ID: 915564509

View in Genome Browser
Species Human (GRCh38)
Location 1:156706177-156706199
Sequence CCCGAAGCAGGGTGGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 401}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564509_915564520 2 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG 0: 1
1: 0
2: 1
3: 49
4: 401
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
915564509_915564522 16 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG 0: 1
1: 0
2: 1
3: 49
4: 401
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129
915564509_915564518 -6 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG 0: 1
1: 0
2: 1
3: 49
4: 401
Right 915564518 1:156706194-156706216 TTCGGGCTCACGTAATGCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
915564509_915564517 -7 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG 0: 1
1: 0
2: 1
3: 49
4: 401
Right 915564517 1:156706193-156706215 CTTCGGGCTCACGTAATGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 53
915564509_915564519 -5 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG 0: 1
1: 0
2: 1
3: 49
4: 401
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564509 Original CRISPR CCCGAAGCAGGGTGGAGGGG TGG (reversed) Intergenic
900323193 1:2095059-2095081 CCCGTAGCAGGGTGGTGGTTTGG + Intronic
900640897 1:3687670-3687692 AGCGGAGCAGAGTGGAGGGGAGG - Intronic
901003897 1:6162473-6162495 TCTGAGCCAGGGTGGAGGGGAGG + Intronic
901007763 1:6180025-6180047 CCCGGCGCGGGGAGGAGGGGAGG + Exonic
901150634 1:7098904-7098926 CCCCAAGAAGTGAGGAGGGGTGG - Intronic
901663738 1:10814926-10814948 CCCCAAGGAGGGTGGAGGGAGGG + Intergenic
901928012 1:12579226-12579248 GCCCAGGCAGGATGGAGGGGAGG - Intronic
902197026 1:14805326-14805348 CCCACAGCAGGGGAGAGGGGAGG + Intronic
902401402 1:16159489-16159511 CCCTAAGCAGGCTGGTGGGCCGG - Intergenic
902510897 1:16966408-16966430 CCCGGCGCAGTGTGGATGGGCGG + Exonic
903878142 1:26490362-26490384 CCCTAAGTAGGGGGAAGGGGAGG + Intergenic
904497189 1:30893572-30893594 CCCTGAGCAGGGAGGAGGGGTGG - Intronic
904593274 1:31627131-31627153 CCCTAAGCAGGGTTGATGTGAGG + Exonic
904879510 1:33684721-33684743 CACCATGCAGGGTGGAGGTGAGG - Intronic
904917286 1:33979275-33979297 TCTGAAGCAGGGTGGAGTAGGGG + Intronic
904992481 1:34604352-34604374 CCCTACCCAGGGTGGAGGAGAGG + Intergenic
905013486 1:34762138-34762160 GCCGTAGCAGGGTGGTGAGGAGG + Exonic
905299007 1:36973238-36973260 GCCAACGCAGGGAGGAGGGGTGG - Intronic
906232936 1:44180905-44180927 CTCGAAGCGGGGAGGAGGGGAGG + Intergenic
906274902 1:44508166-44508188 CCCGAGGCAGGGTTGGGCGGGGG + Intronic
906690943 1:47792420-47792442 CCAGAGGCAGGGAGGAGGGGAGG + Intronic
912460260 1:109826049-109826071 CCCAAAGCAGAGTGATGGGGAGG - Intergenic
913969449 1:143403414-143403436 CAGGGAGCAGGGTAGAGGGGAGG - Intergenic
914134137 1:144883838-144883860 GCCGAGGCGGGGTGGGGGGGGGG + Intergenic
914134177 1:144883935-144883957 GCCGAGGCGGGGTGGGGGGGGGG + Intergenic
914869307 1:151459382-151459404 CCCGAGGGAGGGGGGTGGGGGGG + Exonic
915033184 1:152901612-152901634 CCCTAAGCGGGGTAGAGAGGTGG + Intergenic
915564509 1:156706177-156706199 CCCGAAGCAGGGTGGAGGGGTGG - Intergenic
915586705 1:156847656-156847678 CCAGGAGCAGGTTGGGGGGGTGG + Intronic
915994639 1:160550402-160550424 GGCGATCCAGGGTGGAGGGGAGG + Intronic
916528046 1:165630454-165630476 CTCGAGGCCGGGTGGAGGAGGGG - Intergenic
916704896 1:167339181-167339203 ATGGAAGCAGGGTTGAGGGGAGG - Intronic
920275169 1:204799187-204799209 CCTGCAGCAGGGTGGAGCTGCGG - Intergenic
920403069 1:205689219-205689241 AAGGAAGCAGGGTGGAGTGGGGG + Intergenic
920572423 1:207027601-207027623 CCCGAAACAAGGTGCAGGGATGG + Exonic
922215383 1:223516052-223516074 CCCGAGGCAGTGTGGGGAGGTGG - Intergenic
922588198 1:226751718-226751740 ACAGAAGCAGGGGTGAGGGGAGG + Intergenic
922762700 1:228142485-228142507 CCCTCAGGAGGGAGGAGGGGAGG + Intronic
922762841 1:228143078-228143100 CCCTCAGGAGGGAGGAGGGGAGG + Intronic
923015903 1:230126537-230126559 CGCGAGGCAGGATGGAGGCGGGG - Intronic
924089710 1:240489498-240489520 TGAGAAGCAGGGTGAAGGGGTGG + Intergenic
