123011847 GAGACAGAGTGAAGGGGTGGGGG + Intronic
979666499 4:123316681-123316703 GAGGCTGGGTGGTGGGGAGGAGG + Exonic
980284792 4:130768545-130768567 GAGACAGGGAGAAGGGGTGGGGG - Intergenic
980716817 4:136638561-136638583 GAAGCAGGATAGGGAGGTGGGGG - Intergenic
980912558 4:139006883-139006905 GGAGGAGGATGGGGGGGTGGGGG - Intergenic
981204123 4:142018624-142018646 GAATCACGGGGGAGGGGGGGTGG - Intergenic
981307194 4:143259315-143259337 GAAGCAGGAAGCAGGGGTGGTGG + Intergenic
981415533 4:144488407-144488429 GTAGAAGGGTGGGGGGCTGGGGG + Intergenic
981544343 4:145878857-145878879 AATGCTGGGTGGATGGGTGGGGG + Intronic
981552146 4:145952874-145952896 GAGTCAGGGTGGAGGGATGGTGG - Intergenic
981584283 4:146284464-146284486 GAAGCAGGGTGGGGTGATGGGGG - Intronic
982019328 4:151188013-151188035 GAAGCAGGGTGTTGGGTAGGAGG - Intronic
982087187 4:151847721-151847743 GAAGCAGATTGGTGGGGAGGCGG + Intergenic
982166491 4:152618100-152618122 GAAGCAGGGTGGGAGGATGTGGG - Intergenic
982560178 4:156920018-156920040 GGAGCAAGATGGAGGGGAGGAGG - Intronic
982793430 4:159618235-159618257 GAATCAGGTGGCAGGGGTGGGGG + Intergenic
983028248 4:162764607-162764629 AAAGAGGGGAGGAGGGGTGGAGG + Intergenic
983077781 4:163345927-163345949 GAGGCAGGGAGGGGGGGTGGGGG - Intronic
983653160 4:170053606-170053628 GAAGGAGGGGGGAGGGGGAGGGG - Intergenic
984271844 4:177557463-177557485 GGTGCAGGATGGAGGCGTGGTGG - Intergenic
984461384 4:180041183-180041205 GAAGGATGGGGGTGGGGTGGGGG + Intergenic
984873830 4:184350050-184350072 GAAGCAGGGGGAAAGGGTGAGGG + Intergenic
984959471 4:185081589-185081611 GAGGCAGGGTGGAGGATGGGGGG - Intergenic
985295425 4:188432396-188432418 GGATCAGGGTGGAACGGTGGAGG + Intergenic
985396067 4:189545599-189545621 GAGGCAGGTTGTAGAGGTGGAGG + Intergenic
985436977 4:189940248-189940270 GAAACAGGGCGGAGGCGTGGAGG - Intergenic
985578270 5:683716-683738 GAAACAGGTTGGAGGGGTGGGGG + Intronic
985593197 5:775856-775878 GAAACAGGTTGGAGGGGTGGGGG + Intergenic
985783971 5:1884808-1884830 GAAGGAGGGTGGGGGAGGGGAGG - Intronic
985788298 5:1911383-1911405 GAGGCAGGGTGGTGGGGAGAGGG - Intergenic
985809940 5:2075505-2075527 GGAGCAGGGTGGAGGGGACGGGG + Intergenic
985890157 5:2708972-2708994 GAAGCAGGTTGGAGGGACGCAGG - Intergenic
986230969 5:5864568-5864590 GCTGGAAGGTGGAGGGGTGGGGG + Intergenic
986433589 5:7705601-7705623 GATGCAGGGCAGAGGGGTGGGGG + Intronic
986516994 5:8574591-8574613 GAGTCAGGGAGGAGGGGTGGGGG + Intergenic
986544897 5:8884956-8884978 CAGGCAGGGTAGGGGGGTGGGGG + Intergenic
986651844 5:9971796-9971818 GTGGAAGGGTGGAGGGGTGGAGG + Intergenic
986799733 5:11246715-11246737 GTAGGTGGGTGGGGGGGTGGGGG + Intronic
986884379 5:12215749-12215771 GAAGCAGGGTGGGGAGTTGGGGG + Intergenic
987129831 5:14850181-14850203 GAAGCCGGTGGGAGTGGTGGGGG - Intronic
987361507 5:17111526-17111548 GAAGGAGGGGGGAGGGGGAGGGG - Intronic
989077194 5:37576114-37576136 GAAGGAGGGCGGAGGGAGGGAGG - Intronic
989513833 5:42319130-42319152 GAAGGAGGGAGGAAGGGAGGGGG + Intergenic
989573760 5:42970670-42970692 GTAACAGGGTGGGGGGGCGGGGG - Intergenic
989600043 5:43192445-43192467 GAGGAAGGGTGGCGGGGTGGGGG - Intronic
990178653 5:53135802-53135824 TATGCAGGGTGAAGGGTTGGAGG - Intergenic
990475296 5:56156689-56156711 GAAGCAGGGAGCTGGAGTGGCGG - Intronic
990638519 5:57756672-57756694 ACAGAAGGTTGGAGGGGTGGAGG + Intergenic
991085721 5:62646905-62646927 GAGGGAGGAAGGAGGGGTGGTGG - Intergenic
991092590 5:62707261-62707283 TAAGCAGAGTCGAGGGGAGGAGG - Intergenic
991238933 5:64433856-64433878 GGAGCAGGGTGAAAGAGTGGAGG + Intergenic
991261843 5:64676467-64676489 GATGCAGGGTGGTGGGGGGGGGG + Intergenic
991631227 5:68658006-68658028 GGAGCAGGAAGGAGGGGTGGTGG + Intergenic
991748167 5:69768474-69768496 GTCGTAGGGTGGAGGGATGGGGG - Intergenic
991799749 5:70348319-70348341 GTCGTAGGGTGGAGGGATGGGGG - Intergenic
991828848 5:70661719-70661741 GTCGTAGGGTGGAGGGATGGGGG + Intergenic
991892105 5:71347750-71347772 GTCGTAGGGTGGAGGGATGGGGG - Intergenic
992474723 5:77090110-77090132 GCAGAAGGGTGTAGAGGTGGGGG + Intergenic
992672060 5:79070352-79070374 GGTGCAGGGTGGAGGGTAGGTGG + Intronic
993623965 5:90201335-90201357 AGAACAGGGTGGTGGGGTGGTGG - Intergenic
993672394 5:90777181-90777203 GGAGCAGGTGGAAGGGGTGGAGG + Intronic
