ID: 915564506

View in Genome Browser
Species Human (GRCh38)
Location 1:156706175-156706197
Sequence CGAAGCAGGGTGGAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 635}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564506_915564520 4 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG 0: 1
1: 1
2: 4
3: 45
4: 635
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
915564506_915564522 18 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG 0: 1
1: 1
2: 4
3: 45
4: 635
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129
915564506_915564517 -5 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG 0: 1
1: 1
2: 4
3: 45
4: 635
Right 915564517 1:156706193-156706215 CTTCGGGCTCACGTAATGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 53
915564506_915564519 -3 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG 0: 1
1: 1
2: 4
3: 45
4: 635
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564506_915564518 -4 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG 0: 1
1: 1
2: 4
3: 45
4: 635
Right 915564518 1:156706194-156706216 TTCGGGCTCACGTAATGCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564506 Original CRISPR CGAAGCAGGGTGGAGGGGTG GGG (reversed) Intergenic
900136645 1:1120453-1120475 GGAAGCAGGGGTGGGGGGTGGGG + Intergenic
900151387 1:1180659-1180681 CAGGGCAGGTTGGAGGGGTGGGG + Intronic
900204771 1:1427234-1427256 GGGAGCAGGGTGGAGCGGGGAGG - Intronic
900290886 1:1923137-1923159 GGGAGCTGGCTGGAGGGGTGTGG + Intronic
900385341 1:2408012-2408034 CCAGGCAGGGGCGAGGGGTGAGG + Intronic
900386523 1:2413295-2413317 CCAGGCAGGGTGGAGGGTGGAGG - Intronic
900600938 1:3502420-3502442 CCCAGCTGGGTGGAGGGGAGTGG - Intronic
900640895 1:3687668-3687690 CGGAGCAGAGTGGAGGGGAGGGG - Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
900780781 1:4615865-4615887 GGAAGCAGGGTGGAGCAGAGGGG + Intergenic
900902796 1:5528177-5528199 CTAAGTGGGGTAGAGGGGTGTGG - Intergenic
901129824 1:6955300-6955322 GGAAGAGGAGTGGAGGGGTGAGG - Intronic
901615743 1:10538181-10538203 TGAAGCAGGGAGCCGGGGTGAGG + Intronic
901664456 1:10818546-10818568 GAAAGCAGGTGGGAGGGGTGGGG + Intergenic
901790005 1:11649053-11649075 GGACCCAGGGCGGAGGGGTGGGG - Intronic
901844230 1:11971804-11971826 CGAAGCAGGGCCCAGGCGTGGGG - Intronic
901928008 1:12579224-12579246 CCAGGCAGGATGGAGGGGAGGGG - Intronic
902372275 1:16014216-16014238 AGAAGCAGGGTGGAGGGGAAGGG - Exonic
902580363 1:17404103-17404125 TGAAGCAGCCTGGAGGGGAGAGG - Intergenic
903027857 1:20442414-20442436 TGAAGCAGGATGAGGGGGTGGGG - Intergenic
903306172 1:22414762-22414784 TTGAGAAGGGTGGAGGGGTGGGG - Intergenic
903324983 1:22564274-22564296 GGAGGCAGGAAGGAGGGGTGCGG + Intronic
903539140 1:24086985-24087007 GGAATCCGGGTGGAGAGGTGAGG - Intronic
903950083 1:26991581-26991603 AGAGGAAGGGTGGAGGGGTTGGG - Intergenic
904535773 1:31198619-31198641 TGAAGTAGGGTGGAGGGCAGGGG - Intronic
904688669 1:32277507-32277529 CCAAGAGGGGTGCAGGGGTGGGG - Intronic
904949774 1:34227172-34227194 GGAAGCAGGGAGGTTGGGTGGGG + Intergenic
905479244 1:38249898-38249920 CTAAGGAGGGAGGAGAGGTGAGG + Intergenic
905560435 1:38922606-38922628 GGAAACAGGGTGGAGAGGTATGG - Intronic
905865889 1:41376441-41376463 GGGAGCAGGGTGGGGGGCTGGGG + Intronic
906232938 1:44180907-44180929 CGAAGCGGGGAGGAGGGGAGGGG + Intergenic
906248878 1:44296131-44296153 GGAGGCACGGTGGAGGGGGGTGG - Intronic
906511282 1:46411673-46411695 TGGAGCAGGGTGGTGGGGGGAGG + Intronic
906682500 1:47738932-47738954 CGTAGATGGGTGGGGGGGTGGGG + Intergenic
906732776 1:48097585-48097607 AGAAGCAGATTGGAGGGGAGAGG - Intergenic
908330553 1:63066840-63066862 GGAGGCTGGGGGGAGGGGTGCGG + Intergenic
908450256 1:64247502-64247524 GGAAGGAGGGTGGAGGAGTATGG + Intronic
908629637 1:66088157-66088179 TGAAGCAGAGAAGAGGGGTGGGG + Intronic
908817550 1:68049970-68049992 GGAAGGAGTGTGGAGGGGAGTGG - Intronic
909593825 1:77381971-77381993 AGAGGGTGGGTGGAGGGGTGTGG - Intronic
909997457 1:82298177-82298199 CAAGGCAGGGTGCAGCGGTGTGG + Intergenic
910112085 1:83693487-83693509 AGAAGGGGGGTGGGGGGGTGAGG + Intergenic
910973739 1:92883886-92883908 CAAAGCAGGGTCTAGGGGTAAGG + Intronic
912445148 1:109730068-109730090 CAAAGCAGGGGGGAGGGGGTTGG + Intronic
912514568 1:110210069-110210091 CGGAGCAGGGCTGAGGGGGGCGG + Intergenic
913111508 1:115661450-115661472 CTAAGCAGGGCGGGTGGGTGGGG - Intronic
913969447 1:143403412-143403434 GGGAGCAGGGTAGAGGGGAGGGG - Intergenic
914192688 1:145425225-145425247 CGAGGCGGGGTGGGGGGTTGGGG - Intergenic
914984972 1:152448606-152448628 TGAAGGCAGGTGGAGGGGTGGGG + Intergenic
915564506 1:156706175-156706197 CGAAGCAGGGTGGAGGGGTGGGG - Intergenic
915586707 1:156847658-156847680 AGGAGCAGGTTGGGGGGGTGGGG + Intronic
916718558 1:167465206-167465228 CCTAGCAGGGTGGTGGGGAGGGG - Intronic
916793702 1:168146204-168146226 CGGGGAAGGGTGGGGGGGTGGGG + Intergenic
917448117 1:175123886-175123908 CTGGGCCGGGTGGAGGGGTGAGG - Intronic
918074297 1:181158963-181158985 AGGAGCAGGGTGCAGGGGAGGGG + Intergenic
918424392 1:184393331-184393353 GGAAGAAGGGAGGAGGTGTGGGG - Intronic
919728582 1:200899165-200899187 AGAAGAAGGGAGGAGGAGTGGGG + Intronic
919767552 1:201136940-201136962 CGAAGGGGGGTGGTGAGGTGAGG + Intronic
920032296 1:203044706-203044728 TGCAGCAGGGGGCAGGGGTGCGG + Intronic
920498305 1:206470769-206470791 CTCAGCCGGGTGCAGGGGTGTGG + Intronic
920702932 1:208231345-208231367 GGAAGCGGGAGGGAGGGGTGAGG + Intronic
921155183 1:212433281-212433303 CGAAGGATGGCCGAGGGGTGAGG + Intronic
922547105 1:226466053-226466075 CGAGGCAGGGTGGCTGGATGAGG - Intergenic
923140253 1:231155880-231155902 AGAAAGAGGGTGGAAGGGTGGGG + Intergenic
1063089334 10:2848435-2848457 GTAAGGGGGGTGGAGGGGTGGGG - Intergenic
1063340031 10:5254054-5254076 GGAAGCAGGAAGGAGGGGAGGGG + Intergenic
1063343703 10:5292597-5292619 GGAAGCAGGAAGGAGGGGAGGGG - Intergenic
1063629848 10:7723225-7723247 TGAAGCAGCGTGGAGTGGAGTGG + Intronic
1063960406 10:11301489-11301511 GGGAGCGGGGTGGGGGGGTGCGG - Intronic
1067010877 10:42712511-42712533 ATAAGCAGGGAGGATGGGTGGGG - Intergenic
1067196898 10:44127917-44127939 AGAAGCAGGGTGGGGAGCTGGGG - Intergenic
1067343275 10:45420915-45420937 AGAAGTAGGGGCGAGGGGTGGGG + Intronic