924531508 1:244897592-244897614 GCGGGGGCAGGGTGGAGGGGAGG + Intergenic
1062844118 10:690969-690991 GTCGAAGCGGGGTGGGGGGGTGG - Intergenic
1063114355 10:3063663-3063685 CCCGAGGCATGGAGGTGGGGTGG + Intergenic
1063340029 10:5254052-5254074 ACGGAAGCAGGAAGGAGGGGAGG + Intergenic
1063343705 10:5292599-5292621 CAGGAAGCAGGAAGGAGGGGAGG - Intergenic
1063885219 10:10570286-10570308 CCAGGAGCAGGGTGGAGGCAAGG + Intergenic
1064266251 10:13827843-13827865 CCCGAAGCAGGCAGGAGCAGAGG - Intronic
1064662821 10:17623415-17623437 TCAGAAGCAGGGAGGTGGGGAGG - Intergenic
1065534009 10:26700252-26700274 CCTCAAGCGGGGTGGGGGGGAGG - Intronic
1065674922 10:28164220-28164242 AGGGAAGCAGGGTGGAGGAGAGG + Intronic
1068903478 10:62297175-62297197 CCAGCAGGAGAGTGGAGGGGTGG - Intergenic
1070647538 10:78212130-78212152 GCGGAAGCACAGTGGAGGGGAGG + Intergenic
1070717778 10:78734946-78734968 ACGGCAGCAGGGTGGGGGGGTGG + Intergenic
1071361677 10:84852256-84852278 GCCAAAGAAGGGTGGTGGGGAGG - Intergenic
1071960450 10:90804585-90804607 CCTGAAGGAGTGGGGAGGGGTGG - Intronic
1074415600 10:113264469-113264491 CCCCAAGCAGGGAGGAAGGAAGG + Intergenic
1074982474 10:118630783-118630805 CCCCAAGTAGGGAGGAGGGGAGG + Intergenic
1075447255 10:122521712-122521734 CACACAGCAGGGAGGAGGGGTGG + Intergenic
1075549755 10:123383500-123383522 CCCTATGCAGGCTGGAGGGGAGG - Intergenic
1075722683 10:124596687-124596709 CATGAAGCTGGGTGGACGGGTGG + Intronic
1075765062 10:124886764-124886786 AGCTAAGCGGGGTGGAGGGGGGG - Intergenic
1075911754 10:126131170-126131192 CCCGAGGCAGGGAGCAGGGAAGG - Intronic
1075936113 10:126342904-126342926 CTGGAGGGAGGGTGGAGGGGTGG + Intronic
1076070127 10:127482564-127482586 CACGGAGCAGGGTGGAGATGGGG - Intergenic
1076276515 10:129204177-129204199 CCAGAGGCAGGGTGGAAAGGAGG - Intergenic
1076607473 10:131698449-131698471 CCTGAAGAAGGGTGGCGGTGCGG - Intergenic
1076721554 10:132395563-132395585 CCTGGAGCAGGGTGGCGAGGGGG + Intergenic
1076995575 11:296009-296031 CCAGAAGCAGCGTGTGGGGGAGG + Exonic
1077132243 11:978884-978906 CCCGGAGTTGGGTGGTGGGGAGG + Intronic
1077284419 11:1759373-1759395 GCTGGAGCAGGGTGGAGGGCTGG + Intronic
1077433040 11:2525532-2525554 GCCAAAGCAGTGTGGAGGGTGGG + Intronic
1078060998 11:8043974-8043996 CCAGAAGAAGGGGGGTGGGGTGG - Intronic
1078465866 11:11549857-11549879 CCTGAAGAAGGGTGGAGGAGGGG + Intronic
1080779680 11:35419085-35419107 CCCGGAGGCGGGTGGAAGGGCGG - Exonic
1081156237 11:39695480-39695502 CCAGAAGAAGGGTGGAATGGAGG - Intergenic
1081473407 11:43399428-43399450 ACTGAGGCAGGGTGGAGGGGAGG + Intronic
1081702030 11:45158318-45158340 CCCAGAGGAGGGTGGAGGTGGGG - Intronic
1082928875 11:58579128-58579150 CTCGGAGCCGGGCGGAGGGGAGG + Exonic
1082993185 11:59226538-59226560 CCCTCAGCAGGGTGGATGGTAGG + Intergenic
1083440312 11:62671884-62671906 CCCGAGGAAGGGTGGGCGGGTGG + Intronic
1084496100 11:69504574-69504596 TCAGAAGCAGGGTGGAGGCTGGG - Intergenic
1084844550 11:71888859-71888881 CCGGGAGCAAGGTGGCGGGGTGG - Intronic
1085016410 11:73177004-73177026 CCTGAGGCAGGGTGGTGTGGGGG + Intergenic
1085515904 11:77111921-77111943 CCTGGAGCAGGGAGCAGGGGTGG + Intronic
1088286863 11:108199037-108199059 ACTGAAGCAGGGTAGAGGGACGG + Intronic
1088746125 11:112806443-112806465 CCAGGAGCAGGGTGGAGATGAGG + Intergenic
1089064755 11:115654077-115654099 GCCGAGGCTGGGTGGATGGGCGG - Intergenic
1089294806 11:117461192-117461214 CCAGGAGCAAGGTGGGGGGGTGG - Intronic
1089402384 11:118171744-118171766 CCCGCTGCAGGGTGGGGAGGGGG - Intronic
1089589159 11:119529474-119529496 CCCACAGCAGGGTGGAGAGGTGG + Intergenic
1090438087 11:126703465-126703487 CCTGATATAGGGTGGAGGGGAGG - Intronic
1090838022 11:130467411-130467433 GCCAAAGCAGGGTGGAAGGACGG + Intronic
1091240342 11:134047782-134047804 CCGGTAGGAGGGTGGATGGGTGG - Intergenic
1091282685 11:134390975-134390997 GCTGAAGCAGGAAGGAGGGGCGG + Exonic
1091898060 12:4120523-4120545 CCCAACACAGGGTGGAGGTGCGG - Intergenic
1092173571 12:6388342-6388364 CCCCAAGAAGGGCAGAGGGGAGG - Intronic
1092432440 12:8420260-8420282 CCTGCAGCAAGGTGGGGGGGGGG + Intergenic
1092460466 12:8681609-8681631 CGGGAAGCAGGCTGGAGAGGGGG + Intronic
1094316990 12:29145900-29145922 CCCCAAGAATGATGGAGGGGTGG + Intergenic