993993616 5:94691356-94691378 GAAGCAGTATGGATTGGTGGGGG + Intronic
994738601 5:103590117-103590139 GGAGTAGGGTGGATGGATGGTGG + Intergenic
994905993 5:105841289-105841311 GAAAAAGGGTGAAGGGGTGAAGG - Intergenic
995468490 5:112475443-112475465 GAAGTGGGGTGGGGTGGTGGTGG + Intergenic
995806920 5:116063619-116063641 GAAGAAGCCTGGATGGGTGGAGG + Intergenic
996798706 5:127378746-127378768 AAAGCAGGGTGTAGGGGGCGGGG - Intronic
996810111 5:127506958-127506980 GCAGGAGGGTGGAGGGGAAGTGG + Intergenic
996849657 5:127937999-127938021 TCAGCAGGGGGCAGGGGTGGAGG - Intergenic
997114989 5:131117006-131117028 GTTGCAGGGTGGGGGGCTGGGGG - Intergenic
997214036 5:132095682-132095704 GCTGAAGGGTGGAGAGGTGGGGG - Intergenic
997241479 5:132311505-132311527 GAAGGAGGGTGTAGGGATGTAGG + Intronic
997368109 5:133338755-133338777 GAAGCAGGGGGCTTGGGTGGAGG - Intronic
997475575 5:134140541-134140563 GAAGCAGGCTGGAGGGGCCCAGG + Intronic
997611220 5:135217174-135217196 CTGGCAGGGTGGAGGGGGGGTGG - Intronic
997738008 5:136228617-136228639 GAGGCAGGGGGCTGGGGTGGGGG + Intronic
997853381 5:137352638-137352660 GAAGAAGGAGGGAGGAGTGGAGG + Intronic
998092997 5:139381840-139381862 GGATCACAGTGGAGGGGTGGCGG + Intronic
998199485 5:140108117-140108139 GAGGAAGGGGGGAGGGGAGGAGG - Intronic
998377544 5:141701384-141701406 GAGCCAGGGTGGAGGGGTATGGG - Intergenic
998384690 5:141749966-141749988 GGAATAGGGTGGATGGGTGGAGG + Intergenic
998451215 5:142235820-142235842 GGAGCAGGGAGTGGGGGTGGGGG + Intergenic
998522955 5:142817202-142817224 GAAGCAGATGGGAGGGGAGGGGG + Intronic
998903718 5:146881050-146881072 GGAGCTGGGGGGCGGGGTGGGGG + Intronic
999285008 5:150389454-150389476 GTTTCAGGGTGGAGGGGTGAGGG + Intronic
999443539 5:151621011-151621033 GAAGCAGAGGTGGGGGGTGGTGG + Intergenic
1000059432 5:157640438-157640460 GAGACAGGGTAGTGGGGTGGCGG + Intronic
1000145950 5:158453480-158453502 TTAGGAGGGTGGAGGGTTGGAGG + Intergenic
1000205182 5:159051432-159051454 GCGGCGGGGTGGGGGGGTGGGGG - Intronic
1000386085 5:160675860-160675882 GAAGCAGGGGGGTGGGGGAGGGG + Intronic
1000502479 5:162068529-162068551 GGAGCTGGGGGGAGGGGCGGCGG + Intronic
1000633007 5:163612528-163612550 GTGGCAGGGTGGGGGGGTCGCGG - Intergenic
1001327499 5:170739809-170739831 GGAGTGGGGCGGAGGGGTGGTGG - Intergenic
1001634286 5:173198660-173198682 GAGGGAGGGAGGAGGGGAGGAGG - Intergenic
1001724652 5:173887074-173887096 GAAACAGGAGTGAGGGGTGGGGG + Intergenic
1001871444 5:175159620-175159642 GATGGGGAGTGGAGGGGTGGTGG + Intergenic
1001895339 5:175374590-175374612 GAAGGAGGGAGGATGGGAGGGGG - Intergenic
1001940360 5:175735854-175735876 GAAGCTGGGTGGGCGGGCGGTGG - Intergenic
1002206932 5:177569300-177569322 GCAGCGGGGTGGGGTGGTGGGGG + Intergenic
1002327671 5:178420488-178420510 GAAAAAGGGGGGAGGGGAGGAGG - Intronic
1002393707 5:178937014-178937036 GTAGCAGTGGCGAGGGGTGGGGG - Intergenic
1002564019 5:180100033-180100055 CAAGCAGTGTGGAGAGGTGGGGG - Intergenic
1002594255 5:180312015-180312037 GAGGCAGGGAGGCGGGGAGGTGG + Intronic
1002771356 6:292738-292760 GAAGCCGGGTGGGGTGGGGGCGG - Intronic
1003060409 6:2858274-2858296 GAAACAGGGTGGAAGGGGGAGGG - Intergenic
1003135947 6:3434993-3435015 GGAGCAGTGTGGATGGGTTGGGG - Intronic
1003267168 6:4576005-4576027 ACAGCAGGGTGGAGGGATGGCGG - Intergenic
1003512549 6:6793304-6793326 GAAGCTGGGTGAAGGACTGGTGG + Intergenic
1003545188 6:7052446-7052468 GAAGCCGGGGGTGGGGGTGGGGG + Intergenic
1004087219 6:12462158-12462180 GAAGCAGGGCCCAGGGTTGGAGG - Intergenic
1004167562 6:13270382-13270404 GCAGGAGGGTGGGGGGCTGGAGG - Intronic
1004221196 6:13747856-13747878 GAGGGAGGGTGGAGGTGGGGAGG + Intergenic
1004420609 6:15466178-15466200 GAGGAAGGCTGGAGGGGTGATGG + Intronic
1004571547 6:16850544-16850566 GATGGAGGGTGGAGGGCAGGGGG - Intergenic
1005048716 6:21665321-21665343 GGATCAGGGTCGAGGGGTGGGGG + Intergenic
1005117695 6:22356479-22356501 GGAGCAGGGGTGGGGGGTGGTGG + Intergenic
1005480424 6:26250068-26250090 CAAGGAGGGTGGAGGGTTAGGGG - Intergenic
1005714674 6:28535350-28535372 CAATCAGTGTGGAGGGTTGGGGG - Intergenic
1005841809 6:29748733-29748755 GAAGCAGGGTTGAGGTGTGGCGG + Intergenic
1005871247 6:29975604-29975626 AAAGCAGGGCTGAGGAGTGGCGG + Intergenic
1006058666 6:31403847-31403869 GAAGCAGGGCTGAAGTGTGGCGG - Intronic