1067557408 10:47282544-47282566 CGCAGGAGGGTGGAGGGGTGTGG + Intergenic
1067582123 10:47452506-47452528 CGAAGCACAGAGGAGAGGTGAGG - Intergenic
1067628810 10:47944866-47944888 CTGAGGAGGGTTGAGGGGTGGGG - Intergenic
1067744734 10:48927221-48927243 GGAAGCAGGGGGGAGGGTTCGGG - Intronic
1067776937 10:49170831-49170853 CCTAGCAGGATGCAGGGGTGGGG - Intronic
1068947564 10:62744909-62744931 CGAGGCAGGGTTGGGGGATGGGG - Intergenic
1069422809 10:68261655-68261677 CTAAGGTGGGTGTAGGGGTGTGG + Intergenic
1069903376 10:71718532-71718554 CTGAGCAGGGAGGAGGGATGGGG + Intronic
1070565180 10:77598656-77598678 AGGAGCAGTGTGGAGGGGAGGGG + Intronic
1070649026 10:78221796-78221818 CGAAGCAGAGGAGAGGGCTGGGG - Intergenic
1070982278 10:80659323-80659345 AGAAGCAGAGTGGAGGGATTTGG - Intergenic
1071825600 10:89322568-89322590 AGAAGCACGGTGGTGGGGTCGGG - Intronic
1072451890 10:95545256-95545278 GGAATCTGGGTGGAGAGGTGAGG - Intronic
1072982661 10:100112649-100112671 AGGAGTAGGGTGGTGGGGTGGGG + Intergenic
1074190208 10:111128904-111128926 CGGAGCAGGGGGCAGGGGGGAGG - Intergenic
1074421008 10:113309047-113309069 CGAAGTTGGGAGCAGGGGTGAGG + Intergenic
1074507316 10:114082950-114082972 TGAGCCTGGGTGGAGGGGTGGGG + Intergenic
1074925252 10:118062445-118062467 GGTAGTAGGGAGGAGGGGTGAGG - Intergenic
1075651336 10:124129757-124129779 CTGAGCAGGGTGTAGGGGTAAGG - Intergenic
1075722685 10:124596689-124596711 TGAAGCTGGGTGGACGGGTGGGG + Intronic
1075733670 10:124651328-124651350 AGAAGGAGGCTGGAGGGGTGCGG + Intronic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1075936115 10:126342906-126342928 GGAGGGAGGGTGGAGGGGTGGGG + Intronic
1076245268 10:128942414-128942436 GGAAGCAGGATGCAAGGGTGTGG + Intergenic
1076330058 10:129657557-129657579 TAAAGCAGGGAGGAGGGATGGGG + Intronic
1076358271 10:129868636-129868658 AGAAGGAGGGTGCAGGGGGGAGG + Intronic
1076815703 10:132913823-132913845 GGGGGCTGGGTGGAGGGGTGGGG - Intronic
1076824845 10:132961693-132961715 TGCAGCAGGGGTGAGGGGTGGGG - Intergenic
1076824859 10:132961733-132961755 TGCAGCAGGGGTGAGGGGTGGGG - Intergenic
1076875216 10:133212630-133212652 GGAGGCAGGGTTGGGGGGTGAGG - Intronic
1077159386 11:1105791-1105813 TGCAGCAGGGAGCAGGGGTGGGG - Intergenic
1077338514 11:2015948-2015970 CGAAGGAGGATGGAGGGGCCGGG + Intergenic
1077413217 11:2413096-2413118 CCAGGCAGGGTGGAGGGGACTGG - Intronic
1077414513 11:2418473-2418495 CGAAGCCTTGTGGAGGGGTGCGG - Intronic
1077433043 11:2525534-2525556 CAAAGCAGTGTGGAGGGTGGGGG + Intronic
1077472791 11:2772089-2772111 GGGAGCAGCATGGAGGGGTGGGG + Intronic
1078060996 11:8043972-8043994 AGAAGAAGGGGGGTGGGGTGGGG - Intronic
1078449067 11:11426831-11426853 TGGAGCAGGGTAGAGGGGAGGGG + Intronic
1079451664 11:20604086-20604108 CAGTGCAGGGTTGAGGGGTGAGG + Intronic
1079826971 11:25208490-25208512 AGAAGCAGGGGAGAAGGGTGAGG + Intergenic
1079875611 11:25853402-25853424 AGAAGCAGAGTGAAGAGGTGGGG + Intergenic
1079909189 11:26288154-26288176 GGAAGCAGGGTAGAGTGGAGAGG + Intergenic
1080414634 11:32057916-32057938 CAGAGCAGGGTGGAGAAGTGGGG - Intronic
1080677259 11:34439242-34439264 CGAAGCAGGGGAGGGGGGTCCGG + Intronic
1082928877 11:58579130-58579152 CGGAGCCGGGCGGAGGGGAGGGG + Exonic
1083596209 11:63919281-63919303 TGTAGCAGGTGGGAGGGGTGGGG - Intergenic
1084122976 11:67080272-67080294 GGAGGCAGGGTGCAGAGGTGAGG + Intergenic
1084219998 11:67671982-67672004 TGAAGCAGGGGGTGGGGGTGAGG - Intronic
1084430508 11:69108214-69108236 GGGACCAGGGTGGAGGGCTGTGG - Intergenic
1084497895 11:69515705-69515727 CGTAGCAGGATGGAGGGGTAGGG + Intergenic
1084580599 11:70020618-70020640 CGCAGCAGCGAAGAGGGGTGTGG - Intergenic
1084750872 11:71203861-71203883 AGGAGCAGGGTGCAGGGGTCTGG + Intronic
1084941348 11:72615013-72615035 GGCAGGAGGGTGGAGGGATGGGG - Intronic
1085348021 11:75780650-75780672 CAAAGCAGGGGGCAGTGGTGGGG - Intronic
1085515906 11:77111923-77111945 TGGAGCAGGGAGCAGGGGTGGGG + Intronic
1085755980 11:79201708-79201730 AGAAGCATGAAGGAGGGGTGGGG + Intronic
1085847776 11:80085383-80085405 CACAGCAGGCTGGAGGGCTGGGG + Intergenic
1086543079 11:87935751-87935773 GGATGCAGGGAGTAGGGGTGGGG - Intergenic
1087817921 11:102679393-102679415 AGGAGGAGGGTGGCGGGGTGAGG + Intergenic
1088136300 11:106559824-106559846 CGAGGATGGGTGGAGGGTTGGGG - Intergenic
1088175453 11:107048388-107048410 GGGAGCAGGCTGGAGGGGAGGGG - Intergenic
1088868997 11:113875579-113875601 CGGAGCGGGGTGGAGGGCGGGGG - Intergenic
1089129671 11:116201919-116201941 CCTAGCAGGGTGGAGCAGTGAGG + Intergenic
1089504929 11:118956630-118956652 CGATGCTGCGGGGAGGGGTGAGG + Intronic
1089608238 11:119654447-119654469 GGAATGGGGGTGGAGGGGTGAGG - Intronic
1090154354 11:124422012-124422034 AGAAGGAGGGTTGAGGGCTGTGG - Intergenic
1090420621 11:126572694-126572716 AGAGGCAGGGAGGTGGGGTGAGG + Intronic
1090745061 11:129698760-129698782 AAAAGCAGGGTTGGGGGGTGGGG - Intergenic
1090901213 11:131033416-131033438 GGAAGCAGGTTGGAGAGATGAGG - Intergenic
1202821498 11_KI270721v1_random:71130-71152 CGAAGGAGGATGGAGGGGCCGGG + Intergenic
1091599227 12:1908034-1908056 CGAACTGGGGTGGACGGGTGAGG + Exonic
1091660065 12:2376814-2376836 TGAAGCAGGGAGGAGGTGGGGGG - Intronic
1092001473 12:5036047-5036069 AGAAGGAGGGTGGGAGGGTGGGG + Intergenic
1092021015 12:5202148-5202170 CGAGGGAGTGTGGAGGGGGGCGG + Intergenic
1092157704 12:6295172-6295194 AGCAGCAGGGTTGGGGGGTGGGG - Intergenic
1092371006 12:7916443-7916465 AAAAGGAGGGTGGCGGGGTGGGG + Intergenic
1094295077 12:28896754-28896776 AGAAGCCTGGTAGAGGGGTGTGG - Intergenic
1095566826 12:43634061-43634083 AGAAGCAGAGTGGAGGGCTGGGG - Intergenic
1095947685 12:47763129-47763151 CTCAGCAGGGTGGAAGGGAGAGG + Intronic
1096022538 12:48334084-48334106 GGAAACAGGGTGGAGAGGTATGG + Intergenic
1096192793 12:49631285-49631307 CAGAGCAGGGTGGAGGGTTGGGG + Intronic
1096490020 12:52008017-52008039 CGAAGGAGGGCGGCTGGGTGAGG - Intronic
1096513768 12:52145552-52145574 CGGGGCAGGATCGAGGGGTGTGG + Intergenic
1096572235 12:52530266-52530288 CAAAGCAATGTGGAGGGATGGGG - Intergenic
1096594529 12:52686227-52686249 AGAGGCAGGGTGGCAGGGTGGGG - Intergenic
1096800633 12:54108137-54108159 CAAAGCATGGAAGAGGGGTGGGG + Intergenic