1095520047 12:43052700-43052722 CCCGAAGCTCTTTGGAGGGGCGG - Intergenic
1096192791 12:49631283-49631305 CTCAGAGCAGGGTGGAGGGTTGG + Intronic
1096385928 12:51195564-51195586 CACGGTGCAGAGTGGAGGGGTGG + Intronic
1096789809 12:54037621-54037643 CCCCTTGCAGGGTGGAGAGGGGG - Intronic
1096850011 12:54429284-54429306 CCCAAACCTGGGTGTAGGGGAGG - Intergenic
1096976995 12:55705125-55705147 CCAAAAGTAGGGAGGAGGGGAGG + Intronic
1097143160 12:56920358-56920380 CTGGAACCAGGGTGGAGAGGAGG + Intergenic
1097338143 12:58407657-58407679 CCTTTAGCAGGGTGGAGGGTGGG - Intergenic
1097941334 12:65309745-65309767 TTCTAAGCAGGGTGGTGGGGAGG + Intronic
1100869820 12:98898051-98898073 CCAAAAGCAGGGAGGATGGGAGG + Intronic
1102347078 12:112167252-112167274 GCCTAAGCAAGGTGGCGGGGAGG + Intronic
1102867171 12:116383505-116383527 CTCCAAGCAGGGTGTAGGAGAGG + Intergenic
1103739923 12:123084176-123084198 CCTGAAGCAGGGAGGAGGCCTGG - Intronic
1103744614 12:123113852-123113874 CCAGGGGCAGGGAGGAGGGGAGG - Intronic
1104031177 12:125066411-125066433 GGGGAGGCAGGGTGGAGGGGTGG - Intronic
1105004088 12:132710546-132710568 CCGGAGGCTGGGTGCAGGGGCGG - Intergenic
1105344297 13:19559839-19559861 CCCCTAGGAGGGGGGAGGGGAGG + Intergenic
1105535737 13:21261735-21261757 CCCCTAGGAGGGGGGAGGGGAGG - Intergenic
1106397395 13:29394348-29394370 CTAGAAGCAGAGGGGAGGGGAGG + Intronic
1108208272 13:48112940-48112962 CCCGAAGCAGGGAGGCTGGGGGG + Intergenic
1110224961 13:73110137-73110159 CCCGAAGCAGGGAGGCTGGCTGG + Intergenic
1110829944 13:80019323-80019345 CCCGATGCAGGGGGTGGGGGTGG - Intergenic
1113084901 13:106558894-106558916 GCTGAAGCAGGGTTTAGGGGAGG + Intronic
1114720487 14:24875994-24876016 CACCAAACAGAGTGGAGGGGTGG + Intronic
1114784950 14:25585887-25585909 GCTGGAGCATGGTGGAGGGGAGG - Intergenic
1115752422 14:36505867-36505889 CCCCAAGCAGCCTGGAGGGTGGG + Intronic
1118491367 14:66263796-66263818 TCAGAAGCAGGGAGCAGGGGAGG + Intergenic
1119076815 14:71648366-71648388 AGCTAAGCAGGGTGCAGGGGAGG + Intronic
1120388513 14:83876291-83876313 GCAGAAGCAAGGTGGTGGGGGGG - Intergenic
1120407326 14:84105406-84105428 CCTGAAGGTGGTTGGAGGGGGGG - Intergenic
1121554709 14:94827675-94827697 ACTGAGGCAGGGAGGAGGGGAGG + Intergenic
1121828873 14:97033204-97033226 CAGGAAGCAGCCTGGAGGGGAGG - Intergenic
1122625491 14:103083522-103083544 CAGGAAGCAGGGGGGGGGGGGGG - Intergenic
1122660785 14:103293631-103293653 CCAGACACAGGATGGAGGGGAGG - Intergenic
1123121256 14:105918085-105918107 CCTGAAGGAGGGAGGAGGGAGGG + Intronic
1123403983 15:20009749-20009771 CCTGAAGGAGGGAGGAGGGAAGG + Intergenic
1123513323 15:21016395-21016417 CCTGAAGGAGGGAGGAGGGAAGG + Intergenic
1123943101 15:25226045-25226067 CCTGGAGCCTGGTGGAGGGGAGG + Intergenic
1124632170 15:31344235-31344257 CCTGACACAGGCTGGAGGGGTGG - Intronic
1127581912 15:60346420-60346442 CCATAAGCAGGGTAGAGGGCTGG - Intergenic
1128269075 15:66293379-66293401 CCTGGACCAGGGCGGAGGGGTGG - Intronic
1128430433 15:67588009-67588031 CCAGCTGCAGGGTGGAGGAGGGG - Intronic
1129341656 15:74890303-74890325 TCTGAGGCAGGGTGGCGGGGAGG - Intronic
1131094321 15:89646202-89646224 GCCAAAGCAGGCGGGAGGGGAGG - Intronic
1131107065 15:89742416-89742438 CGCTTAGCAGGGTGGAGGGGGGG - Intronic
1132491574 16:234733-234755 ACCGAAGCATGGCGGTGGGGCGG + Exonic
1132610001 16:810871-810893 CCCTCAGCAGGGAGGAGGTGTGG + Intronic
1132803828 16:1766659-1766681 CCCGGGGCAAGGTGGAGGGAGGG + Intronic
1132899133 16:2243957-2243979 GCCGGAGCCTGGTGGAGGGGAGG - Intronic
1133662549 16:7933282-7933304 GTCCAAGCAGGGAGGAGGGGAGG - Intergenic
1133881563 16:9787400-9787422 CCCGAAGTGGGGTAGAGGGTGGG - Intronic
1136416740 16:30108701-30108723 CCCAAAGCAGAGTGGTGGTGGGG + Intronic
1136546593 16:30958221-30958243 CCCGAATCCGGGCGGGGGGGTGG - Intronic
1137446705 16:48536448-48536470 CTAGAAGCAGGGAGGAGGGGAGG + Intergenic
1138583969 16:57958642-57958664 ACCGAGGGAGGGTGGAGAGGGGG - Intronic
1139373674 16:66483771-66483793 CCTGAAGGAGGGTGCAGCGGGGG + Intronic
1139433933 16:66925588-66925610 CCCGCAGCAGCGTGGACCGGGGG - Exonic
1139956777 16:70697010-70697032 CCTGAGGCTGAGTGGAGGGGTGG + Intronic