1006071096 6:31498409-31498431 AAAGCAGGGCTGAGGTGTGGCGG - Intronic
1006374420 6:33663958-33663980 GCAGGAGGGCGGAGGAGTGGGGG - Intronic
1006425526 6:33960658-33960680 GAAGAAGGGTGGAGGGGACATGG - Intergenic
1006457961 6:34142812-34142834 GGAGGAGGGAGGAGGGGGGGAGG + Intronic
1006516652 6:34549284-34549306 GGAGCAGAATGGTGGGGTGGCGG + Intronic
1006598878 6:35212991-35213013 GAAGCGGGGTGCAGGTTTGGAGG + Intergenic
1006604281 6:35244896-35244918 GGAGCAGGGCTGGGGGGTGGAGG + Intronic
1006610347 6:35290908-35290930 GAAGGAGCCTGGAGGGTTGGTGG + Intronic
1006678889 6:35782840-35782862 GAAGCAGGGAGGCCGGGAGGCGG + Intronic
1006808099 6:36801792-36801814 GGGGCAGGGTGGAGGGGTATAGG + Intronic
1007179913 6:39922630-39922652 GAAGCAGGGTGCAGAAGTGCTGG + Intronic
1007302467 6:40877662-40877684 GTTGCAGGGTGGTGGTGTGGTGG - Intergenic
1007383488 6:41505056-41505078 GGGGCAGGGTGGAGAGATGGAGG - Intergenic
1007390837 6:41548675-41548697 GCAGCAGGGGGAGGGGGTGGGGG - Intronic
1007475081 6:42114260-42114282 CAAGCATGGTGGTGAGGTGGTGG - Intronic
1007556119 6:42767941-42767963 GCAGCATGGAGGAGGCGTGGTGG + Intronic
1007589616 6:43013512-43013534 GAATTGGGGCGGAGGGGTGGAGG - Intronic
1007741033 6:44009604-44009626 GAAGGAGGGAGGAGGGAAGGAGG + Intergenic
1007924557 6:45640904-45640926 GGAGCAAGGTGGAGGGCAGGAGG + Intronic
1008054778 6:46935395-46935417 ACACCAGGGTGGAGTGGTGGGGG - Intronic
1008650556 6:53556933-53556955 GAAAAAAGGTGGAGTGGTGGAGG + Intronic
1010131343 6:72497357-72497379 GTCGGAGGGTGGAGGGTTGGGGG - Intergenic
1010156826 6:72804310-72804332 GAAGGGCAGTGGAGGGGTGGGGG - Intronic
1011131275 6:84053967-84053989 GAAGTGGGGTGGAAGGGTGGTGG + Intronic
1011260836 6:85468293-85468315 GAGGCAGGGTGGAGCGGCTGGGG + Intronic
1011410196 6:87059666-87059688 GAGGCAGGGGGGAGGTGGGGAGG + Intergenic
1011410279 6:87059831-87059853 GAGGCGGGGAGGAGGGGAGGCGG + Intergenic
1011410287 6:87059847-87059869 GAGGCGGGGAGGAGGGGAGGAGG + Intergenic
1012752968 6:103185772-103185794 GAAGAAGGGAGGAGGGAGGGAGG + Intergenic
1013054516 6:106570543-106570565 GAAGCAGGTTTGAGGGGTGCTGG + Intergenic
1013168573 6:107616075-107616097 GAAGGGGGGTGGGGGGGGGGCGG + Intronic
1013465795 6:110415884-110415906 GAAGCAGGAAGGAGGGGGTGAGG + Intergenic
1013498192 6:110719979-110720001 GAAGCAGGGGGGGGGTGGGGGGG - Intronic
1014180988 6:118384047-118384069 GAAGCAGGGCAGAGGGAAGGAGG + Intergenic
1014401439 6:120995354-120995376 GATGAAGGGTGGACGGGTCGAGG - Intergenic
1014569970 6:122996606-122996628 GGAGCAGAGAAGAGGGGTGGCGG - Exonic
1015503040 6:133953043-133953065 GAAGGAGGAAGGAAGGGTGGGGG + Intronic
1015907098 6:138128719-138128741 GAAGAGAGGTGGTGGGGTGGGGG - Intergenic
1016614199 6:146028192-146028214 GAATGAGGGCGGAGGGGCGGTGG + Intronic
1016979298 6:149839412-149839434 GAAGCAGGGAGCGGAGGTGGGGG + Intronic
1017288074 6:152701570-152701592 GTGGATGGGTGGAGGGGTGGAGG + Intronic
1017812924 6:157997024-157997046 GAAGCTGGGTGGGGGGGGGTGGG - Intronic
1017931907 6:158963395-158963417 GAAGGAGGGGGGAGGGAGGGAGG - Intergenic
1018066613 6:160129022-160129044 AAAGCAGTGTGGAGGGACGGGGG + Intronic
1018373639 6:163191264-163191286 GAAGTAGGTTTGGGGGGTGGCGG - Intronic
1018400273 6:163414443-163414465 GAGGCAGGGAGGAGGGGGCGCGG + Intronic
1018990347 6:168669177-168669199 GATGCAGGGTGTTGGGGAGGGGG - Intronic
1019104462 6:169657077-169657099 GAAACAGGGCGGAGGAATGGGGG + Intronic
1019200735 6:170312833-170312855 GGAGCAGAGTGAAGGGGTGAGGG + Intronic
1019299673 7:296787-296809 GACGCAGGGCTGCGGGGTGGCGG + Intergenic
1019299818 7:297275-297297 GACGCGGGGCTGAGGGGTGGCGG + Intergenic
1019299854 7:297397-297419 GACGCAGGGCTGAGGGGTGGCGG + Intergenic
1019320706 7:414209-414231 GGAGGAGGGAGGAGGGGAGGAGG - Intergenic
1019335183 7:479275-479297 GAAGGAGGGAAGAGGGGAGGAGG + Intergenic
1019438576 7:1034759-1034781 AAAGGAGGGTGGAGGGTGGGAGG - Intronic
1019446391 7:1073809-1073831 GCAGCAGGGTGTCGGGGTCGGGG - Intronic
1019446400 7:1073841-1073863 GCAGCGGGGTGCAGGGTTGGGGG - Intronic
1019446473 7:1074054-1074076 GCAGCAGGGTGTCGGGGTCGGGG - Intronic
1019446482 7:1074086-1074108 GCAGCGGGGTGCAGGGTTGGGGG - Intronic
1019472870 7:1230377-1230399 GGGGCGGGGTGGGGGGGTGGGGG + Intergenic
1019473569 7:1233446-1233468 GTAGCGGGAGGGAGGGGTGGGGG + Intronic