1096842902 12:54390263-54390285 GGAGGCAGGGTGGAGGGCAGGGG + Intronic
1097727761 12:63094224-63094246 GGAAGAAAGGGGGAGGGGTGGGG + Intergenic
1097905474 12:64914870-64914892 CTAACCAGGGGAGAGGGGTGAGG + Intergenic
1099620849 12:85001130-85001152 AGAGGCAGGGTGGAAGTGTGGGG + Intergenic
1099684437 12:85866625-85866647 CAAACTGGGGTGGAGGGGTGGGG - Intergenic
1100362098 12:93888626-93888648 CAAGGCAGGGTGGTGGGGTGTGG + Intronic
1100885802 12:99068678-99068700 GGATGCAGGTGGGAGGGGTGGGG + Intronic
1101587599 12:106098669-106098691 AAAAGGTGGGTGGAGGGGTGGGG - Intronic
1101752798 12:107596765-107596787 GGAAGGAAGGTGGAGGGGTAAGG - Intronic
1102225854 12:111227763-111227785 GGGAGCTGGTTGGAGGGGTGAGG - Intronic
1102598032 12:114007770-114007792 AGAAGCAGGGGGCTGGGGTGAGG - Intergenic
1103408907 12:120696561-120696583 CTGAACAGGGTGGAGGGGTGTGG + Exonic
1103739921 12:123084174-123084196 TGAAGCAGGGAGGAGGCCTGGGG - Intronic
1104595357 12:130116809-130116831 TGAAGCTGGGTGGGAGGGTGGGG + Intergenic
1104970205 12:132527595-132527617 CGGGGCAGGGTTGAGGGCTGCGG + Intronic
1104970215 12:132527623-132527645 CGGGGCAGGGTTGAGGGCTGCGG + Intronic
1104970252 12:132527727-132527749 CGGGGCAGGGTTGAGGGCTGTGG + Intronic
1106016259 13:25872046-25872068 CGAAAGAGGGCGGGGGGGTGAGG - Intronic
1106312765 13:28568210-28568232 GGAAGGAGGGAGCAGGGGTGGGG - Intergenic
1108500630 13:51066724-51066746 CCAGGCAGTGTGGAGGTGTGGGG + Intergenic
1109798480 13:67345451-67345473 CCAAGGAGGGTGTAGGGGTTAGG + Intergenic
1110061781 13:71049725-71049747 GGAAGCAGAGTGGAGTGGTTAGG - Intergenic
1112037096 13:95506869-95506891 CGATGCATGGGGGAGGGGTTTGG + Intronic
1113655623 13:112066721-112066743 CAAAGCAGGAAGGAGGGGGGAGG - Intergenic
1113709708 13:112455217-112455239 AGAAGCTGGATGGAGGGGAGTGG - Intergenic
1113777139 13:112954300-112954322 TGGAGCAGGGAGGAGGGGTGTGG - Intronic
1113947845 13:114054510-114054532 CGCTGCAGGGAGAAGGGGTGGGG - Intronic
1113990514 14:16024207-16024229 CGAAGGAGGGTGGAGCGGGGAGG + Intergenic
1114720490 14:24875996-24876018 CCAAACAGAGTGGAGGGGTGGGG + Intronic
1114784948 14:25585885-25585907 TGGAGCATGGTGGAGGGGAGGGG - Intergenic
1115962523 14:38851766-38851788 TGAAGCAGGGGGGTGGGGTGGGG - Intergenic
1116711850 14:48378220-48378242 TGAAGTAGGGAAGAGGGGTGGGG + Intergenic
1116836995 14:49778533-49778555 AGAGGCAGTGGGGAGGGGTGGGG + Intronic
1117162396 14:53002221-53002243 AGAAGGAGGGAGGAGGGGTGAGG - Intergenic
1118320240 14:64748616-64748638 AGAAGCAGAGAGGAGGGATGTGG + Exonic
1118427021 14:65676596-65676618 GGAAGAAGGAAGGAGGGGTGGGG - Intronic
1118896456 14:69949633-69949655 CGAAGCAGGGTGGGAGGGAATGG + Intronic
1120760098 14:88277095-88277117 CAAAGCAGTGTGTTGGGGTGTGG - Intronic
1120764456 14:88315998-88316020 TGAAGCAGAGTGGAATGGTGGGG - Intronic
1120801188 14:88690516-88690538 AGCAGCTGGGTGGAGTGGTGAGG + Intronic
1122885146 14:104707544-104707566 GGAACCAGGGAGCAGGGGTGGGG - Exonic
1202856883 14_GL000225v1_random:57639-57661 CCTGGGAGGGTGGAGGGGTGTGG - Intergenic
1123766750 15:23488001-23488023 GGAAGCATGGAAGAGGGGTGAGG + Intergenic
1124401123 15:29348443-29348465 GGGAGCAGTGTGGAGGCGTGTGG + Intronic
1125295983 15:38203677-38203699 AGGAGCAGGCTGCAGGGGTGTGG - Intergenic
1126901464 15:53318895-53318917 GGCAGCAGAGTGGAGAGGTGTGG + Intergenic
1128165957 15:65464879-65464901 TAAAGCTGGGTGGGGGGGTGAGG + Intronic
1128661849 15:69507089-69507111 CTAAGTGGGGTGGAGGGGTTTGG + Intergenic
1128774319 15:70308168-70308190 CCCAGCAGGGTGGAAGGGTATGG - Intergenic
1128789055 15:70419315-70419337 AGAAGCAGAGAGGAGGGGAGAGG + Intergenic
1129656532 15:77528540-77528562 CGAGGCAGTGTGCTGGGGTGCGG + Intergenic
1129710411 15:77817997-77818019 GGATGCTGTGTGGAGGGGTGTGG - Intronic
1131067759 15:89444767-89444789 GAAAGTAGGGTGGAGGGGGGAGG - Intergenic
1131094318 15:89646200-89646222 CAAAGCAGGCGGGAGGGGAGGGG - Intronic
1131304900 15:91233790-91233812 CAAAGAGGGGTGGAGGGGTTGGG - Intronic
1131354493 15:91732813-91732835 CTAACCAGCGTGGAGGGTTGAGG + Intergenic
1131546179 15:93317339-93317361 GGAAGCTGGGTGGAAGGCTGTGG + Intergenic
1131597470 15:93813054-93813076 AGAAGCAGAGTGGAGTCGTGGGG - Intergenic
1132071286 15:98778573-98778595 GGGAGCAGGGTTGAGGAGTGGGG + Intronic
1132481293 16:167487-167509 TGGGGCTGGGTGGAGGGGTGGGG - Intergenic
1132491577 16:234735-234757 CGAAGCATGGCGGTGGGGCGGGG + Exonic
1132757755 16:1494138-1494160 GGGACCAGGGTTGAGGGGTGTGG + Intronic
1132815233 16:1822698-1822720 CCAAGAAGGGTGGAGGCGAGAGG - Intronic
1133002396 16:2857971-2857993 GGAAGGAGGGTGGAGGTGAGAGG + Intronic
1133285394 16:4688384-4688406 CAACCCAGGGTGCAGGGGTGGGG - Intronic
1134100038 16:11445664-11445686 CGAAGCAGGGCTGAGGGGACAGG + Intronic
1135403451 16:22181801-22181823 GGAAGCAGGTAGGTGGGGTGTGG + Intronic
1135952796 16:26930972-26930994 GGCAGCCGGGTGGAGGGGGGTGG - Intergenic
1136007452 16:27340776-27340798 GGAAGCTGGGTGGAGTGGGGGGG + Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136546590 16:30958219-30958241 CGAATCCGGGCGGGGGGGTGGGG - Intronic
1136909661 16:34135287-34135309 CGAGGGAGGGTGGAGAGGGGAGG + Intergenic
1137670662 16:50276335-50276357 CATGGCAGGGTTGAGGGGTGGGG + Intronic
1138093714 16:54195997-54196019 GGAGGCAGGATGGAGGGGAGAGG + Intergenic
1139701555 16:68710965-68710987 GGAAGGAGGGGGGAGGGGGGAGG + Intronic
1139706869 16:68746972-68746994 CAAAGTGGGGTGGATGGGTGTGG + Intronic
1139956779 16:70697012-70697034 TGAGGCTGAGTGGAGGGGTGGGG + Intronic
1140123845 16:72104683-72104705 CGAAGCCGGCTGGAGGGTGGAGG + Intronic
1140253726 16:73317267-73317289 AGAAGCCGGGGGGTGGGGTGGGG + Intergenic
1140428897 16:74884749-74884771 CGAAGGAAGGTGGCGTGGTGTGG - Intronic
1141680464 16:85540991-85541013 CCAAGCAGGGTGGTGTGGCGGGG + Intergenic
1141765889 16:86059875-86059897 TGAAGCTGGGTGGAGGTGAGGGG + Intergenic
1142008251 16:87700610-87700632 GGAAACAGGGTGGAGGGAGGAGG + Intronic
1142141909 16:88476294-88476316 GGAAACAGGCTGGTGGGGTGTGG - Intronic
1142157483 16:88539256-88539278 AGAAGGAGGGTGGAGGCGGGAGG - Intergenic
1142221017 16:88855010-88855032 CCGTGCAGGGTGGAGGGGTGGGG - Intronic
1142378700 16:89720293-89720315 AAAAGCAGGCCGGAGGGGTGTGG - Intronic
1142624125 17:1181157-1181179 CGCAGAACGCTGGAGGGGTGTGG + Intronic