1140056704 16:71531671-71531693 CCCCAAGCAGGATGGAGGGAGGG + Intronic
1140478166 16:75249313-75249335 GCAGAAGTAGGGTGGAGGGGTGG - Intronic
1140664062 16:77212655-77212677 CCCGAGGAAGGGAGGCGGGGCGG + Intronic
1140818039 16:78638637-78638659 CCAGCAGCAGGCTGGAGGGAAGG + Intronic
1141075947 16:81006860-81006882 CCGGGAGCACGGTGGAGCGGTGG - Exonic
1141668744 16:85480453-85480475 TCAGAAACAGGGTGGAGTGGAGG - Intergenic
1141680461 16:85540989-85541011 CGCCAAGCAGGGTGGTGTGGCGG + Intergenic
1141765887 16:86059873-86059895 CTTGAAGCTGGGTGGAGGTGAGG + Intergenic
1142264562 16:89057748-89057770 ACAGATGCAGGGTGGAGGGAGGG + Intergenic
1142314483 16:89334948-89334970 CAAGCAGCAGAGTGGAGGGGAGG + Intronic
1142973240 17:3627343-3627365 CCCGGAGCGAGCTGGAGGGGAGG - Intronic
1143203322 17:5127014-5127036 CCCGCACCAGGGTGGGGGGAGGG + Intronic
1143329216 17:6121446-6121468 CCCGGAGCATGGTGTAGGAGGGG - Exonic
1143380562 17:6493574-6493596 CACGTAGCAGGGTGCTGGGGAGG + Intronic
1143485745 17:7252604-7252626 CCAGAGGCACGGTGGCGGGGCGG + Intronic
1144753040 17:17663196-17663218 CCTGAGGCAGGGTGGACAGGAGG - Intergenic
1144796402 17:17894286-17894308 GCAGAAGCAGGGTTGAGTGGGGG - Intronic
1144874489 17:18390339-18390361 CCCGCACCAGGGTGGGGGGAGGG + Intergenic
1145388335 17:22435321-22435343 GACGAGGCAGGGAGGAGGGGAGG - Intergenic
1145846298 17:28041870-28041892 ACGGAAGCCGGGTGGGGGGGAGG + Intronic
1146403654 17:32519406-32519428 AGGGAAGCAGGGAGGAGGGGAGG + Intronic
1146501751 17:33370570-33370592 CTGGAAGCAGGGTGGAGGGAGGG + Intronic
1146920187 17:36704816-36704838 CCAGAAGCAAGGTAGAGGGGTGG + Intergenic
1147689719 17:42307782-42307804 CCCGATGGAGGGTGGGGTGGCGG - Intronic
1148164756 17:45475554-45475576 CCCGGAGCAGGGCGGTGGGCTGG + Exonic
1148469628 17:47885070-47885092 CCCTCAGCAGGGTGGGGGTGGGG + Intergenic
1148714528 17:49706554-49706576 CCACATGCAGGGTGGAGGTGGGG + Intronic
1148825830 17:50393336-50393358 CCAGGAGCAGTGTGGAGGGTAGG - Intronic
1149569614 17:57663162-57663184 CCAGTGGCGGGGTGGAGGGGCGG + Intronic
1149575320 17:57707851-57707873 TCAGGAGCGGGGTGGAGGGGAGG - Intergenic
1150395975 17:64822221-64822243 CCCGGAGCAGGGCGGTGGGCTGG + Intergenic
1150580404 17:66468704-66468726 TCTGAAGGAGGGTGGAGGGTGGG + Intronic
1150692591 17:67378321-67378343 CCCGAAGCCTGGAGGAGAGGAGG + Intronic
1151190350 17:72393599-72393621 TTGGAAGAAGGGTGGAGGGGTGG + Intergenic
1151657222 17:75501766-75501788 CCCGGAGCAGGTAAGAGGGGAGG - Exonic
1151712343 17:75813885-75813907 CCCACAGCAGGGTGGGGGGGTGG + Intronic
1151812082 17:76450273-76450295 CACCAAGCAGGGTGGTAGGGTGG - Intronic
1151876399 17:76869933-76869955 CCCGCAGCGGGGTGGGGAGGGGG + Intronic
1152053063 17:77997572-77997594 CAGGAATCAGGGTGGAGCGGAGG + Intergenic
1152191820 17:78892763-78892785 CCTGCAGCTGGGTGGAGGCGAGG + Intronic
1152348289 17:79768310-79768332 CACAAAGCAGGGAGGAGGTGGGG + Intergenic
1152363528 17:79843120-79843142 CCTCCAGAAGGGTGGAGGGGCGG - Intergenic
1152610712 17:81313890-81313912 CCTGCAGCAGGGTGGGGGGCCGG + Exonic
1152759514 17:82100673-82100695 CCCACAGCAGAGTGCAGGGGTGG - Intergenic
1153284738 18:3447856-3447878 CCAGGAGAAGGGGGGAGGGGCGG - Intronic
1154107063 18:11532881-11532903 CCCATCGCAGGGTGGTGGGGTGG + Intergenic
1157493537 18:48139703-48139725 ACCGAGGGAGGCTGGAGGGGTGG - Intronic
1157521441 18:48348157-48348179 CCACCTGCAGGGTGGAGGGGTGG + Intronic
1157867358 18:51197766-51197788 CCCGAAGGAGGGTGGGGGGTGGG - Intronic
1159787600 18:72732915-72732937 CCAGAATCAGTGGGGAGGGGTGG - Intergenic
1160253501 18:77225407-77225429 CCCATAGGAGGGTGGAGGGTGGG - Intergenic
1160303593 18:77709285-77709307 TCAGAAGCAGGGTAGAGTGGTGG + Intergenic
1160460943 18:79037553-79037575 CCTGAGACATGGTGGAGGGGAGG - Intergenic
1160719111 19:589866-589888 CCCGAGGGAGGGGGGAGGCGGGG - Intergenic
1160826709 19:1083570-1083592 CCCAAGGGAGAGTGGAGGGGCGG - Intronic
1160856817 19:1221508-1221530 CCAGAAGCAGGGTGGAGCTGAGG - Intronic
1160920974 19:1520397-1520419 CCGGAAGGAGGGTGCTGGGGAGG + Intergenic
1161262397 19:3345188-3345210 CCGGATGCAGGGGGGAGGGAAGG + Intergenic
1161295756 19:3519423-3519445 CCCCAAGGAGGGCGGAGGGCTGG + Intronic