1019473658 7:1233822-1233844 GGGGAAGAGTGGAGGGGTGGGGG + Intronic
1019473699 7:1233966-1233988 GAAGCGGCGTGGTGGGTTGGCGG + Intronic
1019494455 7:1331295-1331317 AAAGGAGGCTGGCGGGGTGGGGG - Intergenic
1019561675 7:1662397-1662419 GTGGCAGGGTGGAGGGGAGGGGG + Intergenic
1019851054 7:3557998-3558020 GGAACAGGGTCGGGGGGTGGGGG - Intronic
1020131061 7:5558878-5558900 GAAGCAGGAATGAGGGGTGGAGG + Intronic
1020202825 7:6093619-6093641 AAAGGAGAGGGGAGGGGTGGGGG - Intergenic
1020255848 7:6502909-6502931 ACAGCAGGGTGGATGGGTGGTGG - Intronic
1020277008 7:6630665-6630687 GGAGCAGGTTGGAGGGGAGTGGG - Intergenic
1020307080 7:6843595-6843617 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
1020323112 7:6954777-6954799 GGAGCAAGGTGGCGGGGTGCAGG + Intergenic
1020797734 7:12697147-12697169 TAACCAGGGGGGAGGGGTGAGGG - Intergenic
1021125903 7:16851058-16851080 GAAGCGGCGTGGGGGGCTGGGGG + Intergenic
1021266043 7:18523902-18523924 GAAGCAGGGCGGAGCGGGGAGGG - Intronic
1021657045 7:22882853-22882875 GGAGGAGAGTGGAGGGGAGGGGG - Intergenic
1022157449 7:27674492-27674514 GTAGGAGGGTGGGGGGCTGGGGG + Intergenic
1022656719 7:32325952-32325974 GGATCAGGGTGGAGAAGTGGAGG + Intergenic
1022846256 7:34213141-34213163 TTAGTAGGGTGGATGGGTGGGGG + Intergenic
1022983474 7:35626551-35626573 GACAGTGGGTGGAGGGGTGGAGG - Intergenic
1023081769 7:36533140-36533162 GAAGCGGGGTGGAGCGGTGTTGG - Intronic
1023234139 7:38066080-38066102 GCAGCAGGGTAAAGTGGTGGGGG - Intergenic
1023255213 7:38306125-38306147 GGAGCAGGGTGGGGGTGGGGTGG + Intergenic
1023327761 7:39078519-39078541 AATGCAGGGTGAAGGAGTGGTGG + Intronic
1023475652 7:40575092-40575114 GAAGCAGGATGGTGGGCAGGAGG + Intronic
1023616623 7:42026287-42026309 GGGGCAGGGTGGATGAGTGGAGG + Exonic
1024299536 7:47876577-47876599 GGAGCAGGAGGGAGGGGTCGGGG + Intronic
1024621240 7:51159193-51159215 AAAGCAGGGAGGTGGGGAGGAGG + Intronic
1024697467 7:51871214-51871236 GAGACAGGGAGAAGGGGTGGAGG - Intergenic
1026019178 7:66694738-66694760 GACAGAGGGTGGAGGGGAGGGGG + Intronic
1026074322 7:67152510-67152532 CAAACAGGGTGGCGGGGTGAGGG - Intronic
1026145128 7:67740080-67740102 GAGGCAGGATGGAAGGGTGGTGG - Intergenic
1026544135 7:71307109-71307131 AAAGCAGGGACCAGGGGTGGTGG - Intronic
1026590537 7:71691183-71691205 TGATCAGGGTGGCGGGGTGGTGG - Intronic
1026850515 7:73720410-73720432 GGAGCAAGGGGGAAGGGTGGAGG - Intergenic
1026876454 7:73881739-73881761 GAATCAGGGGAGGGGGGTGGGGG + Intergenic
1026883100 7:73919889-73919911 GCAGCAGTGGGGAGGGGGGGAGG - Intergenic
1026892471 7:73990360-73990382 GAGGCAGGGAGGCGGGGAGGAGG - Intergenic
1027035277 7:74920644-74920666 GGAGGCAGGTGGAGGGGTGGAGG - Intergenic
1027189387 7:75988689-75988711 AAAGCCGGGTGGAGGGGTGGAGG + Intronic
1027189439 7:75988792-75988814 AAGGCCGGGTGGGGGGGTGGAGG + Intronic
1027189507 7:75988942-75988964 AAGGCCGGGTGGGGGGGTGGAGG + Intronic
1027189573 7:75989068-75989090 AAGGCTGGGTGGAGGGGTGGAGG + Intronic
1027505758 7:79015994-79016016 GAAGCGGGGGGGGGGGGTGGGGG + Intronic
1027705789 7:81531825-81531847 GAACCAGGGTTGAGGGGATGGGG + Intergenic
1027824001 7:83087298-83087320 GAAGCAGGGAGGGTGGGAGGAGG + Intronic
1028154637 7:87415915-87415937 GAAGCAGGATTGAGGGGCAGGGG + Intronic
1028433112 7:90771092-90771114 GAAGCAGGCTGGGGGATTGGTGG - Intronic
1028444802 7:90909433-90909455 GAAGCATGTTGCGGGGGTGGGGG - Intronic
1028540294 7:91936140-91936162 GGAGTAGGGTGGTGGGGTGGTGG + Intergenic
1028752215 7:94394342-94394364 GGGGCGGGGTGCAGGGGTGGAGG + Intergenic
1028960607 7:96745666-96745688 TAATCAGGGTGGTGGGGAGGGGG + Intergenic
1029078231 7:97952539-97952561 GGAGCAAGGTGGCGGGGTGTAGG + Intergenic
1029125234 7:98290949-98290971 GTAGCTGGGTGGTGGGGTGGGGG + Intronic
1029222572 7:99002118-99002140 GAGGCGGGGGGGTGGGGTGGTGG + Intronic
1029232034 7:99078503-99078525 GGAGGAGGGTGCAGGGGAGGGGG - Intronic
1029272456 7:99385296-99385318 GAAGTTGGGTGGGGGGGGGGGGG + Intronic
1029378992 7:100200332-100200354 GATGCAGAGTGGAGGGGCAGCGG - Intronic
1029394776 7:100300496-100300518 GGAGGCAGGTGGAGGGGTGGAGG + Intergenic
1029413883 7:100431135-100431157 GAGGCAGGGGCTAGGGGTGGAGG + Exonic
1029433495 7:100547898-100547920 AAAGAAGGGTGGAGTGGTGGTGG - Intronic
1029448165 7:100626465-100626487 GAGTCAGCGGGGAGGGGTGGGGG + Intronic