1142666356 17:1465989-1466011 CGATGCAGGCAGGAGTGGTGGGG + Intronic
1142982454 17:3679974-3679996 GGAAGCAGGGTGGAGGACTCAGG - Intronic
1143022657 17:3924851-3924873 GGAAGCAGAGTGGAGTGGAGGGG + Intronic
1143617782 17:8064088-8064110 CGAGGCAGCGTGGCGGGGGGCGG - Intergenic
1143632773 17:8148309-8148331 CCAGGCAGAGTGGAGGGCTGAGG - Intronic
1143659061 17:8313567-8313589 AGAACCAGGGAGTAGGGGTGGGG - Intronic
1143699999 17:8651340-8651362 TGAAGCTGGGTGGAGGAGTATGG - Intergenic
1144566602 17:16364517-16364539 AGAAGCAGGGTGGAGGTCAGTGG + Intergenic
1144579500 17:16450430-16450452 GGAAGCTGGGGGCAGGGGTGGGG - Intronic
1144851559 17:18246547-18246569 CGAGGCCAGGCGGAGGGGTGTGG - Intronic
1145388333 17:22435319-22435341 CGAGGCAGGGAGGAGGGGAGGGG - Intergenic
1145846300 17:28041872-28041894 GGAAGCCGGGTGGGGGGGAGGGG + Intronic
1145936594 17:28717954-28717976 CGCAGAAGGGTGGAGAGGAGGGG - Intronic
1145987602 17:29057638-29057660 CCAGGGTGGGTGGAGGGGTGAGG + Intergenic
1146589143 17:34113213-34113235 CGAAGGAAGCTGGAGGAGTGGGG + Intronic
1146834576 17:36099979-36100001 ATGAGCAGGGTGGAGGGGTTAGG - Intergenic
1146849185 17:36207164-36207186 ATGAGCAGGGTGGAGGGGTTAGG - Intronic
1147185368 17:38710524-38710546 AGAAGGGGGATGGAGGGGTGAGG + Intronic
1147341764 17:39756537-39756559 AGAAGGAGGGTGCAGGTGTGGGG + Intergenic
1147935465 17:44008099-44008121 CAGAGCAGGGTGTAGGGGTGAGG - Intronic
1148236753 17:45974283-45974305 CAATGCAGGGAGGAGGAGTGAGG - Intronic
1148465021 17:47859813-47859835 CCAAGCAGGGTGACAGGGTGGGG - Intergenic
1148491868 17:48028517-48028539 GGAAGCAGAGTCAAGGGGTGGGG + Intronic
1148749365 17:49935697-49935719 CGGGGCCGGGTGGAGGCGTGGGG + Intergenic
1148783719 17:50135194-50135216 GGAGGTGGGGTGGAGGGGTGGGG + Exonic
1150734561 17:67725423-67725445 CCATGAAGGGTGGAGGGGAGAGG - Intronic
1150862762 17:68818145-68818167 CTAAGCAGAGTGGAGTGGAGAGG - Intergenic
1151229563 17:72674133-72674155 GGAAGGAGGGAGTAGGGGTGGGG - Intronic
1151333838 17:73428427-73428449 CAAAGCCAGGTGCAGGGGTGAGG - Intronic
1151396461 17:73826380-73826402 CTGAGCAGGGTGGATGGATGTGG + Intergenic
1152337242 17:79705910-79705932 AGACGCAGGGTGGGGGCGTGGGG - Intergenic
1152353096 17:79794199-79794221 GGGAGAAGGGAGGAGGGGTGAGG + Exonic
1152884346 17:82840640-82840662 CGGAGCAGGGTGTGTGGGTGCGG + Intronic
1152896476 17:82914243-82914265 TGAAGGATGGTGGAGGGCTGTGG + Intronic
1153979589 18:10297659-10297681 AGAAGCAGGAAGGAGGGATGGGG - Intergenic
1154045514 18:10901128-10901150 CGAAGGATGGTGGTGGGCTGAGG + Intronic
1154210723 18:12376927-12376949 CGAGGCAGGGTGGAGGGCGCCGG + Intronic
1155218719 18:23665508-23665530 GGAATCAGGGTTGAGGGATGTGG - Intergenic
1155229279 18:23757352-23757374 CCAAGCAGGCTGGAGGCCTGAGG - Intronic
1155853072 18:30796738-30796760 TGTGGCAGTGTGGAGGGGTGGGG - Intergenic
1156337886 18:36186612-36186634 CGGAGCGGGATGCAGGGGTGGGG - Intergenic
1156723887 18:40104105-40104127 TGAAGCAGGGTTGAGAGGTCAGG + Intergenic
1157091166 18:44638660-44638682 CCAAGCAGGGGGGTGGGGGGGGG + Intergenic
1157521443 18:48348159-48348181 ACCTGCAGGGTGGAGGGGTGGGG + Intronic
1157576392 18:48746642-48746664 CATAGCAGGATGGAGGGGAGAGG + Intronic
1158851026 18:61496004-61496026 AGAGGAAGGGTGGAGGGGAGAGG - Intronic
1159130024 18:64270841-64270863 AGAAGTGGGGTGGAAGGGTGAGG + Intergenic
1159652028 18:70988770-70988792 AGAAGCATGGTGGGGGGCTGGGG - Intergenic
1159881764 18:73864954-73864976 CGAAGGTGGGTGGATGGGTTTGG - Intergenic
1160521602 18:79511304-79511326 GGAAGCAGCGGGGAGGGGGGAGG - Intronic
1160921532 19:1523185-1523207 CCAGGCTGGGTGGAAGGGTGAGG + Intergenic
1161350046 19:3786301-3786323 CGAAGAAGGGTCGGGGAGTGGGG + Intronic
1161453589 19:4359699-4359721 CGGTGCTGTGTGGAGGGGTGGGG - Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162566020 19:11446234-11446256 AGAAGCAGACTGGAGGGGTGAGG - Intronic
1162803333 19:13123140-13123162 CAAAGGAGGGTGGAGGGATGGGG - Intronic
1162930613 19:13955767-13955789 TCAGGCAAGGTGGAGGGGTGTGG + Intronic
1163096679 19:15063208-15063230 TGAAGGAGGGGGGAGGGGAGAGG - Intergenic
1163099519 19:15085993-15086015 GGAAGGAGGGTTGAGGGGGGAGG + Intergenic
1163247047 19:16102835-16102857 AGGAGTAGGGTGGTGGGGTGGGG - Intronic
1164441819 19:28284875-28284897 AGAAGGAGGGTGGAGGGAAGGGG + Intergenic
1164527170 19:29020975-29020997 CAAAGCGGAGTGGAGGCGTGGGG + Intergenic
1164936636 19:32220022-32220044 CGGTGCAGAGTGCAGGGGTGTGG - Intergenic
1165093081 19:33396699-33396721 CCAGGGAGGGTGGGGGGGTGAGG + Intronic
1165256658 19:34580413-34580435 AGACCCACGGTGGAGGGGTGGGG + Intergenic
1165331863 19:35144631-35144653 CGAAGCAGGGCGGGGGGTGGGGG + Intronic
1165987762 19:39785675-39785697 CTAAGGAGGGAGGAGGGGGGAGG - Intronic
1166109551 19:40613835-40613857 CGAGGGGCGGTGGAGGGGTGTGG + Intronic
1166305262 19:41933975-41933997 AGAGGCAGAGTGGAGGGGTGGGG + Intergenic
1166316087 19:41991116-41991138 CGAGGCTGGTGGGAGGGGTGGGG + Intronic
1166376267 19:42328949-42328971 AGAAGGAAAGTGGAGGGGTGGGG + Intronic
1166377220 19:42334314-42334336 CGGAGGAGGGTGGGGTGGTGGGG - Intronic
1166807568 19:45496583-45496605 CGAAACAGGGCGGAGGTGAGGGG - Intronic
1166810126 19:45509379-45509401 CGAGGGGGGGTGGAGGGGCGGGG - Intronic
1167574804 19:50312889-50312911 TGAAGCAGGGGTGAGGGGTGGGG - Intronic
1167674767 19:50877406-50877428 TGGGGCAGGGAGGAGGGGTGGGG + Intronic
1167800206 19:51735808-51735830 CCAGGGAGGGTGAAGGGGTGGGG - Intergenic
1168056451 19:53867661-53867683 GTGAGCAGGGTGGAGGGCTGAGG - Intronic
1168267510 19:55230740-55230762 GGCAGCAGGGCGGGGGGGTGGGG - Intronic
1168459070 19:56538827-56538849 CGGGGCAGCGGGGAGGGGTGGGG + Intergenic
925333444 2:3076112-3076134 CCAAGATGGGTGGATGGGTGGGG + Intergenic
925587021 2:5474782-5474804 CGAGGCAGGTGGGTGGGGTGAGG - Intergenic
925944594 2:8849366-8849388 CCAGCCAGGGAGGAGGGGTGGGG + Intergenic
926136275 2:10338832-10338854 AGAAGCATGGTGCAGTGGTGGGG + Intronic
926226846 2:10972932-10972954 GGAAGCGGGGTGGAGGGGGAGGG + Intergenic
926707091 2:15844612-15844634 CGAAGCTGGGTGGGGTGGGGCGG - Intergenic
926726871 2:16005309-16005331 AGAGGGAGGGGGGAGGGGTGGGG - Intergenic
926726925 2:16005665-16005687 AGAAGGAGGGTGGCTGGGTGCGG - Intergenic