1161973619 19:7596847-7596869 CCCGCAGCCGGGAGGAGCGGGGG - Intronic
1162070294 19:8148920-8148942 CCCGAGGCAGGGGGCTGGGGCGG - Intronic
1162803335 19:13123142-13123164 CACAAAGGAGGGTGGAGGGATGG - Intronic
1163273401 19:16267616-16267638 CCACAAGCAGGTTGGATGGGAGG + Intergenic
1163694925 19:18759361-18759383 ACCGCCCCAGGGTGGAGGGGCGG - Intronic
1165116741 19:33533331-33533353 CCCGAAGTGAGGGGGAGGGGAGG + Intergenic
1165331860 19:35144629-35144651 TCCGAAGCAGGGCGGGGGGTGGG + Intronic
1166231739 19:41428584-41428606 CCCAAACCAGGGTGGAGTGAAGG - Exonic
1166810128 19:45509381-45509403 CGCGAGGGGGGGTGGAGGGGCGG - Intronic
1167151585 19:47713386-47713408 CCCGGAGCGGGGAGGACGGGAGG - Exonic
1167295165 19:48645515-48645537 CCCGAGGGAGGGTGGAGGTGGGG - Intronic
1167320121 19:48792389-48792411 CCTGTTGCAGGGTGGTGGGGAGG - Intergenic
1167493700 19:49806103-49806125 CCAGAAGCTGGGAGGAGGGGGGG - Exonic
1168076493 19:53983020-53983042 CCCGAGGGAGGGGGCAGGGGAGG + Exonic
1168394649 19:56037842-56037864 CCTGAGGGAGGGAGGAGGGGAGG + Intronic
1168589891 19:57624519-57624541 CCCAAATAAGGGAGGAGGGGTGG + Intergenic
926136273 2:10338830-10338852 CCAGAAGCATGGTGCAGTGGTGG + Intronic
926337498 2:11875251-11875273 AAAGAATCAGGGTGGAGGGGAGG - Intergenic
927987187 2:27420279-27420301 ACAGAAGCAGGGTGGAGTGATGG - Intergenic
929211877 2:39366257-39366279 CTTGAAGCAGGGTGGTGGGGTGG + Intronic
929241513 2:39658313-39658335 CCCCAACCAAGGAGGAGGGGAGG - Intergenic
931251711 2:60536833-60536855 CCCCAAGCAGATAGGAGGGGAGG + Intronic
931265173 2:60654019-60654041 CCTGAAGGATGGTGCAGGGGAGG + Intergenic
931306159 2:61030846-61030868 GCCAAAGATGGGTGGAGGGGTGG + Intronic
931763520 2:65435935-65435957 CCCGAGCCAGGCGGGAGGGGTGG - Intergenic
934174140 2:89564317-89564339 CAGGGAGCAGGGTAGAGGGGAGG - Intergenic
934284456 2:91638666-91638688 CAGGGAGCAGGGTAGAGGGGAGG - Intergenic
935334216 2:102000333-102000355 CCAGCAGCAGGGTGGTGGGCAGG - Intronic
935878329 2:107536180-107536202 CCCACAGCAGGGTGGAGGCTCGG + Intergenic
937305651 2:120868912-120868934 CAGGAAGCAAGGTGCAGGGGCGG + Intronic
937379688 2:121365416-121365438 AGCGAAGCAGGGCGGAGGGTGGG - Intronic
938601351 2:132844040-132844062 CCTGAAGCTGGGAGGAGTGGAGG - Intronic
940293345 2:152098733-152098755 CCCGAAGGAGGGTGAGGAGGAGG + Intronic
941699857 2:168592670-168592692 TGTGCAGCAGGGTGGAGGGGTGG + Intronic
942079469 2:172386310-172386332 CCCTTAGCAGGGGGGTGGGGGGG + Intergenic
942299308 2:174546930-174546952 GCCGAAGGAGGGTGGAGGGCTGG - Intergenic
944715736 2:202375264-202375286 CCCGCAGCGGGGTGTAAGGGCGG + Intergenic
945652489 2:212581113-212581135 CGAGAAGCAGAGGGGAGGGGAGG - Intergenic
946347126 2:219119576-219119598 CCAGGGGCAGGGTGGCGGGGAGG - Intronic
946372037 2:219286740-219286762 CCCCAGGCAGGGAGGAGGAGAGG - Exonic
946717969 2:222573109-222573131 ACAGAATCAGGTTGGAGGGGAGG + Intronic
947739954 2:232480482-232480504 CCAGGAGCGGGGTGGAGGGGAGG + Intronic
948171545 2:235907250-235907272 ACCGAGGCAGGGTGGAGAAGTGG - Intronic
948373457 2:237505180-237505202 CCTGATGCAGAGTGGAGGGCAGG + Intronic
1170683207 20:18545186-18545208 CCCAAAGCAGTGAGGATGGGAGG + Intronic
1171491186 20:25518745-25518767 CCAAAAGCAGGGTGGGGGAGGGG - Intronic
1171499123 20:25579567-25579589 CCAGAGGCAGGGTGGCGTGGGGG - Intronic
1172113939 20:32562929-32562951 GGAGAAGGAGGGTGGAGGGGAGG + Intronic
1172292733 20:33788023-33788045 CTCGAATGAGGGTGGAGGTGAGG - Intronic
1172317094 20:33964301-33964323 CCGGAAACAAGGAGGAGGGGAGG + Intergenic
1172320603 20:33993264-33993286 CCGGAAGCAGGGAGGGGAGGAGG - Intergenic
1172781336 20:37438517-37438539 CCCAGAGCAGGGAGGAGGAGCGG + Intergenic
1173183936 20:40825031-40825053 GCCTAGGCAGGGTGGAGAGGAGG + Intergenic
1173253572 20:41377233-41377255 GTGGAAGCAGGGTGGAGGTGAGG + Intergenic
1173424700 20:42932490-42932512 TGAGAAGCAAGGTGGAGGGGTGG + Intronic
1173759616 20:45547967-45547989 CACAGAGCAGGGTGTAGGGGAGG + Intergenic
1173881581 20:46417083-46417105 GCCAAAGCAGGGTGGATGGGAGG - Intronic
1175957056 20:62616827-62616849 CCCTGAGCAGGGTGGAGCAGCGG - Intergenic
1176181659 20:63752347-63752369 CCCGAGGCAGGGCGGGGGCGGGG + Intronic