1029709423 7:102291534-102291556 GCTGCAGAGTGGATGGGTGGGGG - Intronic
1029755781 7:102572743-102572765 GGTGCGGGGTGGGGGGGTGGGGG - Intronic
1029973942 7:104815239-104815261 GCAGCAGGGAGGCGGGGTGGGGG - Intronic
1029996606 7:105013504-105013526 GAAGCACGGTGGCAGGGAGGCGG + Intergenic
1030014601 7:105206149-105206171 ACAGCTGGGTGGTGGGGTGGGGG - Intronic
1030345962 7:108433234-108433256 GTAGCTGGGTTGCGGGGTGGGGG - Intronic
1030441848 7:109596557-109596579 GAGACAGGGAGAAGGGGTGGGGG + Intergenic
1031129158 7:117811299-117811321 TGGGCGGGGTGGAGGGGTGGGGG - Intronic
1031866162 7:127040059-127040081 GAAGAAGGGGAGATGGGTGGGGG + Intronic
1031866180 7:127040100-127040122 GAAGAAGGGGAGATGGGTGGGGG + Intronic
1031907344 7:127475329-127475351 AATGCAGGGTGGTGGGGGGGCGG - Intergenic
1032096066 7:128939024-128939046 GGAGCACGCGGGAGGGGTGGGGG + Intronic
1032284649 7:130531178-130531200 GAATCAGGGTGGGTGGGGGGTGG + Intronic
1032285833 7:130537865-130537887 GAAACAGGGTGTAGAGGTGTTGG + Intronic
1032286598 7:130542291-130542313 GAAACAGGGTGTAGAGGTGTTGG + Intronic
1032400088 7:131618812-131618834 GCAGCGGGGTGGGGGGGCGGGGG - Intergenic
1033039878 7:137908329-137908351 GAGGCAGGCTGAAGGGGTGCAGG + Exonic
1033439634 7:141367079-141367101 ACAGCAGGGGGGAGGGGTGGGGG + Intronic
1033493732 7:141871858-141871880 GTAGGAGGGTGGGGGGCTGGGGG + Intergenic
1033756278 7:144400162-144400184 GTGGCAGGGTGGAGTGGCGGAGG - Exonic
1033885598 7:145941163-145941185 ACAGCAGGGTGGAGGGTAGGAGG - Intergenic
1034201999 7:149288472-149288494 GCAGCAGGGTGGCGGCCTGGAGG + Intronic
1034243957 7:149630485-149630507 GAAGCAGGGAGGGATGGTGGAGG - Intergenic
1034252480 7:149703415-149703437 GGAGGAGGGTAGAGGGCTGGGGG + Intergenic
1034422334 7:150996321-150996343 GGGGCAGGGAGGAGGGGTGCAGG - Intronic
1034435544 7:151061293-151061315 GAAGCAGGCTGGCTGGGTGGAGG - Intronic
1034607365 7:152329644-152329666 GAAGGAGGGAGAAGGGATGGAGG + Intronic
1034693928 7:153037517-153037539 GAGGCTGGGGGGTGGGGTGGGGG - Intergenic
1034730929 7:153386893-153386915 GGAGCTGGGTGGGAGGGTGGGGG + Intergenic
1034774554 7:153813171-153813193 GTTGCAGGGTGGGGGGATGGGGG - Intergenic
1034936319 7:155203013-155203035 GACACAGGGTGGAAGGCTGGGGG + Intergenic
1034973822 7:155436494-155436516 GAAGCAGTGAGAAGGGGTGCAGG - Intergenic
1035111573 7:156486639-156486661 GAAGCAGGGTGGAGGGGAGAAGG - Intergenic
1035125702 7:156607031-156607053 GATGAAGGGGGGTGGGGTGGTGG - Intergenic
1035243598 7:157548053-157548075 GAAACTTGGTGGAGGGTTGGTGG + Intronic
1035302854 7:157908297-157908319 AATGCAGGCTGCAGGGGTGGAGG - Intronic
1035560977 8:603166-603188 GAGGCAGGGTGGAGTGTGGGGGG - Intergenic
1035899927 8:3448359-3448381 GAAGAAGGGAGGAAGGGAGGGGG + Intronic
1036085824 8:5611750-5611772 GAAGCAGGGTCCTGGAGTGGGGG - Intergenic
1036120471 8:6012186-6012208 GAGGCTGTGGGGAGGGGTGGAGG - Intergenic
1036262102 8:7249190-7249212 GCAGCAAGGTGGCGGGGTGTAGG + Intergenic
1036304488 8:7590368-7590390 GCAGCAAGGTGGCGGGGTGTAGG - Intergenic
1036314141 8:7707729-7707751 GCAGCAAGGTGGCGGGGTGTAGG + Intergenic
1036355341 8:8038360-8038382 GCAGCAAGGTGGCGGGGTGTAGG - Intergenic
1036525317 8:9529402-9529424 AAAGCAGGGGTGGGGGGTGGTGG - Intergenic
1036561753 8:9904682-9904704 TAAACAGTGTGGAGAGGTGGAGG - Intergenic
1036661802 8:10714008-10714030 CACCCAGGGTGGAGGGGTGGAGG + Intergenic
1036757141 8:11478267-11478289 GAAGCAGCTTTGAGGGGTGGGGG - Intergenic
1036816668 8:11907653-11907675 GGAGCAAGGTGGTGGGGTGTAGG + Intergenic
1036833392 8:12039182-12039204 GCAGCAAGGTGGCGGGGTGTAGG + Intergenic
1036855238 8:12285747-12285769 GCAGCAAGGTGGCGGGGTGTAGG + Intergenic
1037568839 8:20141567-20141589 GAAGCAGGGAGGAGGAGAGGAGG + Intergenic
1037658620 8:20908377-20908399 GATGCAGGGTGGAAAAGTGGGGG + Intergenic
1037693994 8:21207907-21207929 GAAGCTGGCTGTGGGGGTGGGGG - Intergenic
1037805165 8:22054850-22054872 GCAGCAGGGAGGGGGGGAGGAGG - Intronic
1037805662 8:22056864-22056886 GAAGCAGGGTGGGGGCAAGGAGG + Intronic
1037832873 8:22199425-22199447 GTTGCAGGGGGGTGGGGTGGAGG - Intronic
1037917966 8:22784188-22784210 GTAGCAGGTTGCAGGGGTGCTGG - Intronic
1038040798 8:23722542-23722564 GTGGTGGGGTGGAGGGGTGGTGG + Intergenic
1038219607 8:25594787-25594809 GGAGCAGTGTGTGGGGGTGGTGG + Intergenic