927009782 2:18891143-18891165 CAGAGTAGGGTGGAGGGGAGTGG + Intergenic
927440620 2:23113981-23114003 CCAAGTATGGTGGAGAGGTGTGG - Intergenic
927484058 2:23476997-23477019 TGAAGCAGGCTGGAGGGCAGAGG + Intronic
927513451 2:23658558-23658580 CGAAGCAGTCTGGAGGGGAAGGG + Intronic
927892807 2:26763025-26763047 CAAAGCCGGGAGGAGGGGAGAGG - Intergenic
929211879 2:39366259-39366281 TGAAGCAGGGTGGTGGGGTGGGG + Intronic
930702603 2:54474045-54474067 GGCAGCAGGGTGGACAGGTGAGG + Intronic
931677355 2:64710746-64710768 TGAAGCAGAGGGGAGAGGTGTGG + Intronic
931763517 2:65435933-65435955 CGAGCCAGGCGGGAGGGGTGGGG - Intergenic
932140575 2:69273687-69273709 TGAGGAGGGGTGGAGGGGTGTGG - Intergenic
932491466 2:72125486-72125508 CTGAGGAGAGTGGAGGGGTGGGG + Intergenic
933810187 2:86028230-86028252 GGAAGCAGGATGCAGGGGTCAGG - Intronic
933840771 2:86284137-86284159 GGAGGCAGTGTGGAGGAGTGTGG - Intronic
933842492 2:86298645-86298667 GGATGCAGGGTGGAGGGTAGAGG - Intronic
933988282 2:87612298-87612320 CTAAGCTGGGGGTAGGGGTGAGG + Intergenic
934174138 2:89564315-89564337 GGGAGCAGGGTAGAGGGGAGGGG - Intergenic
934284454 2:91638664-91638686 GGGAGCAGGGTAGAGGGGAGGGG - Intergenic
934579616 2:95427716-95427738 AGGAGTAGGGAGGAGGGGTGGGG - Intergenic
934599829 2:95649009-95649031 AGGAGTAGGGAGGAGGGGTGGGG + Intergenic
935178585 2:100670725-100670747 AGGAGGAGGGTGGAGAGGTGGGG - Intergenic
936287336 2:111190897-111190919 CAAAGCTGGGTGGATGGGTGGGG + Intergenic
936305558 2:111338510-111338532 CTAAGCTGGGGGTAGGGGTGAGG - Intergenic
936533174 2:113291014-113291036 AGGAGTAGGGAGGAGGGGTGGGG + Intergenic
936993130 2:118387023-118387045 CGAAGCATGAGGGTGGGGTGGGG - Intergenic
937120392 2:119436792-119436814 CGGAGCAGGATGGAGGGCTCAGG + Intronic
937377324 2:121346285-121346307 AGAGGCATGGTGAAGGGGTGAGG - Intronic
937922248 2:127138609-127138631 GGAACCAGGGAGGAGGGATGGGG - Intergenic
937967465 2:127525085-127525107 CGAAGTAGGGGGGTGGGGTAGGG + Intronic
938966347 2:136392064-136392086 GGAAGCAGGGAGGAGGGGATAGG - Intergenic
939012817 2:136866508-136866530 TGAAAAAAGGTGGAGGGGTGTGG + Intronic
939515187 2:143157840-143157862 AGAAGTTGGGTGGTGGGGTGAGG + Intronic
939986236 2:148832165-148832187 AGAAGCAGAGTGTAGGGGTCAGG + Intergenic
942277328 2:174332865-174332887 GGACGCTGGGTGGAGGGCTGAGG - Intergenic
943484211 2:188458834-188458856 GGAAGCAGAGTGTAGGGATGGGG - Intronic
943927147 2:193799651-193799673 CTATGCAGGGAGGAGGGGTCTGG - Intergenic
943953662 2:194160062-194160084 CTAAGGAGGGTGTAGGGGTTAGG + Intergenic
945039828 2:205734397-205734419 CGATGCGGGGTGGGGGGGGGCGG - Intronic
945944396 2:215980833-215980855 AGAAGCAGAGAGGAGGGGAGGGG + Intronic
946128838 2:217589036-217589058 CGAAGAAGGCAGGAGGGGAGAGG - Intronic
946455363 2:219821134-219821156 CAAAGCAGGGTTGAGGGGGCAGG + Intergenic
946717971 2:222573111-222573133 AGAATCAGGTTGGAGGGGAGGGG + Intronic
947073674 2:226318773-226318795 TGAAGCATGGTGGAGTGGCGAGG + Intergenic
947596709 2:231417307-231417329 CGAACCAGGCTGGAGGGCAGTGG + Intergenic
948289446 2:236814204-236814226 TGAGGCTGGGTGGAGGAGTGGGG + Intergenic
948584135 2:239008189-239008211 CGCTGCAGGGTGGCTGGGTGTGG - Intergenic
948720803 2:239898938-239898960 CGGAGGGGTGTGGAGGGGTGTGG + Intronic
948720835 2:239899075-239899097 TGGAGGAGTGTGGAGGGGTGTGG + Intronic
1169120590 20:3093319-3093341 CGCCCCAGGTTGGAGGGGTGAGG - Intergenic
1169219767 20:3815185-3815207 AAAAGCAGGGTTGGGGGGTGTGG + Intergenic
1169249172 20:4046883-4046905 TGAAGGATGGTGGAGGGGGGTGG + Intergenic
1169254580 20:4087100-4087122 TGTAGCAGGGTTGAGAGGTGGGG - Intergenic
1169530776 20:6482609-6482631 TGAAGTGGGGTGGAGGGGAGTGG - Intergenic
1170783835 20:19450443-19450465 GGAGGGAGGTTGGAGGGGTGTGG + Intronic
1170791232 20:19511152-19511174 GGGAGCAGGGTGGAGAGATGAGG - Intronic
1171771372 20:29325472-29325494 CGAGGGAGGGTGGAGCGGGGAGG - Intergenic
1171795823 20:29566219-29566241 CAAAGCATGGAAGAGGGGTGGGG - Intergenic
1171905138 20:30894009-30894031 CGAGGGAGGGTGGAGCGGGGAGG + Intergenic
1172053652 20:32139049-32139071 CAAAACAGGGTGGAGGGGTGAGG + Intronic
1172315528 20:33951290-33951312 TGATCCAGGGTGGAGGGTTGAGG - Intergenic
1172573982 20:35992749-35992771 CCAACCAGGGTCGGGGGGTGGGG - Intronic
1172776932 20:37413413-37413435 CGCAGGAGGGTGCAGGGGGGCGG - Intergenic
1172948039 20:38703627-38703649 TGCAGCAGGGTGGTGGAGTGAGG - Intergenic
1173258317 20:41410939-41410961 GGAGGCAGCGTGAAGGGGTGAGG + Intronic
1173448951 20:43145049-43145071 AGAAGCAGAGGGTAGGGGTGAGG - Intronic
1173591549 20:44228847-44228869 CCATGCCGGGTGGGGGGGTGGGG - Intergenic
1173782944 20:45771675-45771697 AGAAGCAGGGTGGAGAAGGGAGG + Intronic
1173822654 20:46029277-46029299 CGAAGGCGGGTAGAGGGGCGCGG + Intronic
1174026475 20:47580620-47580642 CGAAGGAGGGTCATGGGGTGGGG - Intronic
1174061236 20:47834403-47834425 AGACTCAGGGAGGAGGGGTGCGG - Intergenic
1174070540 20:47896296-47896318 AGACTCAGGGAGGAGGGGTGCGG + Intergenic
1174100573 20:48123526-48123548 AGACTCAGGGAGGAGGGGTGCGG - Intergenic
1174286662 20:49478942-49478964 CCAAGCTGGGGGGATGGGTGGGG + Intronic
1174317714 20:49715212-49715234 AGAAGCAGTGGGGAGGGGAGAGG + Intergenic
1175284198 20:57826903-57826925 GGAAGCAGAATGGAGAGGTGAGG - Intergenic
1175412625 20:58780837-58780859 GGAGGCGGGGTGGAGGGGAGAGG + Intergenic
1175461573 20:59155625-59155647 CGCAGCAGGGAGGAGTGCTGGGG + Intergenic
1175890405 20:62313444-62313466 CGAAGCAGGGGAGGGGGCTGTGG + Exonic
1175902194 20:62364372-62364394 GGAAGCTGGGTGGAAGGTTGCGG + Intronic
1176296294 21:5075262-5075284 AGGAGCAGGGAGGAGGGATGAGG - Intergenic
1176725634 21:10430224-10430246 AGAGGCAGGGAGGAGGGGAGGGG - Intergenic
1176865262 21:14047184-14047206 CGGAGCAGAGTGGAGTGGAGTGG + Intergenic
1178481142 21:32979943-32979965 CTAAGAAGGAGGGAGGGGTGAGG + Intergenic
1178806894 21:35846811-35846833 CCAGGCAGGGGGCAGGGGTGGGG - Intronic
1179022891 21:37656175-37656197 CTCAGCAGGGAGAAGGGGTGTGG - Intronic
1179731124 21:43367930-43367952 GGATGCAGGGTGGTGGTGTGAGG - Intergenic
1179795315 21:43779014-43779036 TGAAGCAGGGTGGAGTCATGGGG + Intergenic
1179860755 21:44186859-44186881 AGGAGCAGGGAGGAGGGATGAGG + Intergenic
1180160251 21:45995981-45996003 CTGGGCAGGGTGGAGGGGAGGGG - Intronic