1176389808 21:6157618-6157640 ACCGAAGCAGGGTGGTGAGGGGG + Intergenic
1176725636 21:10430226-10430248 ACAGAGGCAGGGAGGAGGGGAGG - Intergenic
1177629997 21:23714483-23714505 CCCACAGCAGTGTGCAGGGGTGG + Intergenic
1178185830 21:30219123-30219145 CCCGAGGGAGGGTGGAGAGGGGG - Intergenic
1179733659 21:43380620-43380642 ACCGAAGCAGGGTGGTGAGGGGG - Intergenic
1179879588 21:44287797-44287819 CCAGAACCAGGGTGCAGTGGGGG - Intronic
1180026165 21:45163534-45163556 CCTGGTGCAGGGTGGAGGTGGGG - Intronic
1180074744 21:45456738-45456760 CTGGCAGCAGGGTGGCGGGGCGG - Intronic
1180858435 22:19062871-19062893 CCCCTGGCAGGCTGGAGGGGAGG - Intronic
1180920689 22:19520076-19520098 CACCAAGCAGGCTGCAGGGGAGG - Intronic
1182031930 22:27165908-27165930 CTGGAAGAAGGGAGGAGGGGTGG + Intergenic
1182517024 22:30864774-30864796 CCTGAAGCAGGGTGGAAGGATGG - Intronic
1182733132 22:32511331-32511353 CCCCAAGGTGGGTGGAGGTGGGG - Intergenic
1183198918 22:36372657-36372679 CCAAGAGCAGGCTGGAGGGGAGG + Intronic
1183253236 22:36744710-36744732 CCCCAAGAAGGGTGGAGGGAGGG - Intergenic
1183278031 22:36913692-36913714 CCAGGAGCAGGGCTGAGGGGTGG + Intronic
1183731195 22:39619488-39619510 AACGAAGCAGGGTGGGGGGGTGG - Intronic
1185052195 22:48559735-48559757 CCCGAGCCAGGCAGGAGGGGCGG + Intronic
1185111618 22:48903221-48903243 CCGGAAGCAGGGAGGAGGCTTGG - Intergenic
1185310696 22:50152720-50152742 CCAGCAGCCGGGTGGAGGGCAGG - Intronic
949807669 3:7973652-7973674 ACCAAAGCAGGGGAGAGGGGAGG + Intergenic
950456350 3:13095053-13095075 CCAGAAGCAAGGTGGAGAGGAGG - Intergenic
950520560 3:13495398-13495420 CCTGAAGCAGGGTACAGAGGCGG - Intronic
952571055 3:34716712-34716734 CCCAAAGCTGGGGTGAGGGGAGG + Intergenic
953494327 3:43373151-43373173 TCAGAAGCTGGGTGAAGGGGTGG + Intronic
954440751 3:50520838-50520860 CCTGGAGCAGGATGTAGGGGTGG - Intergenic
955159183 3:56447402-56447424 CCCGAAGCAGCGGGGAGGAGAGG + Intronic
956035802 3:65089967-65089989 CCTGAAGTGGGGTGGAGGGGGGG - Intergenic
956960384 3:74392391-74392413 GAAGAAGCAGGGTGGAAGGGAGG - Intronic
961533881 3:127557384-127557406 CCAGAAGCCGGCTGGAGTGGGGG + Intergenic
964477485 3:157109921-157109943 CCAGAATCAGGGAGGAAGGGTGG + Intergenic
967217077 3:187219958-187219980 GCCGAAGGAGGGGGGATGGGAGG + Intronic
967315632 3:188149885-188149907 CTAGAAGGAGGGTGGAGGGTGGG + Intergenic
968069817 3:195777961-195777983 CCCCAGGCAGGGAGGAGGGCGGG - Intronic
968225693 3:196970551-196970573 CTGGAACCAGGGCGGAGGGGAGG - Intergenic
968474307 4:795782-795804 CCCCAAACCGGGTGGAGAGGGGG + Intronic
968494274 4:906850-906872 CCTGAGGCAGGGAGGAAGGGAGG - Intronic
968582682 4:1402320-1402342 ACCGGAGCAGGCTGCAGGGGTGG + Intergenic
969515044 4:7642572-7642594 CAAGAAGCAGGGTGGTGTGGTGG + Intronic
972765622 4:42150950-42150972 CCCGGGGCAGGAAGGAGGGGCGG + Intronic
972911495 4:43822551-43822573 ACAGAAGCATGCTGGAGGGGTGG - Intergenic
974454210 4:62105269-62105291 CCTGTAGCAGGGTGAAGGGTGGG - Intergenic
975400324 4:73929957-73929979 CCTCAAGGAGGGTGGAGGGTGGG + Intergenic
975478171 4:74846523-74846545 GCTGGAGCAGGGTGAAGGGGAGG - Intergenic
977921083 4:102643117-102643139 CCAGAAGCCGGGGAGAGGGGAGG - Intronic
981941026 4:150281679-150281701 CCAGAATCAGGCTGGAGGGCGGG - Intronic
982863417 4:160482040-160482062 CCCGGAGCCGGGGGGAGGGGTGG - Intergenic
985246559 4:187985028-187985050 CCTGAAGCAGGGTCGGGTGGAGG - Intergenic
985669434 5:1200100-1200122 CCCTGTGCAGGGTGGAGGTGGGG + Intergenic
985675617 5:1229959-1229981 CACGGTGCAGGCTGGAGGGGAGG + Intronic
985696948 5:1346039-1346061 CCCGAGGCCGCGTGCAGGGGCGG + Intergenic
985713871 5:1445274-1445296 CCCGAAGTGGGGCGCAGGGGCGG - Intronic
986792933 5:11181114-11181136 CCAGGAGCAGGGTGCAGTGGCGG + Intronic
989229712 5:39073458-39073480 CCTGCAGCAGGGTGAGGGGGCGG + Intronic
989730500 5:44642013-44642035 CCAGAAGCAGGGCTGAAGGGTGG - Intergenic
990638517 5:57756669-57756691 CCCACAGAAGGTTGGAGGGGTGG + Intergenic
991261840 5:64676464-64676486 TCAGATGCAGGGTGGTGGGGGGG + Intergenic
991396180 5:66207519-66207541 CCTGAAGGAGGGTGGTGTGGGGG + Intergenic
994141016 5:96341342-96341364 AACCAAGCAGGGTGGAGGGGTGG - Intergenic