1038542648 8:28402308-28402330 GAAAGAGAGTGGAGGGGCGGAGG + Intronic
1039257387 8:35734273-35734295 AAAGCACTGTGGAGGGGAGGAGG - Intronic
1039369086 8:36966397-36966419 CAAGGAGGGTGGGAGGGTGGGGG + Intergenic
1039397669 8:37240939-37240961 GAAGCAGGAGGGAAGGGAGGAGG + Intergenic
1039585363 8:38702523-38702545 GAGGCAGGGTGCAGGGGAGTGGG + Intergenic
1040014495 8:42689764-42689786 GAGGCGGGGTGGGGGGGAGGCGG - Intergenic
1040014505 8:42689780-42689802 GAGGCGGGGTGGGGGGGAGGCGG - Intergenic
1040621375 8:49096331-49096353 GAAGCGGGAGGGAGGGATGGGGG - Intergenic
1040661799 8:49583082-49583104 GAAGCAGGGGAGAGAGGTGCAGG + Intergenic
1040957177 8:52991289-52991311 GAACCAGGGTGGTGGCATGGGGG + Intergenic
1041355113 8:56992683-56992705 GAGTCGGGGTGGGGGGGTGGGGG - Intronic
1041623490 8:59999769-59999791 GCGGCAGGCTGGAGGGCTGGAGG - Intergenic
1041744984 8:61198711-61198733 GAAGAAGGGAGGAGGGAAGGCGG - Intronic
1043738338 8:83775314-83775336 TTAGCATGGTGGGGGGGTGGTGG - Intergenic
1044006835 8:86947892-86947914 GTAGCAGGGTGGTTGGGAGGAGG - Intronic
1044546589 8:93466741-93466763 GAGGCTGGGTGGGTGGGTGGGGG + Intergenic
1044832372 8:96262273-96262295 GAGGGAGGGTGGCGGGGAGGGGG + Intronic
1045324773 8:101109917-101109939 GGGGCAGGGTGGAGGGAGGGAGG + Intergenic
1045557009 8:103224412-103224434 AAAGCAGAGTGGGCGGGTGGGGG + Intronic
1045819402 8:106318480-106318502 GAAGCAGGGTGGAAGGAGTGGGG - Intronic
1045896003 8:107217793-107217815 GAAGAAGAGTGGAGGTGAGGGGG - Intergenic
1046491120 8:114953748-114953770 GCAGCAGGGTGGTAGTGTGGTGG - Intergenic
1046559199 8:115816345-115816367 GATGCGGGGTGGAGGGGGTGGGG - Intergenic
1046586540 8:116155305-116155327 GAAGGAGAGAGAAGGGGTGGGGG + Intergenic
1046617254 8:116491019-116491041 GAGGCAGGGTGCAGGGGAAGTGG + Intergenic
1046802074 8:118439580-118439602 GAATCAGGGTGCAGGGTTGGGGG - Intronic
1047167662 8:122458302-122458324 CAAGAAGGGCAGAGGGGTGGTGG - Intergenic
1047215937 8:122876080-122876102 GTAGGTGGGTGGAGGGATGGAGG - Intronic
1047276970 8:123413231-123413253 GAAGCAGGGAGGAGTTGGGGGGG - Intronic
1047520425 8:125591668-125591690 GAAGCAGAGGGGCTGGGTGGGGG + Intergenic
1047708536 8:127526371-127526393 GGAGAAGAGTGGAGGGCTGGGGG + Intergenic
1048101728 8:131359274-131359296 GAAGCATGGTGGGAGGGTGCAGG + Intergenic
1048468528 8:134687043-134687065 CCTGCAGGGTGGAGGGGAGGTGG - Intronic
1048640392 8:136351932-136351954 GAAACAGGGTGTAGGGTTTGTGG + Intergenic
1048701255 8:137092203-137092225 GAAGGAGGATGGAGGGGAGGCGG + Intergenic
1048836980 8:138529156-138529178 GAATCAGGGTGCACAGGTGGTGG - Intergenic
1048890234 8:138940511-138940533 GGAGAAAGGTGGGGGGGTGGGGG - Intergenic
1049214822 8:141402724-141402746 GAAGCAGGGGGGAGGGGTGGGGG - Intronic
1049350668 8:142162842-142162864 GATGGAGGATGGATGGGTGGAGG + Intergenic
1049366205 8:142238108-142238130 GGTGCAGGGTGGAGGGGGGGCGG - Intronic
1049406729 8:142454955-142454977 GAAGGAGGGAGGAGGGGCAGAGG - Intronic
1049469267 8:142768214-142768236 GGAGGAGGGAGGTGGGGTGGGGG + Intronic
1049472503 8:142782747-142782769 GACCCAGGGTGAAGGGGTGAGGG - Intergenic
1049575044 8:143386037-143386059 GAGGGAGTGGGGAGGGGTGGGGG + Intergenic
1049609962 8:143550331-143550353 GGGGTGGGGTGGAGGGGTGGTGG - Intergenic
1049616891 8:143579423-143579445 GAGGCAGAGTGGTGGGGTGGTGG + Intergenic
1049645766 8:143734966-143734988 GTGGCAGGGGCGAGGGGTGGTGG - Intergenic
1050528235 9:6564476-6564498 TAAGTAGGGTGGAGTGGTAGTGG - Intronic
1051671648 9:19516415-19516437 GAAGCAGGGCAGAGGGGAGTGGG + Intronic
1053053475 9:34979766-34979788 GAAGCAGGGTGGTGAGCTGCTGG + Exonic
1053140985 9:35682612-35682634 GAAGTAGGGTGGTGAGGTGCAGG - Intronic
1053305419 9:36981187-36981209 GAAGCAGGGCTGAGGGGGGGGGG - Intronic
1053329258 9:37188698-37188720 GAAGGGAGGGGGAGGGGTGGGGG - Intronic
1053337316 9:37286981-37287003 GAAGGAGGGGGGAGGGAGGGAGG - Intronic
1053725107 9:40991764-40991786 GAAACAGGGCAGAGGCGTGGAGG - Intergenic
1054340861 9:63860229-63860251 GAAACAGGGCAGAGGCGTGGAGG + Intergenic
1054757754 9:68976484-68976506 GAGGCAGGGTAGTGGGGTTGTGG - Intronic
1054943664 9:70771568-70771590 GAAGGTGGGTGGTGTGGTGGGGG + Intronic
1055896516 9:81182822-81182844 GAAGCAGCCTGGAGCCGTGGAGG - Intergenic
1056468219 9:86879623-86879645 GCAGCAGGAAGCAGGGGTGGAGG + Intergenic