1180216339 21:46325378-46325400 CCCAGGAGGGTGGAGGGGGGAGG + Intronic
1180338565 22:11600189-11600211 CGAGGGAGGGTGGAGCGGGGAGG + Intergenic
1180608626 22:17081090-17081112 AGAATCAGTGTGGAAGGGTGTGG + Intergenic
1180651330 22:17379408-17379430 TGCCGCAGGGAGGAGGGGTGAGG + Intronic
1180920686 22:19520074-19520096 CCAAGCAGGCTGCAGGGGAGGGG - Intronic
1180923814 22:19538262-19538284 AGAGGGAGGGTGGAGGGGGGAGG + Intergenic
1181045664 22:20213149-20213171 CAAAGCAGGGGTGAGGGCTGGGG - Intergenic
1181442495 22:22943925-22943947 CCAAGAAGAGAGGAGGGGTGAGG + Intergenic
1181490007 22:23255774-23255796 AGAAGCAGGGAGCAGGGGTCGGG - Intronic
1181527881 22:23500493-23500515 AGAAGGAAGGTGGAGGGGAGAGG + Intergenic
1181603595 22:23966832-23966854 CGGACCAGGGAGGAGGGGCGAGG - Intergenic
1181604918 22:23974475-23974497 CGGACCAGGGAGGAGGGGCGAGG + Exonic
1181681788 22:24500427-24500449 AGATGCAGGCTGGAGGGATGTGG - Intronic
1182347608 22:29677616-29677638 CCATGCAGTGTGGAGAGGTGGGG - Intronic
1182422333 22:30254561-30254583 GGAAACAGGGTCCAGGGGTGGGG - Intergenic
1183228291 22:36564892-36564914 GGGCGCAGGGTGGCGGGGTGGGG + Intronic
1183278033 22:36913694-36913716 AGGAGCAGGGCTGAGGGGTGGGG + Intronic
1183306727 22:37086726-37086748 TGTAGCAGGGTGGAGGGGTCTGG - Intronic
1184095649 22:42314873-42314895 CGACCCAGGGAGGAGGGGAGCGG + Intronic
1184388978 22:44192316-44192338 CAAAGCAGGGTGGCTGGGAGGGG - Intronic
1184694117 22:46130386-46130408 TGAAGCAGGGCTGTGGGGTGAGG + Intergenic
1185011418 22:48316715-48316737 CTCAGCAGAGTGGAGGGCTGTGG - Intergenic
1185037360 22:48486475-48486497 GGAGGCAGGGGGGAGGTGTGGGG - Intergenic
1185120318 22:48962403-48962425 AGCAGCAGGGTGGATGGGGGAGG + Intergenic
1185228474 22:49667423-49667445 GGAGCCGGGGTGGAGGGGTGTGG - Intergenic
1185265773 22:49903343-49903365 GGCACCAGGGTGGGGGGGTGCGG + Exonic
1203310883 22_KI270736v1_random:141895-141917 TGGAGCAGAGTGGAGGGGAGTGG + Intergenic
1203314086 22_KI270736v1_random:170977-170999 TGAAGCAGAGTGGAGTGGAGAGG + Intergenic
949555149 3:5146275-5146297 CTAAGGAGGGTGTAGGGGTTGGG + Intronic
949576095 3:5340463-5340485 GGAAGCGGGGTGTAGGGGTGAGG - Intergenic
950159435 3:10748811-10748833 GGAAAAAGGGTGGAGAGGTGAGG - Intergenic
950256756 3:11512226-11512248 CGAAGGAGGGGAGAGGGGTGTGG - Intronic
950404667 3:12797084-12797106 CGAGGCAGGGTGCAGAGGGGTGG - Intronic
950456348 3:13095051-13095073 AGAAGCAAGGTGGAGAGGAGGGG - Intergenic
950539252 3:13600167-13600189 AGAATCAGGGTGGAGGGCGGGGG + Intronic
950708477 3:14798458-14798480 CGACGCAGGGTGGTGAGCTGGGG + Intergenic
952416102 3:33092774-33092796 TGAAGCAGGATGGAGGGTCGAGG + Exonic
953357355 3:42266225-42266247 CGAGGCGGGGTGGGGGGGTTGGG + Intergenic
953663811 3:44910928-44910950 AGAGTCAGGGTGGAGGGGAGAGG - Intronic
953880887 3:46690816-46690838 CGGGGCAGGGTGGAGAGGGGAGG - Intronic
954380347 3:50215857-50215879 CGGTGCAGTGAGGAGGGGTGGGG + Intronic
955032178 3:55232212-55232234 CAAAGCAGGGAGGAGGCCTGGGG + Intergenic
955758269 3:62249391-62249413 TGGAGCAGGGTGGAGGGAAGGGG + Intronic
956083745 3:65587841-65587863 CGAAGAAGGGAGGGAGGGTGTGG - Intronic
958467281 3:94473368-94473390 CCAAGAAGGGTTGAGGGCTGTGG - Intergenic
959296812 3:104545809-104545831 AGAAGCAGGGTGGAGTGGGGAGG - Intergenic
959510564 3:107206891-107206913 CAAGGCTGGGTGGAGGGTTGAGG - Intergenic
960867604 3:122217922-122217944 CTAAGCAGAGTGAGGGGGTGTGG + Intronic
960939566 3:122924631-122924653 GGAAGGAGGGTGAAGGGGTAGGG - Intronic
961261065 3:125602293-125602315 GGTAGCAGGGAGCAGGGGTGCGG + Intergenic
962531166 3:136281932-136281954 CCCAGAAGTGTGGAGGGGTGTGG + Intronic
964477487 3:157109923-157109945 AGAATCAGGGAGGAAGGGTGGGG + Intergenic
964618911 3:158700886-158700908 GGAAGCAGGGTGGAGGGGCATGG - Intronic
965365050 3:167787738-167787760 TGCAGGAGGGTGAAGGGGTGAGG + Intronic
965653270 3:170955736-170955758 TGGAGGAGGGTGGTGGGGTGAGG - Intergenic
966940985 3:184746913-184746935 CCAAGCAGGGAGGCCGGGTGAGG - Intergenic
967020403 3:185517399-185517421 AGTAGCAGGGTGGAGAGGTGTGG + Intronic
967315634 3:188149887-188149909 AGAAGGAGGGTGGAGGGTGGGGG + Intergenic
967891899 3:194369621-194369643 CTAAGCAGAGAGGAGGGATGGGG + Intronic
968011320 3:195280066-195280088 GGAAGCTGGGTGGGGGGGTTGGG + Intronic
968531385 4:1093785-1093807 TGGAGCAGGGTGAGGGGGTGAGG + Intronic
968582685 4:1402322-1402344 CGGAGCAGGCTGCAGGGGTGGGG + Intergenic
969027296 4:4183709-4183731 CGAGGCAGGGTGGAAGGGCACGG - Intergenic
969362671 4:6674482-6674504 CGAAGCAGAGAGGAAGGCTGCGG + Intergenic
970191605 4:13523717-13523739 GGAAGTGGGGTGGGGGGGTGCGG + Intergenic
970639799 4:18051482-18051504 TTGGGCAGGGTGGAGGGGTGGGG - Intergenic
972149889 4:36076604-36076626 GGAAGCATGGAGGAGGGTTGGGG - Intronic
972292310 4:37700757-37700779 AGGAGAAGTGTGGAGGGGTGAGG - Intergenic
972807303 4:42542589-42542611 CGTTGCAGGGTGGGGGGCTGAGG - Intronic
973642103 4:52913645-52913667 CGGTGCAGGGTGGGGCGGTGTGG - Intronic
974366388 4:60955135-60955157 TGCAAGAGGGTGGAGGGGTGTGG + Intergenic
975481007 4:74880314-74880336 CAAAGAATGGTGAAGGGGTGAGG + Intergenic
975541179 4:75514002-75514024 CGAAGCAGGTAGGAAAGGTGGGG + Intronic
975684239 4:76903880-76903902 TGAAGCATGGTGGAGGGGAGAGG + Intergenic
976009625 4:80471606-80471628 GGGAGCAGGGTGGCGGGGGGTGG + Intronic
976405827 4:84659582-84659604 CTAGGCAGGGTTGAGGGGTGGGG + Intergenic
978262041 4:106771514-106771536 TGAAGGGTGGTGGAGGGGTGAGG + Intergenic
978885806 4:113764699-113764721 AGGAGCAGGGTAGAGGGCTGTGG + Intergenic
980705587 4:136488811-136488833 CAAAGCAGGGTGGAGGAGAATGG + Intergenic
981584284 4:146284465-146284487 GGAAGCAGGGTGGGGTGATGGGG - Intronic
982166492 4:152618101-152618123 AGAAGCAGGGTGGGAGGATGTGG - Intergenic
983077782 4:163345928-163345950 GGAGGCAGGGAGGGGGGGTGGGG - Intronic
983256173 4:165403422-165403444 GGAAGCAGTGTGGAGTGGTATGG + Intronic
984873829 4:184350049-184350071 AGAAGCAGGGGGAAAGGGTGAGG + Intergenic
985578269 5:683715-683737 GGAAACAGGTTGGAGGGGTGGGG + Intronic
985593196 5:775855-775877 GGAAACAGGTTGGAGGGGTGGGG + Intergenic
985672369 5:1213313-1213335 CGAGGCATGCTGGAAGGGTGGGG - Intronic
985788299 5:1911384-1911406 GGAGGCAGGGTGGTGGGGAGAGG - Intergenic