995553854 5:113307720-113307742 CTCTTGGCAGGGTGGAGGGGAGG + Intronic
995764723 5:115602512-115602534 CGCAAAGAAGGGTGGAGGAGGGG + Intronic
997349155 5:133217842-133217864 GCCGAGGGAGGATGGAGGGGAGG - Intronic
997453127 5:133999453-133999475 CACAGAGCAGGGTGGAAGGGAGG - Intronic
998136869 5:139678629-139678651 CCCCAAGCGGGGGGGAGGGGGGG - Intronic
998199486 5:140108120-140108142 CGCGAGGAAGGGGGGAGGGGAGG - Intronic
998236518 5:140402546-140402568 TCCAAAGCAGGGTGGGCGGGAGG - Intronic
998399085 5:141838635-141838657 CCAGAAGCAGGGTGGGAGAGAGG + Intergenic
999184554 5:149696933-149696955 CCAAAAGCGGGGAGGAGGGGTGG + Intergenic
999461055 5:151758146-151758168 CCTGAAGGAGGGCGGTGGGGAGG - Intronic
999735736 5:154511515-154511537 CTCTCAGCAGGGTGGAGGGCTGG + Intergenic
1001211142 5:169811291-169811313 CCTGCTGCAGGGTGGAAGGGAGG + Intronic
1001398836 5:171434886-171434908 CGCAAAGCATGGTTGAGGGGAGG + Intronic
1001520022 5:172384906-172384928 CCCTCAGAAGGGTGGAAGGGTGG - Intronic
1002021844 5:176368650-176368672 CTAGAAGCAGGGTGGGGTGGGGG + Intronic
1002051202 5:176572597-176572619 CCCGCAGCAAGGGGGAGGAGTGG + Intronic
1002771357 6:292741-292763 CCGGAAGCCGGGTGGGGTGGGGG - Intronic
1003290831 6:4776811-4776833 CCCGAGGCCGGGGGGAGGGGAGG - Intronic
1005996860 6:30936803-30936825 CAAGAATCAGGGTGGAGTGGTGG + Intergenic
1006308586 6:33240817-33240839 TACCAAGCAGGGTGGAGTGGGGG + Intergenic
1006802072 6:36765763-36765785 GCCCCGGCAGGGTGGAGGGGAGG + Intronic
1006810719 6:36818751-36818773 CCCGCCGCAGGGTGGAGTAGAGG - Intronic
1006815238 6:36845512-36845534 GGCCAGGCAGGGTGGAGGGGTGG - Intergenic
1006921688 6:37631841-37631863 CCCCAAGTAGGGTGCAGGGTGGG + Exonic
1007841581 6:44720445-44720467 CCAGAAACAGGGTGGGGGTGAGG + Intergenic
1007924556 6:45640901-45640923 CCAGGAGCAAGGTGGAGGGCAGG + Intronic
1012987507 6:105890671-105890693 CCCCAAGCAGGGAGGAGGAAAGG - Intergenic
1013498196 6:110719982-110720004 GCCGAAGCAGGGGGGGGGTGGGG - Intronic
1016460796 6:144278641-144278663 CCGGAAGCAGGGAGGGGGGTGGG + Intergenic
1016972670 6:149779043-149779065 CCCGCACCAGAGTGGGGGGGTGG - Intronic
1017763074 6:157585946-157585968 TCCCAGGCAGGGTGGAGGTGCGG + Intronic
1017806022 6:157946230-157946252 ACAGATGCAGTGTGGAGGGGCGG - Intergenic
1018009331 6:159655371-159655393 CCAGAGGCATGGTGGAGGTGGGG + Intergenic
1018719393 6:166561357-166561379 GCTGAAGAATGGTGGAGGGGAGG - Intronic
1019049003 6:169169067-169169089 CCCAGAGCACGGTGGAGGGTGGG + Intergenic
1019561672 7:1662394-1662416 GCAGTGGCAGGGTGGAGGGGAGG + Intergenic
1019705081 7:2493790-2493812 CCCAAGGCAGGGTGGGGGTGGGG - Intergenic
1019735670 7:2648741-2648763 CCTGCAGTAGGGTGGTGGGGGGG + Intronic
1019801566 7:3091808-3091830 CCTGCCGGAGGGTGGAGGGGTGG - Intergenic
1022329064 7:29360566-29360588 CCCATGGCAGGGTGGAGGGTGGG + Intronic
1022504114 7:30899985-30900007 CCCCAAGCAGGGCAGAGGAGAGG + Intergenic
1022793258 7:33710796-33710818 CCAGAATCAAGGTGGAGGTGGGG + Intergenic
1023648560 7:42344586-42344608 CCAGGAGCAGGGTGGGGGTGGGG + Intergenic
1023773597 7:43583012-43583034 CCAGAAGCAGGGTGCAGGGCAGG + Intronic
1024621239 7:51159190-51159212 CGCAAAGCAGGGAGGTGGGGAGG + Intronic
1024629983 7:51238885-51238907 TCTGTAGCTGGGTGGAGGGGAGG - Intronic
1026743044 7:72990652-72990674 CCAGAAGGAAGGTGGAGGGCAGG - Intergenic
1027029158 7:74875356-74875378 CCAGAAGGAAGGTGGAGGGCGGG - Intergenic
1027100691 7:75374426-75374448 CCAGAAGGAAGGTGGAGGGCAGG + Intergenic
1029201208 7:98840380-98840402 CCCGGAGCAGGGTTGTGGTGGGG - Intergenic
1029996604 7:105013501-105013523 CCCGAAGCACGGTGGCAGGGAGG + Intergenic
1031288410 7:119901192-119901214 CCTGGGGCTGGGTGGAGGGGCGG + Intergenic
1032013083 7:128359604-128359626 CCGGAAGCAGGGAGGAGGCCCGG + Exonic
1032415233 7:131730416-131730438 CCAAAAGCAGGGAGGAAGGGAGG - Intergenic
1033449584 7:141450541-141450563 CCCCAAGAATGGTGGATGGGTGG - Intronic
1034538418 7:151740229-151740251 CCCGAAGGAGGGAGGAGTTGAGG + Intronic
1035266576 7:157692969-157692991 ACCGGAGGAGGGTGGCGGGGAGG - Intronic
1035748194 8:1976564-1976586 CCCACAGCAGGGTGGGGGGTGGG - Intronic
1036287836 8:7460180-7460202 ACAGAAGCAAGGTGAAGGGGTGG + Intronic