1056569840 9:87805638-87805660 CAGCCAGGGTGGAGGTGTGGGGG + Intergenic
1056604882 9:88077595-88077617 GAGGCAGGTTTGAAGGGTGGGGG - Intergenic
1056711020 9:88991723-88991745 GAACCAGGGTGGGGGGCTGGGGG + Intronic
1056754437 9:89373111-89373133 GAGGCCTGGTGGTGGGGTGGAGG - Intronic
1056865790 9:90226468-90226490 GGAGCAAGGTGGCGGGGTGTAGG - Intergenic
1057048079 9:91901073-91901095 GAAGGATGGTGGAGTGGAGGGGG - Intronic
1057172559 9:92971941-92971963 GGAGGGGGGTGGATGGGTGGAGG - Intronic
1057179770 9:93023386-93023408 GACGGAGTGTGGAGGCGTGGGGG + Intronic
1057412364 9:94828057-94828079 GAAGCAGGGAGGAGGAGCAGTGG + Intronic
1057554941 9:96080562-96080584 GAATCTGGGAGGAGAGGTGGAGG - Intergenic
1057797437 9:98169007-98169029 GGGACGGGGTGGAGGGGTGGGGG + Intronic
1058579313 9:106437631-106437653 GAAGAAGGGGGGAGGGGGAGGGG - Intergenic
1058727875 9:107820622-107820644 GAAGCAGGAGGGAGAGGAGGAGG + Intergenic
1058858572 9:109091097-109091119 GGAGGAGGGTGAAGGGGAGGTGG + Exonic
1058944163 9:109841528-109841550 GAAAAAGGGTGGAGAGATGGAGG + Intronic
1059281922 9:113141756-113141778 GTAGAGGGGAGGAGGGGTGGTGG + Intergenic
1059387636 9:113977126-113977148 ACTGCAGGGTGGAGGGGAGGAGG + Intronic
1059633791 9:116153705-116153727 GAAGAAGGAGGGAGGGGAGGGGG + Intergenic
1059803240 9:117772147-117772169 GTAGGAGGGTGGGGGGCTGGGGG + Intergenic
1060119578 9:120975634-120975656 AAGGCAGAGTGGAGGGTTGGTGG - Intronic
1060299986 9:122369608-122369630 GGGACAGGGTGGAGGTGTGGGGG - Intergenic
1060337279 9:122737353-122737375 GTTGCCGGGTGGAGGGCTGGGGG - Intergenic
1060885130 9:127146211-127146233 GCAGGAGGGAGGAGGGGTGTGGG - Intronic
1060985425 9:127816665-127816687 GAGGCAGGGGTGAGGGATGGGGG - Intronic
1061036804 9:128118748-128118770 GATGGAGGATGGAGGGGTGCAGG + Intergenic
1061246150 9:129402128-129402150 GGAGCAGGGAGGAGGTGGGGAGG - Intergenic
1061255679 9:129453413-129453435 GATGGAGTGTGGAGGGATGGGGG + Intergenic
1061257849 9:129463114-129463136 GAGGCAGTGGGGTGGGGTGGGGG + Intergenic
1061289882 9:129644655-129644677 GGAGTAGGAAGGAGGGGTGGGGG + Intergenic
1061387123 9:130296859-130296881 GAAGTAGGGGGGAGGTGTGGGGG + Intronic
1061405847 9:130392639-130392661 GGAGCAGGCAGCAGGGGTGGAGG + Intronic
1061490992 9:130944373-130944395 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1061491005 9:130944405-130944427 GTAGAGGGCTGGAGGGGTGGAGG + Intergenic
1061491017 9:130944437-130944459 GTGGAAGAGTGGAGGGGTGGAGG + Intergenic
1061491021 9:130944445-130944467 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1061491031 9:130944469-130944491 GTGGAAGGGTGGAAGGGTGGAGG + Intergenic
1061491056 9:130944525-130944547 GTGGAAGGGTGGAGGGGTGGAGG + Intergenic
1061491060 9:130944533-130944555 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1061491064 9:130944541-130944563 GTGGAGGGGTGGAGGGGTGGAGG + Intergenic
1061491082 9:130944581-130944603 GTGGAAGGGTGGAGGGGTGGAGG + Intergenic
1061562629 9:131415953-131415975 GAAACATGGGGGTGGGGTGGGGG - Intronic
1061593593 9:131614393-131614415 GAAGAAGGGAGGAGAGGAGGAGG - Intronic
1061609817 9:131739279-131739301 GAAGCAGGCTGGATGAGTGGGGG - Intronic
1061705732 9:132451743-132451765 GAGGCAGAGTGGAGGGGGTGAGG - Intronic
1061872528 9:133528444-133528466 GCAGCCGGGAGGTGGGGTGGAGG + Intronic
1061947105 9:133914640-133914662 GAAGCAGGAAGCAGGGGAGGGGG + Intronic
1061949877 9:133930270-133930292 GAGGCAGGGTGGAGGCAGGGAGG - Intronic
1062009453 9:134259230-134259252 GAAGCCAGGGGCAGGGGTGGGGG - Intergenic
1062098013 9:134712606-134712628 GAAGGAAGGGGGAGGGGAGGAGG - Intronic
1062334683 9:136059866-136059888 GAGTTAGGGTGGAGGGGTTGGGG - Intronic
1062454690 9:136629939-136629961 GTTGCAGGGGGGAGGGGAGGGGG + Intergenic
1062538329 9:137030567-137030589 GAAGCAGGGGTGGGGGGTGCAGG - Exonic
1062565438 9:137162096-137162118 GGGGCCGGGTGGCGGGGTGGCGG + Intronic
1062597323 9:137305132-137305154 TAAGCAGGGAGGGAGGGTGGCGG + Intergenic
1062618475 9:137408598-137408620 GCAGCTGGGGGGAGGTGTGGGGG - Intronic
1062622369 9:137428732-137428754 GAGGCTGGGTGGGGGGATGGGGG + Intronic
1203518165 Un_GL000213v1:23268-23290 GCAGCCGGGTGGAGGGAGGGGGG - Intergenic
1203449709 Un_GL000219v1:100225-100247 GAAACAGGGCAGAGGCGTGGAGG + Intergenic
1185466611 X:358778-358800 GAAGCACCGCGGAGGGGGGGTGG + Intronic