985809939 5:2075504-2075526 TGGAGCAGGGTGGAGGGGACGGG + Intergenic
986224677 5:5801607-5801629 CCAAGGAGGGTGTAGTGGTGAGG + Intergenic
986433588 5:7705600-7705622 AGATGCAGGGCAGAGGGGTGGGG + Intronic
986516993 5:8574590-8574612 GGAGTCAGGGAGGAGGGGTGGGG + Intergenic
986884378 5:12215748-12215770 TGAAGCAGGGTGGGGAGTTGGGG + Intergenic
987308595 5:16661241-16661263 GGATGCAAGGTGGAGGGGTGTGG - Intergenic
988215586 5:28268156-28268178 CCAAGCAGGAGGAAGGGGTGAGG - Intergenic
989463215 5:41725219-41725241 AGGAGAAGGGTGGAGGTGTGGGG - Intergenic
989600044 5:43192446-43192468 AGAGGAAGGGTGGCGGGGTGGGG - Intronic
990881046 5:60539821-60539843 TGAGGCAGGGTGGAGGAGAGAGG - Intergenic
991168690 5:63594451-63594473 CAAAGCAGTATGGAGAGGTGGGG + Intergenic
991261842 5:64676466-64676488 AGATGCAGGGTGGTGGGGGGGGG + Intergenic
994141013 5:96341340-96341362 CCAAGCAGGGTGGAGGGGTGGGG - Intergenic
995526820 5:113056930-113056952 TGAAGCAGGGAAGAGGCGTGGGG + Intronic
996237489 5:121149726-121149748 CGAAGAAGGGTAGAGTTGTGAGG - Intergenic
997518232 5:134505866-134505888 GGAAGCTGGGTGCAGGGCTGAGG + Intergenic
997711058 5:136005359-136005381 TGAGGAGGGGTGGAGGGGTGGGG - Intergenic
998199399 5:140107722-140107744 CGGAGTTGGGAGGAGGGGTGGGG + Intergenic
998377545 5:141701385-141701407 TGAGCCAGGGTGGAGGGGTATGG - Intergenic
999147351 5:149405285-149405307 TGAGGGAGGGTGGAGGGGTAAGG + Intergenic
999285007 5:150389453-150389475 TGTTTCAGGGTGGAGGGGTGAGG + Intronic
999636575 5:153629219-153629241 CAAAGCAGGGAGGAAGGGGGAGG - Intronic
999948838 5:156626784-156626806 AAAAGCAGGGTGGGGGGGAGTGG - Intronic
1000346711 5:160320562-160320584 GGAAGCAGTGTGGAGCGATGAGG + Intronic
1000755031 5:165147660-165147682 CAATGCAGAGTGGAGTGGTGGGG - Intergenic
1000918458 5:167110087-167110109 CAAGGCAGGGTGCAGGGGTGGGG + Intergenic
1001113363 5:168917578-168917600 AGAAGCAGGGGGAAGGGCTGTGG - Intronic
1001707712 5:173753735-173753757 GGGAGCAGGGTAGAGGCGTGGGG + Intergenic
1002051205 5:176572599-176572621 CGCAGCAAGGGGGAGGAGTGGGG + Intronic
1002180401 5:177428206-177428228 CCAGCCAGGGAGGAGGGGTGGGG + Intronic
1002564020 5:180100034-180100056 GCAAGCAGTGTGGAGAGGTGGGG - Intergenic
1002931274 6:1636840-1636862 GGCAGCAGGGAGGAGAGGTGAGG + Intronic
1003060410 6:2858275-2858297 AGAAACAGGGTGGAAGGGGGAGG - Intergenic
1003092830 6:3118620-3118642 CGGAGCAGGATGGAGAGGCGAGG + Intronic
1003313690 6:4991920-4991942 CAGAGCAGGAGGGAGGGGTGTGG - Intergenic
1003533780 6:6958554-6958576 CGGAGCAGGCTGGAGGACTGGGG - Intergenic
1003615231 6:7649088-7649110 TCAAGCAGGATGCAGGGGTGTGG - Intergenic
1005048715 6:21665320-21665342 GGGATCAGGGTCGAGGGGTGGGG + Intergenic
1005521210 6:26602145-26602167 CGAAGGCGGGCGGAGGGGAGAGG + Intergenic
1005996862 6:30936805-30936827 AGAATCAGGGTGGAGTGGTGGGG + Intergenic
1006132943 6:31879659-31879681 GGAAGCAGGCTGGACAGGTGTGG - Intergenic
1006374421 6:33663959-33663981 CGCAGGAGGGCGGAGGAGTGGGG - Intronic
1006672827 6:35740273-35740295 GAAAGCAGGGAGGATGGGTGTGG - Intronic
1006677583 6:35775589-35775611 AGAAGCAGGCAGGTGGGGTGAGG + Intergenic
1006903487 6:37517675-37517697 GGCAGCAGGATGGAGGGGAGGGG + Intergenic
1007137938 6:39540916-39540938 TGAAGTAGGGTAGAGGGGAGTGG - Intronic
1007219681 6:40268667-40268689 CAAAGCAGAGTAGAGGGGTGAGG - Intergenic
1007390838 6:41548676-41548698 CGCAGCAGGGGGAGGGGGTGGGG - Intronic
1007622258 6:43222425-43222447 AGAAGCAGGTTGGGGTGGTGGGG + Intronic
1007967456 6:46015743-46015765 CGAAGCCGGGAGGAGGCGGGGGG + Intronic
1008538992 6:52530006-52530028 CCGAGCAGGGTGGATGGTTGTGG + Intronic
1010933831 6:81836299-81836321 TGAAGTAGGGTGGACAGGTGGGG + Intergenic
1012465203 6:99509831-99509853 TGAGGCAGGGAGGTGGGGTGGGG + Intronic
1013170081 6:107628962-107628984 CAAAGGAGGATGGAGGGATGTGG - Intronic
1013263289 6:108468646-108468668 TGAGGTGGGGTGGAGGGGTGGGG - Intronic
1013423312 6:109986531-109986553 CTAAGCAGGGCAGAGGGCTGGGG + Intergenic
1013448129 6:110251836-110251858 TGAAGCAGTATGAAGGGGTGTGG - Intronic
1013498193 6:110719980-110720002 CGAAGCAGGGGGGGGGTGGGGGG - Intronic
1014173309 6:118303535-118303557 CTAAGGAAGGTGGAGGTGTGAGG - Intronic
1014203618 6:118630969-118630991 CGGACCAGGGTGGAGTGGGGTGG - Intronic
1014283320 6:119465950-119465972 CGAAGCAGTGAGGAGAGGAGTGG + Intergenic
1016972667 6:149779041-149779063 CGCACCAGAGTGGGGGGGTGGGG - Intronic
1017495476 6:154979502-154979524 AGAACCAGGGTGGCTGGGTGCGG - Intronic
1017812925 6:157997025-157997047 CGAAGCTGGGTGGGGGGGGGTGG - Intronic
1017980316 6:159395370-159395392 CCAAGCACCGTGGTGGGGTGAGG + Intergenic
1018066612 6:160129021-160129043 CAAAGCAGTGTGGAGGGACGGGG + Intronic
1018136114 6:160779830-160779852 GGAAGCGGGGTGGGGGGGGGAGG - Intergenic
1018681945 6:166271819-166271841 CGAAGCGGGGTGGAGATCTGTGG - Intergenic
1018814981 6:167323870-167323892 CGAGGAAGGGTGGGTGGGTGGGG - Intergenic
1018984153 6:168623234-168623256 CAGAGCAGGCTGGAGGGCTGCGG + Intronic
1019200734 6:170312832-170312854 AGGAGCAGAGTGAAGGGGTGAGG + Intronic
1019494456 7:1331296-1331318 CAAAGGAGGCTGGCGGGGTGGGG - Intergenic
1019561674 7:1662396-1662418 AGTGGCAGGGTGGAGGGGAGGGG + Intergenic
1019608168 7:1920537-1920559 AGAAGGAGGGTGCAGGTGTGGGG + Intronic
1019641506 7:2106101-2106123 CTGGGCAGGGTGGAGGGGCGGGG - Intronic
1020080083 7:5282385-5282407 GGGAGGAGGGTGGAGGGGAGGGG + Intronic
1020277009 7:6630666-6630688 AGGAGCAGGTTGGAGGGGAGTGG - Intergenic
1020797735 7:12697148-12697170 ATAACCAGGGGGGAGGGGTGAGG - Intergenic
1021240654 7:18196742-18196764 CTAAAAAGGGTGTAGGGGTGTGG + Intronic
1021266044 7:18523903-18523925 GGAAGCAGGGCGGAGCGGGGAGG - Intronic
1022019714 7:26386593-26386615 CAAAGCAGGGAGGAGAGATGGGG - Intergenic
1023476662 7:40586521-40586543 GGAAGCAGAGAGAAGGGGTGAGG + Intronic
1024615755 7:51110257-51110279 CTGCGCAGGGTGGAGGGGAGAGG - Intronic
1024883668 7:54117072-54117094 CAAGGAAGGGAGGAGGGGTGGGG + Intergenic
1025236826 7:57240050-57240072 GAAAGGAGGGAGGAGGGGTGGGG + Intergenic
1026074323 7:67152511-67152533 GCAAACAGGGTGGCGGGGTGAGG - Intronic
1027505757 7:79015993-79016015 AGAAGCGGGGGGGGGGGGTGGGG + Intronic
1029125233 7:98290948-98290970 TGTAGCTGGGTGGTGGGGTGGGG + Intronic