1036333640 8:7851348-7851370 ACAGAAGCAAGGTGAAGGGGTGG - Intronic
1036757144 8:11478270-11478292 CCAGAAGCAGCTTTGAGGGGTGG - Intergenic
1037371492 8:18184031-18184053 CCCGGGGCGGGGTGGTGGGGGGG + Intronic
1037887053 8:22600768-22600790 CCCGGAGCAGTGAGGAAGGGCGG - Intronic
1038497539 8:28014487-28014509 CCCGGAACAGGGTGGAGAAGAGG + Intergenic
1038659652 8:29486202-29486224 CCTGAAGCAAAGTGGAGGGGAGG + Intergenic
1039596932 8:38798739-38798761 CCGGAAGCATGGGAGAGGGGTGG - Intronic
1039881916 8:41630498-41630520 CCGGAAGCATGGAGGAGGGGAGG - Intergenic
1040006896 8:42628521-42628543 CCACAGGCAGGGTGGAGGGAGGG - Intergenic
1042576045 8:70219675-70219697 GCAGGAGGAGGGTGGAGGGGGGG + Intronic
1048701254 8:137092200-137092222 CAGGAAGGAGGATGGAGGGGAGG + Intergenic
1048896905 8:139000480-139000502 CCTGAAGCAGGGTGCATGGTGGG + Intergenic
1049108844 8:140630246-140630268 TGCAAAGCAGGGTGGACGGGCGG - Intronic
1049214825 8:141402727-141402749 GCGGAAGCAGGGGGGAGGGGTGG - Intronic
1049306409 8:141906558-141906580 CCCCAAGGAGAGTGGAGTGGAGG + Intergenic
1049659487 8:143813380-143813402 GAGGAAGCAGGGTGGAGGTGTGG + Intronic
1050091228 9:2017297-2017319 GGCTAAGTAGGGTGGAGGGGTGG + Intronic
1051812789 9:21069091-21069113 CCCGTTGCAGCCTGGAGGGGAGG + Intergenic
1053054930 9:34988588-34988610 CCCGATGCAGGGAGCAGGCGGGG - Intergenic
1053136891 9:35656727-35656749 GACGAAGCGGGGTGGAGGGATGG - Intergenic
1053266122 9:36714756-36714778 CCCGGTGCCTGGTGGAGGGGAGG - Intergenic
1053408047 9:37894769-37894791 CCCATAGGAGGGTGGAGGGTGGG - Intronic
1056583387 9:87912018-87912040 CACAGAGCAGGGTGGAGGGTTGG - Intergenic
1056583950 9:87916059-87916081 CACAGAGCAGGGTGGAGGGGTGG + Intergenic
1056612919 9:88136861-88136883 CACAGAGCAGGGTGGAGGGGTGG - Intergenic
1056613419 9:88140355-88140377 CACAGAGCAGGGTGGAGGGGTGG - Intergenic
1056658634 9:88528887-88528909 CCAGGAACAGGGTGGAGGTGGGG + Intergenic
1056901921 9:90607796-90607818 CCTGAAGCTGGGCGGAGGGTTGG + Intergenic
1057159666 9:92880097-92880119 CACAGAGCAGGGTGGAGGGGTGG - Intergenic
1057196595 9:93119067-93119089 CACGAAGTTGGGTGGTGGGGGGG - Intergenic
1057503363 9:95613313-95613335 CCCAAAGCAGGCTGGAGGGTTGG - Intergenic
1057908180 9:98998588-98998610 CCCGATGCTGGGTGGATGAGAGG + Intronic
1058037879 9:100273112-100273134 CCAGAATCAGGGTGGAAGTGGGG + Intronic
1059022680 9:110593679-110593701 CCCGTGGGAGGGTGGGGGGGTGG - Intergenic
1060403210 9:123360393-123360415 CCCGGGCCAGGCTGGAGGGGCGG - Intronic
1061540982 9:131277701-131277723 CCCCAAGCCGGGAGGAGGGTGGG - Intergenic
1061628499 9:131856537-131856559 CCCGGAGTGGGGTGGGGGGGGGG - Intergenic
1062153477 9:135033337-135033359 CCCGAGGCAGGGCAGAGCGGTGG - Intergenic
1062454687 9:136629936-136629958 CCTGTTGCAGGGGGGAGGGGAGG + Intergenic
1062521662 9:136960429-136960451 CCTGCAGCTGGGTGGCGGGGGGG + Intergenic
1185599993 X:1332228-1332250 CCAGACTCAAGGTGGAGGGGAGG + Intergenic
1185643590 X:1601332-1601354 CCAGCAGCAGGGAGGACGGGAGG + Exonic
1186704881 X:12130365-12130387 CAGGAAGCAGGGAGGAGGGAGGG + Intergenic
1187077291 X:15947787-15947809 CCAGCAGCAGGGTGGAGGGAAGG + Intergenic
1187369016 X:18688814-18688836 CTCGAAGCAAGGGGGAGGAGGGG + Intronic
1192283276 X:69706621-69706643 CTCGAAGAAGGGTGGGGGTGGGG + Intronic
1192331091 X:70175752-70175774 CCCAAAGCAGAGTGGGGGTGGGG + Intergenic
1193179660 X:78439915-78439937 CTCGAAGCAGGGTGGAGTGGGGG - Intergenic
1193417766 X:81244790-81244812 CCTGTAGCGGGGTGGAGGGAGGG - Intronic
1194453929 X:94079521-94079543 TCAGAAGCAGGGAGGAGGAGAGG - Intergenic
1194981871 X:100449748-100449770 CTAGAAGCAGGGTGCGGGGGTGG - Intergenic
1196134955 X:112198999-112199021 CCTGAAGCAGGCTGGCGCGGTGG + Intergenic
1196196240 X:112840887-112840909 CCCGGAGCAGGGCGGCGGGAGGG + Intergenic
1196405965 X:115362749-115362771 CCGGACACAGGGTGGAGGAGGGG + Intergenic
1198910384 X:141607114-141607136 CCTGGAGCAGGGTGGAGCTGGGG - Intronic
1199143180 X:144335075-144335097 GCTGAAGAAGGGGGGAGGGGTGG - Intergenic
1199847353 X:151700900-151700922 CTCGTAGGAGGGGGGAGGGGTGG - Exonic
1201969057 Y:19771548-19771570 CCCGCAGCAGTGTCTAGGGGTGG - Intergenic