1185599765 X:1330822-1330844 GAAGCTTGCGGGAGGGGTGGCGG - Intergenic
1185627613 X:1493453-1493475 GAAGGAGGGAGGAGGGAGGGAGG + Intronic
1185913776 X:4011603-4011625 GAAGGAGGGAGGAGGGAGGGAGG - Intergenic
1186554353 X:10541817-10541839 GAGGAAGGGTGGGAGGGTGGGGG + Intronic
1186744653 X:12554997-12555019 GAAGCAGAGTGGAGTGGTCAGGG - Intronic
1186849778 X:13569365-13569387 GAAGCAGGATGGAAGGATGCAGG - Intergenic
1186878752 X:13843103-13843125 GAACCAGAGTTGAGGGGTGAGGG - Intronic
1187228257 X:17395058-17395080 GAAGCAGGGTAGAGCAGAGGAGG - Intronic
1187264409 X:17718333-17718355 GAAGGAGGGAGGGAGGGTGGTGG + Intronic
1187289561 X:17940057-17940079 GAAGCAGGAGGGAGAGGAGGAGG - Intergenic
1187343461 X:18442000-18442022 GCAGCAGGGAGGAGGGGTGGGGG - Intronic
1187541326 X:20198594-20198616 TAAAAAGGGTGGTGGGGTGGAGG + Intronic
1187960068 X:24559774-24559796 GGAGCAGGGAGGTGGTGTGGGGG + Intronic
1188004849 X:25010215-25010237 GAGGGAGGGAGGAGGGCTGGGGG - Intronic
1188303467 X:28533050-28533072 GAAGAAGGGTGGAAGGGAAGAGG + Intergenic
1188613422 X:32127526-32127548 GAAGGAGGGAGAAGGAGTGGGGG - Intronic
1188815915 X:34714119-34714141 GTAGCATGGTGGCGGGGGGGCGG - Intergenic
1189333284 X:40155627-40155649 GAAGTAGGGAGGGGGTGTGGGGG + Intronic
1190232644 X:48594290-48594312 GAAGCAGAGTGGTGGGATGAAGG + Intronic
1190282383 X:48939629-48939651 GAAGGAGGTTGGTGGGGTAGGGG - Intronic
1190396919 X:49994335-49994357 GGGGCAAGGTGGAGTGGTGGTGG + Intronic
1190642767 X:52496093-52496115 GAAGGAGGGCCGAGGAGTGGAGG + Intronic
1190644906 X:52516774-52516796 GAAGGAGGGCCGAGGAGTGGAGG - Intronic
1190658065 X:52629535-52629557 GAACCGGGGAGGAGGGGAGGAGG + Intergenic
1190713145 X:53083504-53083526 GAAGGGTGGTGGAGGGGGGGCGG + Intronic
1190806931 X:53846742-53846764 GAAGCATTGTGGTGGGGTTGGGG - Intergenic
1191101047 X:56729174-56729196 GGGGTAGGGAGGAGGGGTGGAGG + Intergenic
1191111410 X:56805568-56805590 GATGCAGGATGGGGTGGTGGTGG + Intergenic
1191707096 X:64104872-64104894 GAAGGAGGGAGGGGGGGTGAGGG + Intergenic
1191715213 X:64189794-64189816 GCAGAAGGGTGGGGGGGTGGGGG - Exonic
1191816782 X:65253993-65254015 GCAGCAGGGTGGAGTGGGGTAGG - Intergenic
1192033946 X:67544331-67544353 GAGGCGGGGTGGAGAGGAGGAGG - Intronic
1192139550 X:68636044-68636066 AAAGCAGATTGGAGGGGTAGAGG + Intergenic
1192283277 X:69706624-69706646 GAAGAAGGGTGGGGGTGGGGAGG + Intronic
1192848047 X:74925718-74925740 GAAGAAGGGTAGAGGGGGGAAGG - Intergenic
1195000315 X:100637006-100637028 TAAGGAGAGGGGAGGGGTGGGGG - Intronic
1195115474 X:101694143-101694165 GAAGCAGGAGGGAAGGGTAGGGG + Intergenic
1195292626 X:103443930-103443952 GAAGCAGGGTGGGCGGCAGGGGG - Intergenic
1195469955 X:105219867-105219889 GGAGCAGGGTGGAGAGGGGTGGG + Intronic
1195705202 X:107733510-107733532 AAAGCAGGGTGGAGGTGTGCAGG - Intronic
1195718944 X:107847359-107847381 GAAGCACAGTGGAGGGGTCAGGG + Intronic
1196438194 X:115693587-115693609 GAAGCAGGATGGAGGGGAAAGGG + Intergenic
1196645898 X:118116931-118116953 GAGGCAGGGTGGCGGGGAGCCGG + Intronic
1196650074 X:118159344-118159366 GAAGGAGGGAGGGGGGGGGGAGG + Intergenic
1196677406 X:118434674-118434696 GAGGTGGGGTGGAGGGGTTGGGG - Intronic
1198054122 X:132976908-132976930 GGAGCAAGGTGGGGGGGAGGTGG + Intergenic
1198504152 X:137284501-137284523 GAAGCGGGGTAGAGGGGTTTTGG + Intergenic
1199143170 X:144335057-144335079 GGTGGAGGGGGGAGGGGTGGAGG - Intergenic
1199143179 X:144335072-144335094 GAAGAAGGGGGGAGGGGTGGAGG - Intergenic
1199547193 X:149018738-149018760 CAAGCAGGGAGGATGAGTGGCGG + Intergenic
1199740327 X:150729610-150729632 GGAACAGGGTGGCAGGGTGGTGG - Intronic
1199978040 X:152905799-152905821 GGACCAGAATGGAGGGGTGGAGG + Intergenic
1200061807 X:153487177-153487199 GAGGCAGGGTGGGGGTGGGGAGG - Intronic
1200086565 X:153610138-153610160 GCAGCAGGGGGATGGGGTGGGGG - Intergenic
1200247202 X:154532529-154532551 GGAGCAGTGTGGAGGGTGGGCGG - Intronic
1200256663 X:154586036-154586058 GGGGTAGGGGGGAGGGGTGGGGG + Intronic
1200259611 X:154606100-154606122 TAAGGAGGGTTGAGGGGGGGAGG - Intergenic
1200261106 X:154618367-154618389 GGGGTAGGGGGGAGGGGTGGGGG - Intronic
1201109728 Y:10790432-10790454 GGAGTGGGGTGGAGGGGGGGGGG - Intergenic
1201733871 Y:17236069-17236091 GTAGCAGGGTGCAGGGGGAGAGG + Intergenic