1029973943 7:104815240-104815262 TGCAGCAGGGAGGCGGGGTGGGG - Intronic
1030014602 7:105206150-105206172 CACAGCTGGGTGGTGGGGTGGGG - Intronic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1032096065 7:128939023-128939045 CGGAGCACGCGGGAGGGGTGGGG + Intronic
1032337842 7:131042869-131042891 AGAAGCATGGCGGCGGGGTGGGG - Intergenic
1032462502 7:132122399-132122421 GGAGGCAAGGGGGAGGGGTGAGG - Intergenic
1033439633 7:141367078-141367100 GACAGCAGGGGGGAGGGGTGGGG + Intronic
1034743678 7:153502530-153502552 CTGATCAGGGTGGTGGGGTGGGG - Intergenic
1034901169 7:154908880-154908902 AGAAGCAGAGAGGAGGGTTGGGG - Intergenic
1035528167 8:330815-330837 GTTAGCAGTGTGGAGGGGTGGGG + Intergenic
1035582707 8:749909-749931 AGAAGCAGGCTGGAGTGATGAGG - Intergenic
1036757142 8:11478268-11478290 AGAAGCAGCTTTGAGGGGTGGGG - Intergenic
1037589737 8:20303000-20303022 TGTGGCAGGGTGGAGGGGTGAGG + Intronic
1037603305 8:20417138-20417160 TGAAGCAAGGAGGAGGCGTGGGG + Intergenic
1039386247 8:37138180-37138202 GAAAGGAGGGTGCAGGGGTGAGG + Intergenic
1039585362 8:38702522-38702544 GGAGGCAGGGTGCAGGGGAGTGG + Intergenic
1039914076 8:41846791-41846813 CAGAGCAGGGTGGGAGGGTGTGG - Intronic
1040060252 8:43097637-43097659 CGCAGCGGGGTGGAGGGGAAGGG + Intronic
1040900718 8:52414561-52414583 CAAAGCTGGGGGGAGGGGGGCGG + Intronic
1042309444 8:67365830-67365852 GTAAGGAGGATGGAGGGGTGGGG - Intergenic
1043368722 8:79565738-79565760 CAAAGCAGGGTGGGAGGGAGTGG + Intergenic
1043908729 8:85836176-85836198 TGAAGGAGAGTGGAGGAGTGGGG + Intergenic
1044546588 8:93466740-93466762 CGAGGCTGGGTGGGTGGGTGGGG + Intergenic
1045277588 8:100721661-100721683 CGGAGCCGGGGGGAGGGGAGCGG + Exonic
1045557008 8:103224411-103224433 CAAAGCAGAGTGGGCGGGTGGGG + Intronic
1046802075 8:118439581-118439603 GGAATCAGGGTGCAGGGTTGGGG - Intronic
1048950784 8:139495320-139495342 CTGAGCAGGCTGGAGGGGAGAGG - Intergenic
1049047203 8:140162214-140162236 AGAAGCAGGGTGGCAGGCTGTGG - Intronic
1049214823 8:141402725-141402747 GGAAGCAGGGGGGAGGGGTGGGG - Intronic
1049472504 8:142782748-142782770 TGACCCAGGGTGAAGGGGTGAGG - Intergenic
1051408515 9:16764904-16764926 GGAAGGAGGGAGGAGGGATGGGG + Intronic
1051541900 9:18229424-18229446 CCTGGCAGGGTGGAAGGGTGGGG - Intergenic
1051641711 9:19230372-19230394 AGACGCAGGGAGGAGGGGGGCGG - Intergenic
1051671647 9:19516414-19516436 TGAAGCAGGGCAGAGGGGAGTGG + Intronic
1053305420 9:36981188-36981210 TGAAGCAGGGCTGAGGGGGGGGG - Intronic
1055791926 9:79931586-79931608 AGAGGCAGGGTGGAGGGGGTGGG + Intergenic
1056711019 9:88991722-88991744 GGAACCAGGGTGGGGGGCTGGGG + Intronic
1056817719 9:89813558-89813580 CCAAGCAGGAAGGAGGCGTGAGG - Intergenic
1057179769 9:93023385-93023407 CGACGGAGTGTGGAGGCGTGGGG + Intronic
1057816668 9:98301030-98301052 CGAGGACGGGTGAAGGGGTGTGG - Intronic
1058234199 9:102468683-102468705 TACAGCAGGGTGGAGGGTTGAGG + Intergenic
1058811620 9:108645037-108645059 CGGGGCAGAGTGGTGGGGTGTGG - Intergenic
1059962372 9:119577777-119577799 AGAGGCAAGGTGGTGGGGTGGGG + Intergenic
1060113139 9:120920817-120920839 GGAGGCAGGGTGGAGGGCTGAGG - Intronic
1060411187 9:123401331-123401353 CGGAGCACAGTGGGGGGGTGGGG + Intronic
1060885131 9:127146212-127146234 GGCAGGAGGGAGGAGGGGTGTGG - Intronic
1061181669 9:129028226-129028248 CGCAGCAGGTGGGCGGGGTGCGG - Exonic
1061387122 9:130296858-130296880 GGAAGTAGGGGGGAGGTGTGGGG + Intronic
1061431460 9:130533870-130533892 AGAAACAGGGTGGCCGGGTGCGG + Intergenic
1061521772 9:131122504-131122526 AGAGGCAGTGAGGAGGGGTGAGG - Exonic
1061609818 9:131739280-131739302 GGAAGCAGGCTGGATGAGTGGGG - Intronic
1061680900 9:132242046-132242068 CCGAGCAGGGTGGCGGGGCGCGG - Exonic
1061702477 9:132426474-132426496 GGAAACAGGGAGGGGGGGTGGGG - Intronic
1062108550 9:134768963-134768985 CTAAGCTGTGTGGAGGGGGGAGG + Intronic
1062248355 9:135581774-135581796 CGGAGCAGGGTAGACAGGTGTGG - Intergenic
1062481394 9:136754114-136754136 GGATGCAGGCAGGAGGGGTGTGG + Intergenic
1186744654 X:12554998-12555020 TGAAGCAGAGTGGAGTGGTCAGG - Intronic
1186878753 X:13843104-13843126 TGAACCAGAGTTGAGGGGTGAGG - Intronic
1187298251 X:18023658-18023680 CGGAGAAGGGAGAAGGGGTGTGG - Intergenic
1187343462 X:18442001-18442023 AGCAGCAGGGAGGAGGGGTGGGG - Intronic
1188146276 X:26617584-26617606 TGAGGCAGGGTGGAGTGGAGTGG + Intergenic
1189567717 X:42260749-42260771 CAAAGGAAGGTGGAGAGGTGGGG - Intergenic
1190128690 X:47726811-47726833 CAGAGCAGGGTGGTGGGGGGAGG - Intergenic
1191707095 X:64104871-64104893 GGAAGGAGGGAGGGGGGGTGAGG + Intergenic
1191715214 X:64189795-64189817 GGCAGAAGGGTGGGGGGGTGGGG - Exonic
1192493893 X:71600960-71600982 GGAAGGATAGTGGAGGGGTGTGG - Intronic
1192562450 X:72136174-72136196 CAAGGCAGGGTGGTGGGGCGAGG - Intronic
1192580874 X:72280187-72280209 AGAAGCAGGCTGCGGGGGTGGGG + Intronic
1194330069 X:92571790-92571812 GGAAGTAGGGTGGAAGGTTGAGG - Intronic
1194342694 X:92723911-92723933 CTAAGCATGTGGGAGGGGTGTGG - Intergenic
1194994017 X:100573697-100573719 CTAAGGAGGGTGTAGGGGTTAGG + Intergenic
1195378430 X:104249804-104249826 TGGGGCAGGGTAGAGGGGTGAGG + Intergenic
1195469954 X:105219866-105219888 TGGAGCAGGGTGGAGAGGGGTGG + Intronic
1195652339 X:107298362-107298384 AGGAGCAGGGTGTGGGGGTGGGG + Intergenic
1195718943 X:107847358-107847380 TGAAGCACAGTGGAGGGGTCAGG + Intronic
1195968379 X:110449551-110449573 TGGAGCAGGCTGGAGGGGTGAGG + Intronic
1196438193 X:115693586-115693608 GGAAGCAGGATGGAGGGGAAAGG + Intergenic
1197179125 X:123515342-123515364 AGAGGCAGAATGGAGGGGTGAGG - Intergenic
1197679135 X:129363618-129363640 TGTAGCAGGCTGTAGGGGTGTGG + Intergenic
1197695004 X:129540618-129540640 CGAAGCAGGGCGGGGCGGGGCGG + Intronic
1198009904 X:132541371-132541393 CCAGGAAGGGTGGTGGGGTGGGG - Intergenic
1200088459 X:153623392-153623414 GGAAGCAGAGTGGTGGGGGGCGG - Intergenic
1200215604 X:154366899-154366921 GGCTGAAGGGTGGAGGGGTGAGG - Intronic
1200256662 X:154586035-154586057 CGGGGTAGGGGGGAGGGGTGGGG + Intronic
1200261107 X:154618368-154618390 CGGGGTAGGGGGGAGGGGTGGGG - Intronic
1201099909 Y:10663656-10663678 AGCAGCAGGGTGGAGTGGAGTGG - Intergenic
1201131439 Y:10954785-10954807 TGAAGCAGAGTGGAGTGGAGTGG - Intergenic
1201452975 Y:14136169-14136191 GGAAGGAGGGAGGAGAGGTGAGG - Intergenic